ID: 1142541172

View in Genome Browser
Species Human (GRCh38)
Location 17:660652-660674
Sequence ACCACACCCAGCAGCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 2, 1: 0, 2: 5, 3: 43, 4: 334}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541172_1142541184 23 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541184 17:660698-660720 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541172_1142541176 -1 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541176 17:660674-660696 TGCATCCTTGGTGAAGGACGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
1142541172_1142541182 18 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541182 17:660693-660715 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541172_1142541175 -7 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541175 17:660668-660690 GTGTGGTGCATCCTTGGTGAAGG 0: 1
1: 0
2: 3
3: 8
4: 132
1142541172_1142541179 7 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541179 17:660682-660704 TGGTGAAGGACGAGGGCCCCTGG 0: 1
1: 1
2: 1
3: 13
4: 185
1142541172_1142541181 17 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541181 17:660692-660714 CGAGGGCCCCTGGGTGCTGCTGG 0: 2
1: 0
2: 4
3: 34
4: 353
1142541172_1142541180 8 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541180 17:660683-660705 GGTGAAGGACGAGGGCCCCTGGG 0: 1
1: 1
2: 4
3: 11
4: 156
1142541172_1142541177 0 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541177 17:660675-660697 GCATCCTTGGTGAAGGACGAGGG 0: 1
1: 0
2: 1
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541172 Original CRISPR ACCACACCCAGCAGCACCCA GGG (reversed) Intronic