ID: 1142541178

View in Genome Browser
Species Human (GRCh38)
Location 17:660679-660701
Sequence GGGGCCCTCGTCCTTCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541178_1142541189 9 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541189 17:660711-660733 CTGGGTGTGGTGCACCCTTGGGG 0: 3
1: 0
2: 4
3: 26
4: 182
1142541178_1142541190 13 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541190 17:660715-660737 GTGTGGTGCACCCTTGGGGAAGG 0: 2
1: 0
2: 1
3: 12
4: 159
1142541178_1142541188 8 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541188 17:660710-660732 GCTGGGTGTGGTGCACCCTTGGG 0: 2
1: 0
2: 0
3: 20
4: 180
1142541178_1142541193 30 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541193 17:660732-660754 GGAAGGACCACAGAAAATCCAGG 0: 1
1: 0
2: 2
3: 26
4: 218
1142541178_1142541182 -9 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541182 17:660693-660715 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541178_1142541181 -10 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541181 17:660692-660714 CGAGGGCCCCTGGGTGCTGCTGG 0: 2
1: 0
2: 4
3: 34
4: 353
1142541178_1142541187 7 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541187 17:660709-660731 TGCTGGGTGTGGTGCACCCTTGG 0: 2
1: 1
2: 0
3: 27
4: 205
1142541178_1142541184 -4 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541184 17:660698-660720 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541178 Original CRISPR GGGGCCCTCGTCCTTCACCA AGG (reversed) Intronic