ID: 1142541171

View in Genome Browser
Species Human (GRCh38)
Location 17:660651-660673
Sequence CCCCTGGGTGCTGCTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 2, 1: 1, 2: 7, 3: 68, 4: 509}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541155_1142541171 23 Left 1142541155 17:660605-660627 CCCCTGGTGCTGCTGGGTGTGGT 0: 1
1: 0
2: 6
3: 30
4: 411
Right 1142541171 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541156_1142541171 22 Left 1142541156 17:660606-660628 CCCTGGTGCTGCTGGGTGTGGTG 0: 1
1: 2
2: 7
3: 63
4: 538
Right 1142541171 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541157_1142541171 21 Left 1142541157 17:660607-660629 CCTGGTGCTGCTGGGTGTGGTGC 0: 1
1: 0
2: 3
3: 38
4: 420
Right 1142541171 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541164_1142541171 -3 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541171 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541165_1142541171 -4 Left 1142541165 17:660632-660654 CCTTGGGGAAGGACGAGGGCCCC 0: 1
1: 1
2: 2
3: 26
4: 219
Right 1142541171 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541171 Original CRISPR CCCCTGGGTGCTGCTGGGTG TGG Intronic