ID: 1142541174

View in Genome Browser
Species Human (GRCh38)
Location 17:660662-660684
Sequence TGCTGGGTGTGGTGCATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 2, 2: 2, 3: 17, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541165_1142541174 7 Left 1142541165 17:660632-660654 CCTTGGGGAAGGACGAGGGCCCC 0: 1
1: 1
2: 2
3: 26
4: 219
Right 1142541174 17:660662-660684 TGCTGGGTGTGGTGCATCCTTGG 0: 1
1: 2
2: 2
3: 17
4: 236
1142541164_1142541174 8 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541174 17:660662-660684 TGCTGGGTGTGGTGCATCCTTGG 0: 1
1: 2
2: 2
3: 17
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541174 Original CRISPR TGCTGGGTGTGGTGCATCCT TGG Intronic