ID: 1142534135

View in Genome Browser
Species Human (GRCh38)
Location 17:602045-602067
Sequence AAAGCACTGTGAAGGCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142534135_1142534146 25 Left 1142534135 17:602045-602067 CCTCCGGGCCTTCACAGTGCTTT 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1142534146 17:602093-602115 ACCCCGCCCCAACTCGAATCTGG 0: 1
1: 0
2: 0
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142534135 Original CRISPR AAAGCACTGTGAAGGCCCGG AGG (reversed) Intronic
902046415 1:13528056-13528078 ATAGCACGGTGAAGGCACAGAGG - Intergenic
902627574 1:17685394-17685416 ACAGCAGTGCAAAGGCCCGGAGG - Intronic
904580694 1:31541705-31541727 CTAGCAGTGTGAAGGCTCGGAGG - Intergenic
905026960 1:34857221-34857243 AAATCACTGTACAAGCCCGGGGG + Intronic
905911553 1:41658542-41658564 CATGCACTTTCAAGGCCCGGGGG - Intronic
906921806 1:50072446-50072468 AAAACAGTGAGAAGGCCCAGCGG - Intronic
907989808 1:59568708-59568730 AAACAGCTGTGAAGGCCCAGAGG - Intronic
908211213 1:61902248-61902270 AAACCACTGAGAATGCCCTGAGG + Intronic
911205664 1:95089731-95089753 AAAACTCTGTGCAGGCCCCGTGG + Intergenic
915286022 1:154852867-154852889 ATAGCAAGGTGAAGGCCCTGAGG - Intronic
915381568 1:155446016-155446038 AAAGTACAGTGTAGGCCCAGTGG - Intronic
919362136 1:196608940-196608962 ATAGCACAGTGACGGCACGGGGG + Exonic
920585306 1:207153296-207153318 GAAGCACTGGGAATGCCAGGAGG - Intergenic
921335177 1:214078432-214078454 AAAGTACTGTACAGGCACGGTGG - Intergenic
923199080 1:231694353-231694375 AAGGCACTGTGAGAGCCAGGAGG - Exonic
924800810 1:247328842-247328864 CAAGCACTGTGAAGACCCTGTGG - Exonic
1063100582 10:2946261-2946283 GAAGGACTGTGAAGCCCCGAGGG + Intergenic
1065820372 10:29519623-29519645 AAAGTACTGTGAAGGTAAGGGGG + Intronic
1066435525 10:35393793-35393815 AAAGCAGTGTGTGGGCACGGTGG + Intronic
1069184370 10:65404598-65404620 AAAGCATTGGAAAGGCCAGGAGG + Intergenic
1069622249 10:69845120-69845142 AAAGCACAGTGAAGTCTTGGAGG - Intronic
1072880860 10:99227647-99227669 AAAGCACTGTGAAAGGCCCTGGG - Intronic
1075437911 10:122459109-122459131 AAAGCACTGTGCTGGCACTGGGG + Intergenic
1076916818 10:133427111-133427133 ACAGCACGTTGAAGGCACGGTGG + Intergenic
1076936921 10:133571911-133571933 ACAGCACGTTGAAGGCACGGTGG + Intergenic
1077595781 11:3530137-3530159 ACAGCACAGTGAAGTCCCTGAGG - Intergenic
1081772206 11:45656976-45656998 AAACTACTGTGAAGCCCTGGGGG + Intronic
1084020286 11:66413307-66413329 AAAGCACTGTGGCGGCCGGGAGG + Intergenic
1084343667 11:68527827-68527849 ACAGCAGTGAGAAGGCCCTGAGG - Intronic
1085394664 11:76201222-76201244 AGAGCAGTGTGAAGGCCCAGGGG + Intronic
1086685625 11:89730401-89730423 GAAGCACTGGGTAGGACCGGAGG - Intergenic
1086747943 11:90453719-90453741 AAAGGACTGTGAAGCACTGGGGG + Intergenic
1092800829 12:12164484-12164506 CAAGCACAGCGAAGGCCCTGAGG + Exonic
1095709122 12:45269387-45269409 AATCCAGTGTGAAGGCCCAGAGG + Intronic
1097329185 12:58314681-58314703 ACAACACTGAGAAGGCCTGGAGG - Intergenic
1101363702 12:104051730-104051752 AAAACACTGGGAAGGGCAGGAGG - Intronic
1101745643 12:107539379-107539401 AAAGTGATGTGAATGCCCGGAGG + Intronic
1103558398 12:121779453-121779475 ACAGCACTGACAGGGCCCGGGGG - Exonic
1103869851 12:124083572-124083594 AGAGCACTGTGAAGAGCAGGCGG + Intronic
1105616169 13:22014837-22014859 AAAGCACTCTGTAGGCCTGCTGG - Intergenic
1105706283 13:22969432-22969454 ACAGCACTGGGCAGGCCTGGAGG - Intergenic
1105858935 13:24392890-24392912 ACAGCACTGGGCAGGCCTGGAGG - Intergenic
1107784790 13:43943993-43944015 AAAGAAATATGAAGGCCCTGAGG + Intergenic
1108742275 13:53350271-53350293 AAGCATCTGTGAAGGCCCGGAGG - Intergenic
1112381615 13:98896072-98896094 AAAGCAGTGTGCATGCCCGCTGG - Intronic
1121940930 14:98069972-98069994 AAATCACAGTGAAGGACCTGAGG + Intergenic
1122199655 14:100114689-100114711 AAAGCACGGTGCAGTCCCAGTGG - Intronic
1126268615 15:46785835-46785857 AAAGCAGTGTGAAAGACCGTGGG - Intergenic
1128423126 15:67513645-67513667 AAAGCACACTGAAAGCCAGGAGG + Intergenic
1128500402 15:68223241-68223263 AAAGCAGGGTAAAGGCCTGGAGG + Intronic
1129122781 15:73411940-73411962 GAAGCACTGAGAAGGTCCTGAGG + Intergenic
1132291319 15:100705734-100705756 TTAGCACTGGGAAGGCACGGAGG - Intergenic
1132640828 16:977600-977622 GAAGCACAGGGAGGGCCCGGCGG - Intronic
1132989664 16:2786277-2786299 AGAGCACTGTGAAGGTGCAGGGG + Intronic
1133101987 16:3485425-3485447 AGGGCAGGGTGAAGGCCCGGCGG - Intronic
1134155390 16:11838873-11838895 AAAAAACTGTGAAGACCCAGAGG + Intronic
1138297194 16:55897077-55897099 ACAGCAGTGAGAAGGCCCTGAGG - Intronic
1142499993 17:326925-326947 AGAGCACAGAGAAGGCCCTGGGG + Intronic
1142534135 17:602045-602067 AAAGCACTGTGAAGGCCCGGAGG - Intronic
1142847456 17:2689121-2689143 AAGAAACTGTGAAGGCCAGGTGG - Intergenic
1145221821 17:21095847-21095869 AAAGGACTGTGAGAGCCTGGAGG + Intergenic
1145957020 17:28861645-28861667 AAAGCACTGTGAGGGGCTGGGGG + Intergenic
1146714157 17:35069963-35069985 AAAGCACTGTGAACAGCAGGGGG + Intronic
1146968454 17:37052855-37052877 CAAGCCCTGTGCAGGCCGGGTGG + Intronic
1147367248 17:39967057-39967079 TAAGGACTGTGAAGGCCAGAAGG + Intronic
1150977997 17:70110370-70110392 AAATCACTGTGAAGGACCAAAGG - Intronic
1151291499 17:73153868-73153890 AAAGGCCTGTGAAGGGCAGGAGG + Intergenic
1156628123 18:38934287-38934309 AGAGCAGTGAGAAGGCCTGGAGG + Intergenic
1157625508 18:49047606-49047628 AGAGCACTGTGCAGGGCAGGTGG - Intronic
1160568705 18:79802264-79802286 AAAGCACTTAGAAGACCAGGTGG + Intergenic
1160802613 19:977275-977297 ACAGCTGTGTGAAGGCCCTGAGG - Intergenic
1161072511 19:2269911-2269933 AGAGCACTGCTAAGGCCGGGGGG - Intronic
1162346158 19:10119306-10119328 AACGCACTGGGATGGCCCTGTGG + Intronic
1164589406 19:29498100-29498122 AAAGCACGGTGAAGTCTTGGGGG + Intergenic
1165448554 19:35869630-35869652 AAAGGACAGTGAGGGCTCGGGGG - Intronic
1168432031 19:56288940-56288962 AAAGGAGTTTGAAGGCCCAGCGG - Intronic
925614826 2:5735148-5735170 AGGGCACTGTGAGGGCCCAGGGG - Intergenic
925888306 2:8412196-8412218 GAAGCACCGTGAAGGCACCGAGG - Intergenic
927848616 2:26485031-26485053 AAGGCACTGGGAAGCCCCAGAGG - Intronic
929907026 2:46055238-46055260 AAATCTCTGTGAGGGCCCCGTGG - Intronic
931016120 2:57982568-57982590 AAAGCACTCTGAAGGTTAGGTGG + Intronic
931416730 2:62088651-62088673 AAAGCAATGTGAAGGACTAGAGG - Intronic
933035216 2:77387699-77387721 CAAGAACTGTGAAGGGCCCGCGG - Intronic
939342805 2:140921879-140921901 AAAACACTGTGAAAGCCACGGGG - Intronic
943680909 2:190766711-190766733 AGAGGACTCTGAAGGCCTGGGGG - Intergenic
947744014 2:232498304-232498326 AAAGACCTGGGAAGGCCAGGGGG + Intergenic
947943354 2:234077774-234077796 TATGCACTGTGAAAACCCGGAGG + Intergenic
1170295445 20:14819770-14819792 TAGGCACTGGGAAGGCCCAGAGG + Intronic
1170590199 20:17765795-17765817 AAAGCCCTGTGCAGCCCTGGGGG + Intergenic
1172362740 20:34325572-34325594 AAAGAACTGGGCAGGCACGGTGG - Intergenic
1173824890 20:46041909-46041931 AATGCACAGAGAATGCCCGGGGG + Intronic
1175086232 20:56461409-56461431 CAAGCACTGTGATGGGCCTGAGG + Intergenic
1175111230 20:56649502-56649524 AAAGCACAGTGTAGGCCAGGCGG - Intergenic
1175834161 20:61982731-61982753 AATGCACTGCGAGGGCCCAGTGG + Intronic
1181054505 22:20254053-20254075 AGTGCACTGTGAATGCCCAGTGG - Intronic
1182445961 22:30389851-30389873 AATGCACTGTGGAAGCCCCGTGG + Intronic
1182820307 22:33210225-33210247 AAAGGCCTGTGGAGGCCGGGAGG - Intronic
1182877839 22:33707809-33707831 GTAGCACTGTGAGGGCCCTGGGG + Intronic
1183270764 22:36861225-36861247 GGAGCAGTGAGAAGGCCCGGGGG - Intronic
1184387127 22:44182612-44182634 AAAACACTGAGAAGACCCAGGGG + Intronic
950862938 3:16166346-16166368 AAAGCACTGTGAAGCCCTACTGG - Intergenic
953268829 3:41419712-41419734 GCATCACTGTGAAGGCCCGGGGG + Intronic
954177018 3:48852703-48852725 ACAGCACTGGGAAGGCCCCAGGG - Intergenic
956161694 3:66361674-66361696 AAACCACAATGAAGGCACGGTGG + Intronic
957065753 3:75520525-75520547 ACAGCACAGTGAAGTCCCTGAGG - Intergenic
961506583 3:127374470-127374492 CAGGCACTGTGAAGGCGGGGAGG + Intergenic
963035359 3:141020877-141020899 AAAGCACTGGGAACACCCAGTGG - Intergenic
969010350 4:4056585-4056607 ACAGCACAGTGAAGGCCCTGAGG - Intergenic
969743701 4:9053308-9053330 ACAGCATAGTGAAGGCCCTGAGG + Intergenic
971470766 4:27023702-27023724 AAATCACAGTGAAAGCCCTGGGG - Exonic
971544032 4:27861751-27861773 GAAGCACTGAGAATGCCTGGAGG - Intergenic
977266032 4:94856009-94856031 AAAGACCAGTGAAGGCCCAGGGG + Intronic
985529863 5:427623-427645 GAATCACTCTGCAGGCCCGGGGG + Exonic
985773471 5:1827455-1827477 AGAGGACTTTGAAGGCACGGGGG + Intergenic
985922693 5:2991938-2991960 CAGGCACTGAGAAGGCCCAGAGG - Intergenic
986207006 5:5634382-5634404 ACAGCACTGTGCAGGACCTGAGG - Intergenic
986372864 5:7098269-7098291 GAAGCACAGAGAAGGCCCAGTGG + Intergenic
988459180 5:31417224-31417246 AATGCACTGCAAAGGCCCTGAGG + Intronic
996579464 5:125015321-125015343 AAAGCACTGGGGAGGCGTGGGGG - Intergenic
997722480 5:136090431-136090453 ACAGCATGGTGAAGGCCCCGGGG + Intergenic
998631211 5:143900954-143900976 AATGGACTGTGAATGCCCTGAGG + Intergenic
999237552 5:150108116-150108138 ACAGCACAGTAAAGGCCTGGAGG + Intronic
1001565983 5:172699795-172699817 AGAGCACAGCGAAGGCCCAGGGG + Intergenic
1007039217 6:38705979-38706001 ACAAGACTGTGAAGACCCGGAGG - Intergenic
1007355473 6:41312207-41312229 AAAGAACTCTGAAGACCTGGAGG + Intergenic
1010034504 6:71308540-71308562 AGAGCACAGAGAAGGCCCAGTGG - Exonic
1011546139 6:88483481-88483503 AAGACAGTGTGAAGGCCCTGGGG + Intergenic
1011554623 6:88561801-88561823 AAAGCAGTGGGAGGGCCAGGTGG - Intergenic
1011802693 6:91035527-91035549 AAAGCACTGTGAAAGCAAGAAGG + Intergenic
1015884430 6:137901811-137901833 CAAGCTCAGTGAAGGCCAGGAGG + Intergenic
1016394708 6:143611284-143611306 AATGCACGGTGAAGGCGCAGGGG - Intronic
1017518585 6:155180960-155180982 AAAGCACAGTGAAGGCCAAGAGG - Intronic
1018066613 6:160129022-160129044 AAAGCAGTGTGGAGGGACGGGGG + Intronic
1018776772 6:167024298-167024320 AAGGCACTGTGGAAACCCGGAGG + Intronic
1018868718 6:167765166-167765188 AAAGCACTGTGACAGCCCTCAGG + Intergenic
1019586385 7:1806438-1806460 AAAGCACTGGCCAGGCACGGTGG - Intergenic
1020173253 7:5862050-5862072 AAGCCACTGTGAGGGCCCAGGGG - Intergenic
1020268245 7:6576264-6576286 ATAGCCCTGAGAAGGCCCTGTGG - Intergenic
1023849412 7:44141748-44141770 AAACCTCTGGGAAGCCCCGGGGG - Intergenic
1027004888 7:74684672-74684694 GAAGCACAGAGAAGGCCCGTGGG + Intronic
1027024390 7:74840469-74840491 GAAGCACAGAGAAGGCCCGTGGG - Intronic
1027063375 7:75103653-75103675 GAAGCACAGAGAAGGCCCGTGGG + Intronic
1028353367 7:89877306-89877328 AAAGCACTTTGATGGCATGGTGG + Intergenic
1029186883 7:98745693-98745715 AATGCACTGTGAAACCCCGCCGG - Intergenic
1029479562 7:100804289-100804311 AAAGAAATGTGAAGGCCAGGTGG - Intronic
1034675671 7:152891201-152891223 AAAGCACTGTGTGGGCGCTGTGG - Intergenic
1035740795 8:1926996-1927018 AAAGCACAGTGGAGCCCTGGAGG - Intronic
1036120014 8:6006166-6006188 AAATCACGGTGAAGGCCACGGGG + Intergenic
1036238227 8:7060958-7060980 AAACCACTGTCCAGGCCCTGTGG + Intergenic
1036295026 8:7528555-7528577 AAAACGCTGTGAGGGCTCGGGGG - Intergenic
1036327537 8:7792436-7792458 AAAACGCTGTGAGGGCTCGGGGG + Intergenic
1036446187 8:8823324-8823346 AATGTACTGTGAAGGCCCGGTGG + Intronic
1037040335 8:14223101-14223123 AAACCTCTGTGACGGGCCGGGGG - Intronic
1038421309 8:27435772-27435794 GAAACCCTGCGAAGGCCCGGAGG + Exonic
1039114359 8:34075587-34075609 AAAGCACTGATCAGGCCGGGCGG - Intergenic
1039257387 8:35734273-35734295 AAAGCACTGTGGAGGGGAGGAGG - Intronic
1040516850 8:48142820-48142842 CAAGCAGTGCGAAGGCCCTGTGG + Intergenic
1040582909 8:48712098-48712120 AAAGCACTGGGAAGTCTGGGAGG - Intronic
1044817879 8:96131498-96131520 AAAGAAGTGTGAAGGCTCTGTGG - Intergenic
1045097996 8:98818069-98818091 AAAGCTATGAGAAGGCCTGGAGG - Intronic
1047923660 8:129660960-129660982 AAAGCTATGTGAATGCCAGGAGG + Intergenic
1049409454 8:142465973-142465995 AGAGCCCTGTGGAGGCCCCGTGG + Intronic
1049409959 8:142468633-142468655 ACAGCTGTGTGAAGGCCCTGAGG - Intronic
1050701551 9:8345374-8345396 AAAGCATTGTGAAGCACTGGGGG - Intronic
1056999291 9:91492786-91492808 ATAGCAATGTGAAGGCAAGGAGG + Intergenic
1057733659 9:97633440-97633462 AAACCATTGAGAAGCCCCGGAGG + Exonic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060725639 9:126003888-126003910 ACAGCAGTGTGAAGGCCTGAAGG + Intergenic
1186559355 X:10594482-10594504 AAATCAGTGTCAAGGCCCTGAGG + Intronic
1189001377 X:36950778-36950800 AAAGGACTGTGAAGTCCAGCAGG + Intergenic
1189556603 X:42151856-42151878 AAAGGACTGTAAAGGCCAGAGGG - Intergenic
1191174147 X:57482015-57482037 AAAGCACTGAGGAGGCTGGGAGG - Intronic
1198732048 X:139742097-139742119 AAAACACTGTGAAGGCCATTTGG + Intronic
1199369615 X:147031933-147031955 AAAACACTGTGAAGGCAGGATGG - Intergenic