ID: 1142541169

View in Genome Browser
Species Human (GRCh38)
Location 17:660646-660668
Sequence GAGGGCCCCTGGGTGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 2, 1: 0, 2: 4, 3: 33, 4: 346}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541157_1142541169 16 Left 1142541157 17:660607-660629 CCTGGTGCTGCTGGGTGTGGTGC 0: 1
1: 0
2: 3
3: 38
4: 420
Right 1142541169 17:660646-660668 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541165_1142541169 -9 Left 1142541165 17:660632-660654 CCTTGGGGAAGGACGAGGGCCCC 0: 1
1: 1
2: 2
3: 26
4: 219
Right 1142541169 17:660646-660668 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541155_1142541169 18 Left 1142541155 17:660605-660627 CCCCTGGTGCTGCTGGGTGTGGT 0: 1
1: 0
2: 6
3: 30
4: 411
Right 1142541169 17:660646-660668 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541156_1142541169 17 Left 1142541156 17:660606-660628 CCCTGGTGCTGCTGGGTGTGGTG 0: 1
1: 2
2: 7
3: 63
4: 538
Right 1142541169 17:660646-660668 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541164_1142541169 -8 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541169 17:660646-660668 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541169 Original CRISPR GAGGGCCCCTGGGTGCTGCT GGG Intronic