ID: 1142541182

View in Genome Browser
Species Human (GRCh38)
Location 17:660693-660715
Sequence GAGGGCCCCTGGGTGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 2, 1: 0, 2: 4, 3: 33, 4: 346}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541178_1142541182 -9 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541182 17:660693-660715 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541172_1142541182 18 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541182 17:660693-660715 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541173_1142541182 17 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541182 17:660693-660715 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346
1142541170_1142541182 19 Left 1142541170 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 0
2: 6
3: 45
4: 430
Right 1142541182 17:660693-660715 GAGGGCCCCTGGGTGCTGCTGGG 0: 2
1: 0
2: 4
3: 33
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541182 Original CRISPR GAGGGCCCCTGGGTGCTGCT GGG Intronic