ID: 1142541176

View in Genome Browser
Species Human (GRCh38)
Location 17:660674-660696
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541172_1142541176 -1 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541176 17:660674-660696 TGCATCCTTGGTGAAGGACGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
1142541173_1142541176 -2 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541176 17:660674-660696 TGCATCCTTGGTGAAGGACGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
1142541165_1142541176 19 Left 1142541165 17:660632-660654 CCTTGGGGAAGGACGAGGGCCCC 0: 1
1: 1
2: 2
3: 26
4: 219
Right 1142541176 17:660674-660696 TGCATCCTTGGTGAAGGACGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
1142541170_1142541176 0 Left 1142541170 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 0
2: 6
3: 45
4: 430
Right 1142541176 17:660674-660696 TGCATCCTTGGTGAAGGACGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
1142541164_1142541176 20 Left 1142541164 17:660631-660653 CCCTTGGGGAAGGACGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1142541176 17:660674-660696 TGCATCCTTGGTGAAGGACGAGG 0: 1
1: 0
2: 1
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type