ID: 1142541173

View in Genome Browser
Species Human (GRCh38)
Location 17:660653-660675
Sequence CACCACACCCAGCAGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 2, 1: 1, 2: 9, 3: 73, 4: 579}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541173_1142541175 -8 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541175 17:660668-660690 GTGTGGTGCATCCTTGGTGAAGG 0: 1
1: 0
2: 3
3: 8
4: 132
1142541173_1142541182 17 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541182 17:660693-660715 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541173_1142541179 6 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541179 17:660682-660704 TGGTGAAGGACGAGGGCCCCTGG 0: 1
1: 1
2: 1
3: 13
4: 185
1142541173_1142541177 -1 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541177 17:660675-660697 GCATCCTTGGTGAAGGACGAGGG 0: 1
1: 0
2: 1
3: 4
4: 113
1142541173_1142541181 16 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541181 17:660692-660714 CGAGGGCCCCTGGGTGCTGCTGG 0: 2
1: 0
2: 4
3: 34
4: 353
1142541173_1142541184 22 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541184 17:660698-660720 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541173_1142541180 7 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541180 17:660683-660705 GGTGAAGGACGAGGGCCCCTGGG 0: 1
1: 1
2: 4
3: 11
4: 156
1142541173_1142541176 -2 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541176 17:660674-660696 TGCATCCTTGGTGAAGGACGAGG 0: 1
1: 0
2: 1
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541173 Original CRISPR CACCACACCCAGCAGCACCC AGG (reversed) Intronic