ID: 1142541184

View in Genome Browser
Species Human (GRCh38)
Location 17:660698-660720
Sequence CCCCTGGGTGCTGCTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 2, 1: 1, 2: 7, 3: 68, 4: 509}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541173_1142541184 22 Left 1142541173 17:660653-660675 CCTGGGTGCTGCTGGGTGTGGTG 0: 2
1: 1
2: 9
3: 73
4: 579
Right 1142541184 17:660698-660720 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541178_1142541184 -4 Left 1142541178 17:660679-660701 CCTTGGTGAAGGACGAGGGCCCC 0: 1
1: 1
2: 0
3: 11
4: 131
Right 1142541184 17:660698-660720 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541170_1142541184 24 Left 1142541170 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 0
2: 6
3: 45
4: 430
Right 1142541184 17:660698-660720 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509
1142541172_1142541184 23 Left 1142541172 17:660652-660674 CCCTGGGTGCTGCTGGGTGTGGT 0: 2
1: 0
2: 5
3: 43
4: 334
Right 1142541184 17:660698-660720 CCCCTGGGTGCTGCTGGGTGTGG 0: 2
1: 1
2: 7
3: 68
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541184 Original CRISPR CCCCTGGGTGCTGCTGGGTG TGG Intronic