ID: 1142541164

View in Genome Browser
Species Human (GRCh38)
Location 17:660631-660653
Sequence GGGCCCTCGTCCTTCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541164_1142541175 14 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541175 17:660668-660690 GTGTGGTGCATCCTTGGTGAAGG 0: 1
1: 0
2: 3
3: 8
4: 132
1142541164_1142541169 -8 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541169 17:660646-660668 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541164_1142541180 29 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541180 17:660683-660705 GGTGAAGGACGAGGGCCCCTGGG 0: 1
1: 1
2: 4
3: 11
4: 156
1142541164_1142541177 21 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541177 17:660675-660697 GCATCCTTGGTGAAGGACGAGGG 0: 1
1: 0
2: 1
3: 4
4: 113
1142541164_1142541171 -3 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541171 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541164_1142541168 -9 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541168 17:660645-660667 CGAGGGCCCCTGGGTGCTGCTGG 0: 2
1: 0
2: 4
3: 34
4: 353
1142541164_1142541174 8 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541174 17:660662-660684 TGCTGGGTGTGGTGCATCCTTGG 0: 1
1: 2
2: 2
3: 17
4: 236
1142541164_1142541179 28 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541179 17:660682-660704 TGGTGAAGGACGAGGGCCCCTGG 0: 1
1: 1
2: 1
3: 13
4: 185
1142541164_1142541176 20 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541176 17:660674-660696 TGCATCCTTGGTGAAGGACGAGG 0: 1
1: 0
2: 1
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541164 Original CRISPR GGGCCCTCGTCCTTCCCCAA GGG (reversed) Intronic