ID: 1142537987

View in Genome Browser
Species Human (GRCh38)
Location 17:633414-633436
Sequence AAGTTAATTCTGAAGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142537987_1142537990 25 Left 1142537987 17:633414-633436 CCCTGTTCCTTCAGAATTAACTT 0: 1
1: 0
2: 1
3: 32
4: 305
Right 1142537990 17:633462-633484 GCTCAAAACCACAATTTCTTTGG 0: 1
1: 0
2: 1
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142537987 Original CRISPR AAGTTAATTCTGAAGGAACA GGG (reversed) Intronic
900339084 1:2179312-2179334 AGGCTCATTCTGAAGGAACTGGG + Intronic
901028591 1:6292623-6292645 AAGTTAATTCTGGTTGTACAAGG + Intronic
901161365 1:7178634-7178656 GAGTTCCTTCTGCAGGAACAAGG - Intronic
904334633 1:29788766-29788788 AATTTAGTTCTGATGGCACAGGG - Intergenic
904570081 1:31457075-31457097 AAGAAAATTCAGAAGGAAAATGG - Intergenic
905107381 1:35572619-35572641 AAGATATTTCTGAAGCCACAGGG - Intergenic
906982971 1:50651001-50651023 ACGTTAACTCTGAAGGGAGATGG + Intronic
908424728 1:63995523-63995545 AACTTATTTCTGAATGCACAAGG + Intronic
908451643 1:64261926-64261948 AATTTTATCCTGAAGGAAAATGG - Intronic
908835928 1:68230306-68230328 AATTTAATTCTGAAAGCACAAGG + Intronic
909937958 1:81575983-81576005 AAGAGAATTCTGAAGGGAAAGGG - Intronic
915528830 1:156491815-156491837 AAGTTGAGCCTGAAGGAATAAGG - Intronic
918524042 1:185445830-185445852 AAGTTAACTCTCCAGCAACAAGG - Intergenic
918585249 1:186179797-186179819 AAGATAATAATGAAGTAACAGGG - Intronic
919546732 1:198931293-198931315 AAGTAAATTCTTTATGAACATGG - Intergenic
922635510 1:227166564-227166586 TAGGTAAGTCTGAAGGAAAAAGG - Intronic
923933974 1:238739356-238739378 AAGTTAATGAAGCAGGAACACGG + Intergenic
924735414 1:246751075-246751097 AAGAGAATTCTGAAGGAAAATGG - Intronic
1063282682 10:4648037-4648059 AATTTAATAATTAAGGAACAAGG + Intergenic
1063308919 10:4934664-4934686 AAGTTCATTCTCAAGTAATAAGG + Intronic
1064957426 10:20926262-20926284 AAGTAAATGCTGAAGTAACCTGG + Intronic
1065261717 10:23930769-23930791 AAGTTAACTCAGTGGGAACATGG + Intronic
1067131024 10:43565444-43565466 AAATTAAGTATGAAGGAATAAGG - Intronic
1067770770 10:49122164-49122186 AATTTAATTCTGAAGAACTAAGG + Intergenic
1068450555 10:57181123-57181145 GAGTGAATTCTGAAGAAAAAAGG - Intergenic
1068681477 10:59824940-59824962 AAGTGACTCCTCAAGGAACATGG + Intronic
1068707455 10:60092303-60092325 ATGTTAATAGTGAAGGGACAGGG - Intronic
1069212882 10:65783371-65783393 AAGAGAATTCTGAAGAAATAAGG - Intergenic
1069235371 10:66064853-66064875 ACTTTAATTCAGAAGGAACCAGG - Intronic
1069661145 10:70124245-70124267 AATTAAATTCAGAAGGAACAAGG + Intronic
1071895150 10:90058302-90058324 AAGAGAATTTTGAAGGAACATGG + Intergenic
1073946577 10:108757530-108757552 AAGTCAATTCTGATGAAACAAGG - Intergenic
1075620131 10:123921076-123921098 AAGTTACTTCTGAATGCACCAGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079295989 11:19234568-19234590 AAGTGACTTCTAAAGTAACAAGG + Intronic
1079535740 11:21513044-21513066 AAGTTTATTCTTAAGCAGCAAGG + Intronic
1079935713 11:26613983-26614005 AAGTTCTGTCTGAAGGGACAGGG + Intronic
1080245541 11:30175845-30175867 AAATTTATTTTGAAGAAACAGGG - Intergenic
1080549297 11:33357355-33357377 AACTTAATATTGAAGGAAAATGG - Intergenic
1080595676 11:33772886-33772908 AAATCAATTCTGCAGGAAGAAGG + Intronic
1085721584 11:78916972-78916994 AAATTAATTCTGAAGTACCTCGG + Intronic
1085837204 11:79969914-79969936 AAGTTATTTTTGTAGAAACAAGG + Intergenic
1086759375 11:90608278-90608300 AAGTTAATGCTGGAAAAACAGGG + Intergenic
1086987396 11:93265556-93265578 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1091398070 12:166061-166083 ACTTTAATTGTGAAGAAACATGG - Intronic
1092505921 12:9099932-9099954 AAATAACTTCTGAAGGAGCATGG - Intronic
1092595356 12:9998224-9998246 AAGGTAATACTGAAGGGTCATGG - Intronic
1092841473 12:12546417-12546439 AAGTTAAGAATGAATGAACAAGG + Intronic
1093356600 12:18174712-18174734 AAGTTAATTTGGAATAAACAAGG + Intronic
1093890224 12:24511032-24511054 AAGTAAATTCTGCGGGACCAGGG + Intergenic
1095288506 12:40446608-40446630 AAGATAATTGTGGAAGAACATGG + Exonic
1095307531 12:40655689-40655711 AAGTTGATTCAGAAGGAAATAGG - Intergenic
1095726825 12:45463003-45463025 AAGTTAATTATGAAATAACACGG - Intergenic
1096446327 12:51695901-51695923 GAGCTCATTCTTAAGGAACAGGG + Intronic
1097373123 12:58808398-58808420 TAGTTTATGCTGAAGGAAAATGG - Intronic
1098685696 12:73417280-73417302 AAGCTAATTCTGCATGAGCAAGG - Intergenic
1099422418 12:82478740-82478762 AAGTTTATGCTGAGGAAACAAGG - Intronic
1099687659 12:85910015-85910037 AAGTTACTTTTAAAGAAACATGG + Intergenic
1100363048 12:93895437-93895459 AAGTTAATTCTGTGGGAAGTGGG - Intergenic
1100759583 12:97792493-97792515 AAGAGAATTCTGAAGGAAGTTGG - Intergenic
1102108361 12:110345090-110345112 AAGATGATTCTGAAGGACCAGGG + Intronic
1102841234 12:116125973-116125995 AAATTAATTTTGAAGACACAAGG - Intronic
1103493892 12:121345751-121345773 ACGTGAATTCTAAATGAACAAGG + Intronic
1103662733 12:122534395-122534417 AAGTCAATCCTGAGGAAACAAGG + Intronic
1105688952 13:22816326-22816348 AATTTAATTCTTAAAGAAAAAGG + Intergenic
1106201458 13:27540901-27540923 TAGTTAAGTCTGAATTAACAGGG + Intergenic
1106845894 13:33737456-33737478 AAATTACTTCTGAAAGACCATGG + Intergenic
1106868692 13:33995564-33995586 AAGTTAAACTTGAAGGATCAGGG + Intergenic
1107691396 13:42957068-42957090 AAGTTAAGTCAGCAGGTACAGGG + Intronic
1108312240 13:49205738-49205760 AAGATAAATCTGAAAGAAAATGG - Intronic
1109513409 13:63408635-63408657 AATTTAATTCTGGAGGAAATTGG + Intergenic
1109704231 13:66068496-66068518 AAAATAATTCTAAAGAAACATGG + Intergenic
1110006283 13:70275244-70275266 GGGTTAATTATGAAGGAAAAAGG + Intergenic
1110053282 13:70932772-70932794 AAGTTAATACTGAAGGCAAATGG - Intergenic
1111010073 13:82301059-82301081 GAGTTAATTATCAAGGAAAAAGG - Intergenic
1113302575 13:109038146-109038168 GAGTTAATTCTGAAGAAAAGAGG - Intronic
1113416760 13:110134548-110134570 AAGGTATTTATGCAGGAACAAGG - Intergenic
1113525345 13:110970405-110970427 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1114143023 14:19938324-19938346 AAGGTAATTCTGCAGGCACCTGG + Intergenic
1114145949 14:19978773-19978795 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1114346002 14:21795937-21795959 AAATAATTTCTGAAGGAACTAGG - Intergenic
1115697490 14:35915047-35915069 AAGTTAACTCTTAAACAACATGG - Intronic
1116104656 14:40486791-40486813 AAGTTAAATATGAAGTAACTGGG + Intergenic
1116347562 14:43814367-43814389 AAGTTATTTCTGAAGAAAAAAGG + Intergenic
1118387006 14:65264356-65264378 AAAGTAATTATGAAGTAACAAGG - Intergenic
1119504386 14:75159293-75159315 GGCTTAATTCTGAAGGAAGAAGG + Intronic
1120060058 14:79971699-79971721 ATTTTAATTCTGAAGTAAGATGG + Intergenic
1122330631 14:100909991-100910013 ATGTTAATTCTCATGGAACCGGG + Intergenic
1122382641 14:101320415-101320437 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1123130503 14:105981855-105981877 GATTTCATTCTGAAGGACCAAGG + Intergenic
1123409951 15:20049944-20049966 GATTTCATTCTGAAGGACCAAGG - Intergenic
1123519283 15:21056651-21056673 GATTTCATTCTGAAGGACCAAGG - Intergenic
1123580742 15:21713076-21713098 GATTTCATTCTGAAGGACCAAGG + Intergenic
1123617391 15:22155699-22155721 GATTTCATTCTGAAGGACCAAGG + Intergenic
1124476914 15:30043139-30043161 AAGGTAATTGTGAAAGAAAACGG + Intergenic
1124911943 15:33929852-33929874 AAATTAATTCAGAACAAACAGGG + Intronic
1126351642 15:47750565-47750587 ATGTGCATTCTGAAGGAGCAAGG - Intronic
1126759533 15:51956637-51956659 TAGTTAATTCTTTAAGAACAAGG - Intronic
1126866475 15:52942619-52942641 GAGTTAATTCTAAAGGGACAAGG - Intergenic
1128177848 15:65572328-65572350 AAGATAAATCTGAAGAAAAAAGG - Exonic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1129557225 15:76524780-76524802 AAGTTAATTTTGAAAGATCTAGG + Intronic
1129596948 15:76972998-76973020 GAGTTAATTCTGGAGCCACAGGG - Intergenic
1130992523 15:88884603-88884625 AAATAAATTCTGAAGGAAAAGGG + Intronic
1202989612 15_KI270727v1_random:447321-447343 GATTTCATTCTGAAGGACCAAGG + Intergenic
1133593001 16:7264220-7264242 AAGGTAAATATGAAGGAAAAAGG + Intronic
1135106860 16:19657324-19657346 AAGTAAGTTCTAAAAGAACAGGG - Intronic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1141420020 16:83908567-83908589 AAAATAATTGTGAAGGAAGAAGG + Intronic
1142537987 17:633414-633436 AAGTTAATTCTGAAGGAACAGGG - Intronic
1145068475 17:19781573-19781595 AAGTAAACTCTCAAGGGACAAGG + Intronic
1145197355 17:20906370-20906392 AAGATAATTCTATAGGGACATGG + Intergenic
1149751861 17:59154205-59154227 AAGATAATGCTGAACGAAAAGGG + Intronic
1150008369 17:61483545-61483567 AGGTTAATACTGGAGCAACACGG - Exonic
1150199674 17:63341808-63341830 AAGTTAATTCAGAAGGCAATAGG - Intronic
1151055087 17:71021597-71021619 AAGGTAATTTAGAATGAACATGG - Intergenic
1151059808 17:71078892-71078914 AATCTTATTCTGAAGGAAGATGG + Intergenic
1151368707 17:73633738-73633760 AAGATAATTCAGAATCAACAAGG + Intronic
1153100822 18:1467441-1467463 ATGTTAAATCTGAACAAACAAGG - Intergenic
1153462506 18:5352272-5352294 AGGATAAATCTGAAGGAACTAGG + Intergenic
1153515590 18:5897766-5897788 GAGTTATTTTTAAAGGAACAAGG + Intergenic
1154979964 18:21495479-21495501 AAGGCACTTCTGAAGGAACGAGG - Intronic
1155226246 18:23732026-23732048 AATGTGATTCTGATGGAACAAGG + Intronic
1156459145 18:37311804-37311826 AAATTAAGTCAGAAGGAACAGGG + Intronic
1157843995 18:50985289-50985311 AAGTAAACTCTGAAAGCACATGG - Intronic
1158510383 18:58085170-58085192 ATGTGAATTCTGGGGGAACATGG + Intronic
1159366658 18:67474942-67474964 AAGTAAATTCTAAAGTAAAAAGG + Intergenic
1160347742 18:78148104-78148126 ATGTTGATGCTGAAGGATCAGGG + Intergenic
1160615098 18:80120167-80120189 AAGTGAACTCTGATGGGACATGG - Intronic
1161490743 19:4559854-4559876 AAGGAAATTCTGAAGGAAACAGG - Intergenic
1161862776 19:6810725-6810747 AAGTTGATTCTGAAGGATTGGGG + Intronic
1163929188 19:20372350-20372372 AAGTTAATACGGACTGAACAAGG + Intergenic
1164092802 19:21975113-21975135 AATTTAGTTCTGAAGGTACTAGG - Intronic
1164197013 19:22977411-22977433 AATTTACTTCTGAAGGGACTAGG - Intronic
1165568336 19:36752850-36752872 AAAGTAATACTGAAAGAACAGGG + Intronic
1168612291 19:57811068-57811090 CAGTAAATACTGAAGGAACTCGG + Intronic
927454705 2:23239530-23239552 ATGTTAAATCTCAAGGAACCAGG + Intergenic
927558603 2:24052984-24053006 AAGTAAACTCTAAAAGAACAGGG + Intronic
928043841 2:27907112-27907134 AAATTAATTCTCAAGCAACACGG - Intronic
928537697 2:32256468-32256490 AAGCTCATTGTGAAGAAACATGG - Intronic
928842842 2:35631638-35631660 AATTTGTTTCTGCAGGAACAGGG - Intergenic
930473126 2:51845862-51845884 AAATTAAGTCTGAGTGAACAGGG + Intergenic
930790989 2:55328679-55328701 TAATTAATTCTCAAGGAACCCGG + Intronic
931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG + Intergenic
933504574 2:83161242-83161264 AATGTAATGCTGCAGGAACATGG + Intergenic
935069486 2:99681475-99681497 ATGTGAATTTTGAGGGAACACGG - Intronic
937501254 2:122481565-122481587 ATGTTTATTGTGAAGGAAAAGGG + Intergenic
938317295 2:130339033-130339055 GAGCTAATTGTGAAGGAAGAAGG + Exonic
938629705 2:133153584-133153606 AACTTTATTCTGAAGGTAGAAGG - Intronic
939420479 2:141962182-141962204 TAGTTCACTCTGAAGTAACAAGG + Intronic
940352648 2:152706375-152706397 AAGAGAATTCAGAAGGAAAACGG + Intronic
940573822 2:155473969-155473991 ATGTTAATTCTGAGGGAATTTGG + Intergenic
941412075 2:165171202-165171224 AAGATGATTCTATAGGAACATGG - Intronic
941548753 2:166888397-166888419 AATCTGATTCTGATGGAACATGG + Intergenic
941570508 2:167164129-167164151 AAGTTAATTCTAAAGGAATATGG - Intronic
941856683 2:170238437-170238459 AAATTAATTCTGAAGCCAAATGG - Intronic
942204435 2:173605364-173605386 AAGTTAAGATAGAAGGAACAGGG - Intergenic
943954270 2:194166523-194166545 CAGTGGATTATGAAGGAACATGG - Intergenic
944181693 2:196902629-196902651 AAGTCAATCCTGAACGAACTTGG + Exonic
944622697 2:201533332-201533354 AAGTTATTTCTTATGGAAAAAGG + Intronic
945483551 2:210368844-210368866 AAGAAAATTCAGAAGGAAAATGG - Intergenic
945638236 2:212386749-212386771 AACTTAATTCTAAAAGAACAAGG - Intronic
945873232 2:215249813-215249835 AAATTATCTCTGAAGGAATAAGG + Intergenic
946040564 2:216779946-216779968 AAGTAGATTATGAAGGAAGAGGG + Intergenic
947252023 2:228117635-228117657 AAGTGAATTCTGTAGGAATGTGG - Intronic
947413642 2:229870310-229870332 AAGTTAAGCCTTAAGGCACAGGG + Intronic
947880016 2:233499887-233499909 AAGTTAATGCTGAAGAAATCTGG - Exonic
948017760 2:234703718-234703740 AACTTAATTCAAAAGGAACACGG + Intergenic
948549079 2:238756210-238756232 AAGATAAAACTGAAAGAACATGG - Intergenic
1168822939 20:788176-788198 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1169802176 20:9521651-9521673 AAATTAATTGTGGAAGAACAAGG - Intronic
1172906422 20:38373442-38373464 AAGTTAATATAGAAGGCACAAGG + Intronic
1173158940 20:40638412-40638434 AAGTTAATTATGTAGGAACCTGG - Intergenic
1173802932 20:45906115-45906137 AACCTAATTCTGTAGTAACAGGG + Intronic
1174080574 20:47968479-47968501 AGGTTAATTCTGGATGCACAGGG - Intergenic
1174136806 20:48385437-48385459 AGGTTAATTCTGGATGCACAGGG + Intergenic
1174491987 20:50906310-50906332 AGGCTAATTCTGAAGAAACCAGG + Intronic
1177974426 21:27829340-27829362 AAGTTATTTCTTAAGGAATCAGG - Intergenic
1178188657 21:30255117-30255139 AATTTAATTTTAAAGAAACAGGG + Intergenic
1178606946 21:34046066-34046088 AAGTAACTTCAGAAGAAACAAGG + Intergenic
1182132565 22:27867538-27867560 AAATTAAGTTTGGAGGAACATGG - Intronic
1182813958 22:33141718-33141740 AAGTGAATTGTGAAGGCACCAGG + Intergenic
1182863990 22:33586103-33586125 ATCTTAATCCTGAAGGAACTGGG - Intronic
1182916115 22:34033248-34033270 AAATTACTTCTCAAGGAACTAGG - Intergenic
949282747 3:2365503-2365525 CAGTTAATAATAAAGGAACAAGG + Intronic
949431302 3:3979027-3979049 AAGTTCATTTTTAATGAACAAGG + Intronic
950613916 3:14144369-14144391 AAGTTATTTCTGCAGAGACATGG + Intronic
951147616 3:19247486-19247508 AAGGTAATTCTGAAAGCATAGGG + Intronic
951855221 3:27188423-27188445 TAATTAATAATGAAGGAACAGGG - Intronic
954092408 3:48295517-48295539 ATGTCAAATCTGAAGAAACACGG - Intronic
954488297 3:50875404-50875426 AATATCATACTGAAGGAACAGGG - Intronic
957038173 3:75314061-75314083 GAGGTAATACTGAGGGAACATGG + Intergenic
957167139 3:76689950-76689972 AGGTTAATTCTCAAGGAGGAGGG - Intronic
957504338 3:81100401-81100423 AAGGAAATGCTGAAGGAACCAGG + Intergenic
959672864 3:108998603-108998625 AAGATAATTAGGAAGGAGCACGG + Intronic
959790958 3:110360536-110360558 AATTTAATTATGAAGCAACATGG + Intergenic
961176050 3:124835792-124835814 GAGTCAATTCTGCAGGAACTGGG + Intronic
962065163 3:131971893-131971915 TATGTAAGTCTGAAGGAACAAGG - Intronic
962422656 3:135241808-135241830 GAGTGAATTCTCAAGGAAGAAGG - Intronic
964254923 3:154765755-154765777 AAGTTAAATGTGGAGCAACAAGG + Intergenic
964389561 3:156183295-156183317 GAGATAAGTCTCAAGGAACAGGG + Intronic
964981668 3:162690405-162690427 AATTTAATTCCAAAGGAACCCGG - Intergenic
965431318 3:168592736-168592758 GAGTTAATTCTGAAGGGACTAGG - Intergenic
968419377 4:470461-470483 AAGTTAATTTTGGGAGAACAAGG + Intronic
968747129 4:2365817-2365839 GAATAAATTCTGAAGGAAAAGGG + Intronic
968835619 4:2962707-2962729 GAGTTACTTCCCAAGGAACAAGG + Intronic
969515041 4:7642561-7642583 AAGCTAATTCTCAAGAAGCAGGG + Intronic
969821013 4:9720305-9720327 AATTTTATCCTGAAGGGACATGG - Intergenic
970181214 4:13397339-13397361 CAGTTACTTCTGAAGGTAGAAGG + Intronic
971027297 4:22600759-22600781 AAGTTAATTTAGACGAAACAAGG + Intergenic
972935425 4:44128828-44128850 TAGTTAATGCTGCAGGAAAAGGG + Intergenic
973753999 4:54054266-54054288 AAGTTAAAACTGAAGTAAGAAGG - Intronic
974068935 4:57106661-57106683 AAATTAATTCTGAGGGAGAAAGG + Intronic
974173865 4:58300476-58300498 ACGTTAATCCTGAAGTTACAAGG - Intergenic
974977311 4:68906676-68906698 AAGTTAGTTCAGAAGGAAACTGG - Intergenic
975761252 4:77621982-77622004 AATTTAATTCTGAATGACCTTGG - Intergenic
976599549 4:86925662-86925684 ATGTTATCTATGAAGGAACAAGG - Intronic
977025895 4:91819448-91819470 AAGATAATTCTGAACTAAAATGG - Intergenic
977122239 4:93116729-93116751 AAGTAACTTCTGAAGGAAGAGGG + Intronic
977567867 4:98599341-98599363 AAGTCAAATCTAAAGAAACAAGG + Intronic
977981999 4:103335344-103335366 AAGTTCATCCTGAAGGAAGGAGG + Intergenic
978755724 4:112301010-112301032 AAGGTAATTATGAATGGACAAGG - Intronic
979393462 4:120156223-120156245 AGGTTAAGTTTTAAGGAACAAGG + Intergenic
979944958 4:126817028-126817050 AGGTTAGTGCTGAAGGAATACGG + Intergenic
980044643 4:127974026-127974048 AAGATAATCCTCAAGGAAAAGGG + Intronic
980843556 4:138296537-138296559 AAGTTTATTTTGAAAGAAAAAGG - Intergenic
981085828 4:140682475-140682497 AAGTCAATTCAGAAGGGAAAAGG + Intronic
981510102 4:145546969-145546991 AAGTCAGCTCTGGAGGAACAGGG - Intronic
983384662 4:167044455-167044477 AATTTAAGTCTGAAGTAAGAAGG - Intronic
983511155 4:168610783-168610805 AAGTCAATTCTGAAGATGCATGG - Intronic
983824746 4:172245011-172245033 AATTTTCTGCTGAAGGAACACGG + Intronic
984614546 4:181882053-181882075 AAGTTAATTCTGGAAGTTCAAGG + Intergenic
985321766 4:188720808-188720830 AGGTTAATTCTGCAGGACTAAGG - Intergenic
986244652 5:5996060-5996082 ATGTTAATTCTGAATGTAAATGG - Intergenic
986679322 5:10219269-10219291 CAGCTCATTCTGAAGGAACAAGG + Intergenic
987963546 5:24842150-24842172 ATGTTAATTCTGAAGAAATTAGG + Intergenic
988330124 5:29826743-29826765 AAGATAAAGCTGAAGAAACAGGG - Intergenic
989342178 5:40388268-40388290 AAGTTAATTATGAAGGAGGAAGG - Intergenic
990375048 5:55161494-55161516 AAGTAAATTCTTCAGGAAGATGG - Intronic
990960638 5:61390398-61390420 AATTTAATACTGGAGGAATAAGG - Intronic
990986735 5:61647801-61647823 AAGTGAGTTCTGAAGGAAAGAGG + Intronic
990989494 5:61671445-61671467 AAATAAATTCTGAAGAAACAGGG - Intronic
991243680 5:64486845-64486867 AAGTTAACATTGAAGGAAGATGG - Intergenic
991305935 5:65175903-65175925 AAGTTAATTTGGACTGAACAAGG + Intronic
991928068 5:71724717-71724739 AAATTAATTTTCAAGGAACTAGG - Intergenic
991970614 5:72137459-72137481 CATTTAATTCTGAATGAAGATGG - Intronic
992240128 5:74760055-74760077 AAGTAATTTCTAAAGAAACAAGG + Intronic
993550269 5:89264919-89264941 AACGTAATTCTGAAGCATCATGG - Intergenic
993773365 5:91960569-91960591 AAGTTATTTCTGAAGGGATACGG + Intergenic
996208487 5:120774621-120774643 AAGTTAATTCCTAAAGATCAGGG - Intergenic
996243816 5:121235303-121235325 AAGTTAATTATGAGGAAACATGG + Intergenic
998114721 5:139527388-139527410 AAGTTAATTTAGACTGAACAAGG + Intronic
1000828096 5:166071016-166071038 GAGTTTATTCTGAAAGAACAAGG + Intergenic
1000846164 5:166282971-166282993 AAATTAATCCTAAAGGAAGAGGG + Intergenic
1001195332 5:169668353-169668375 AAGGAAACTCTGAAGCAACAGGG - Intronic
1001461820 5:171922521-171922543 AAGGCAATTCAGAAGGAAGAAGG + Intronic
1001558575 5:172654187-172654209 AAGTTAATTTGGAATGAACAAGG - Intronic
1001795809 5:174501546-174501568 AAGTGAAGTCTGATGGGACAAGG - Intergenic
1003975877 6:11344027-11344049 AAGTTATTTCTCAAGAGACAGGG + Intronic
1004443617 6:15676896-15676918 AAGTAAATTCTGGGGAAACATGG - Intergenic
1004812724 6:19277294-19277316 AAGTTAATATGGACGGAACAAGG + Intergenic
1004847003 6:19655166-19655188 AAGTAAATTGTGAAGGTATATGG - Intergenic
1008043806 6:46831448-46831470 AAGACAATTCTGAACTAACAGGG + Intronic
1008432164 6:51432018-51432040 AAGCTAATTTTAAAGAAACAAGG - Intergenic
1008718623 6:54321339-54321361 CAATTAATTCTGAACGAACAAGG - Exonic
1009506983 6:64496414-64496436 TAGTTAATTTTTAAGGCACAAGG + Intronic
1010095820 6:72043770-72043792 AAGGTAACTCTGAAGAAGCATGG + Intronic
1010336940 6:74696835-74696857 AATTTATTTCTAAAGGAACAAGG + Intergenic
1012655445 6:101813312-101813334 AACTTAGCTCTGAAGGAAGACGG + Intronic
1012741419 6:103020415-103020437 AAGTTAAATATTAAAGAACATGG + Intergenic
1013748517 6:113373974-113373996 AAGTTATTTCTGAGGGAATGAGG - Intergenic
1014117871 6:117686624-117686646 CAGTTATTTCTGAATGAATATGG + Intronic
1014427686 6:121328860-121328882 AAATTACTTCTAAAGTAACAAGG - Intronic
1014885782 6:126779624-126779646 AACTTAATTCTATAAGAACATGG + Intergenic
1015490680 6:133822118-133822140 AAGTTAACTTTGAAGCATCAGGG - Intergenic
1016234537 6:141847286-141847308 AAGATAATTCTGAATGATAATGG + Intergenic
1017273405 6:152536174-152536196 AATGGGATTCTGAAGGAACAAGG - Intronic
1018424762 6:163670393-163670415 GAGTTCATTCTGGAGGAAAATGG + Intergenic
1018444657 6:163844264-163844286 ACCTTAATTATCAAGGAACAAGG + Intergenic
1019807007 7:3135162-3135184 AAGATGGGTCTGAAGGAACAAGG + Intergenic
1020626735 7:10590273-10590295 ATTATAATTCTGAAGGAAGACGG - Intergenic
1021011250 7:15469786-15469808 AAGTTAATTTTGAAGGGGCTAGG + Intronic
1022241864 7:28520184-28520206 TAGTTCATACTGAAGGAACACGG - Intronic
1023106201 7:36765370-36765392 AAATTAAATATCAAGGAACAGGG + Intergenic
1023516088 7:41003264-41003286 GAGTTAAATCTGAAGGTAAATGG - Intergenic
1023798959 7:43816430-43816452 AAGTTAATTTGGACTGAACAAGG + Intergenic
1026842513 7:73678083-73678105 ATGTGAATTTTGAAGGGACAAGG + Intergenic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1028178124 7:87681076-87681098 AAGTTAATTGTGGAGGAAATGGG + Intronic
1029970179 7:104780900-104780922 AAGTCAAGTCTGAGGGATCAAGG - Intronic
1030265777 7:107620579-107620601 TAGGTAATTCTGATGGAAAAAGG - Exonic
1030914915 7:115300866-115300888 AAGATAATTTTGAAAGAAAATGG + Intergenic
1032103748 7:129006213-129006235 AAGTTATTTCTGAAACAACTTGG - Intronic
1033097691 7:138445164-138445186 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1034686211 7:152973550-152973572 AAGTTGATTTTGAAAGATCATGG - Intergenic
1035003767 7:155639719-155639741 AATCTAATTCTGAAGAAAAAAGG - Intronic
1035005164 7:155651942-155651964 AAATTATTTCTAAAGCAACATGG + Intronic
1036104572 8:5826003-5826025 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1037144037 8:15551827-15551849 AAGTAACTTTTGAAGGAAAAGGG - Intronic
1038116068 8:24556665-24556687 AAATAAATTCTCAAGAAACAAGG - Intergenic
1038826311 8:31006153-31006175 AAGTTATTTCTGTAGGAAACTGG - Intronic
1041212822 8:55569753-55569775 AAGTGAAGTCTGATGGGACAAGG - Intergenic
1041439679 8:57881326-57881348 CAGTTAACTCTGGAGCAACAGGG + Intergenic
1041540645 8:58981252-58981274 AAGGTAATTGGGAAGGAAGATGG - Intronic
1042358967 8:67860714-67860736 AAATTAATTCACAAGGACCAAGG - Intergenic
1042983796 8:74560583-74560605 AAGATAATTCTAAAGGAAAGAGG + Intergenic
1043157308 8:76799874-76799896 AAGTGAAAGCTGAATGAACACGG - Intronic
1043183564 8:77116656-77116678 TAGTGAATTTAGAAGGAACAGGG - Intergenic
1044252592 8:90021539-90021561 ATGTTAATTCTGAAAGAAATAGG + Intronic
1044397178 8:91726681-91726703 AAGCTAATTCTGAAAGAAGTGGG - Intergenic
1046408755 8:113811367-113811389 AAGTAAATTTAGAAGGAATAAGG + Intergenic
1046513845 8:115233058-115233080 AATTTAAATCTGATGGGACAGGG - Intergenic
1051527349 9:18061055-18061077 AAGTTCATTCTTAAGATACAAGG - Intergenic
1052740344 9:32386227-32386249 AAGTTATTTCCAAAAGAACAAGG + Intronic
1053486413 9:38460122-38460144 AACTTAATGCTGAGGGGACACGG + Intergenic
1055840232 9:80494471-80494493 GTGGTAATTCTGCAGGAACATGG - Intergenic
1058725081 9:107795215-107795237 AAGCAAAATCTGATGGAACATGG - Intergenic
1059836269 9:118157419-118157441 AAGTGCAATCTGAAGGAAGAAGG + Intergenic
1059846059 9:118278211-118278233 AAGAGAATTCAGAAGGAACCAGG + Intergenic
1059933079 9:119280844-119280866 TATTTAATTCTGAAAGAGCAGGG + Intronic
1061787033 9:133035583-133035605 AAGAGAATTCTGAAGGGAAATGG - Intronic
1062131781 9:134899234-134899256 TAGACAATTCTGAAGGAAAAAGG + Intergenic
1187481484 X:19659790-19659812 AAGTGAGTTCAGTAGGAACATGG - Intronic
1188124239 X:26348150-26348172 AAATTGATTCTGAAGCAACATGG - Intergenic
1188225011 X:27586586-27586608 ACGTTAATTATGAAAGGACACGG - Intergenic
1188659605 X:32742670-32742692 AAGTAAATTATGAAGATACAAGG + Intronic
1188690988 X:33128928-33128950 AAGTTAATTCTTAAGGCAAATGG + Intronic
1188879294 X:35472140-35472162 AAGGTAAATCTAAAGGAACAGGG + Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189108141 X:38257408-38257430 CAGTTAATTGTGAAAGCACATGG + Intronic
1190216246 X:48481340-48481362 AAGGTAAGTCTCAAGGAACTTGG + Exonic
1191921875 X:66265555-66265577 AAGTTAATTATGGGGGTACAAGG + Intronic
1195003594 X:100665636-100665658 AAGTTCATTGTGAAAGTACAAGG + Exonic
1197353610 X:125406498-125406520 TAGTGGATTTTGAAGGAACATGG - Intergenic
1197576780 X:128222737-128222759 GATTTAATCCTGAAGGAAGAAGG + Intergenic
1197826982 X:130600473-130600495 AAGTTGGTTCGGAATGAACAAGG + Intergenic
1197903561 X:131399183-131399205 ATGTAAATGCTGAAGGAAAAGGG + Intronic
1199247059 X:145617627-145617649 AAGTTAATGGTGAAAGAAAAAGG - Intergenic
1200303501 X:155001937-155001959 AAATTAATTCTGGAGGTAGATGG - Intronic