ID: 1142541726

View in Genome Browser
Species Human (GRCh38)
Location 17:664920-664942
Sequence CAGGGAATGCAGGAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1160
Summary {0: 1, 1: 1, 2: 9, 3: 103, 4: 1046}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142541713_1142541726 23 Left 1142541713 17:664874-664896 CCCGGGTTTTGGTTGAAAAGCCA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG 0: 1
1: 1
2: 9
3: 103
4: 1046
1142541719_1142541726 -3 Left 1142541719 17:664900-664922 CCAGGGTTCACTGTCTGAACCAG 0: 1
1: 0
2: 0
3: 13
4: 253
Right 1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG 0: 1
1: 1
2: 9
3: 103
4: 1046
1142541718_1142541726 3 Left 1142541718 17:664894-664916 CCAAGGCCAGGGTTCACTGTCTG 0: 1
1: 0
2: 12
3: 30
4: 265
Right 1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG 0: 1
1: 1
2: 9
3: 103
4: 1046
1142541714_1142541726 22 Left 1142541714 17:664875-664897 CCGGGTTTTGGTTGAAAAGCCAA 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG 0: 1
1: 1
2: 9
3: 103
4: 1046

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142541726 Original CRISPR CAGGGAATGCAGGAGGAGGA CGG Intronic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900418518 1:2545858-2545880 CAGGAAGTGCAGGAGGAGGGTGG + Intergenic
900475199 1:2873199-2873221 CAGGGAGTTGGGGAGGAGGAAGG - Intergenic
900605532 1:3521950-3521972 CAGGGACTTCAGGGAGAGGAAGG + Intronic
900621656 1:3590371-3590393 CAGAGAATCCATGAGCAGGAAGG + Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900753745 1:4418633-4418655 GAGGGAAGGAAGGAGGAGGAGGG - Intergenic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
901214932 1:7550004-7550026 GAGGGAAGGAAGGAGGAGGAGGG + Intronic
901229666 1:7634683-7634705 CTGGGGCTGCCGGAGGAGGAAGG + Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901948818 1:12725281-12725303 CAGGGACTTCAGGAAGTGGATGG - Exonic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903034895 1:20486780-20486802 CAGGGCCTCCAGGAGGGGGAGGG + Intergenic
903051320 1:20603392-20603414 AAGGGAATGGAGGAGCAGCAAGG - Intronic
903201106 1:21739806-21739828 CAGGGAGTGGAGGTGGTGGATGG - Intronic
903269564 1:22178795-22178817 CAGAGAAGGAAGGAGAAGGAAGG - Intergenic
903460005 1:23514258-23514280 GAGGCACAGCAGGAGGAGGATGG + Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
904011091 1:27391159-27391181 CAGGGAACATGGGAGGAGGAGGG - Intergenic
904027813 1:27515784-27515806 CAGGGAATGTGGGAGGAGAAGGG - Intergenic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904494862 1:30880786-30880808 CACAGAATGCCTGAGGAGGAGGG + Intronic
904591457 1:31617763-31617785 CCGGGACTGCAGGAGGGGGCCGG - Exonic
904848400 1:33438416-33438438 CAGGGAAGGCAGGAGACAGAAGG - Intergenic
904945782 1:34197786-34197808 CAGGACGTGCAGGAGGAGGTCGG - Exonic
904978904 1:34480033-34480055 GGGGCAATGCAGGAGGAGGAGGG + Intergenic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905388579 1:37621586-37621608 GAGGGACCACAGGAGGAGGAGGG + Intronic
905632167 1:39524913-39524935 CAGGGAAGGGAGGAGGCGAAAGG + Intronic
905643547 1:39608975-39608997 CTGGGAGTGCTGGTGGAGGAAGG + Intergenic
905866869 1:41381502-41381524 AAGAGAGTGTAGGAGGAGGAGGG - Intronic
906069961 1:43008920-43008942 ATGGGAATGTGGGAGGAGGAGGG + Intergenic
906169971 1:43716733-43716755 TAGGGACTGCATGAGGAGGCCGG + Intronic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906436651 1:45802425-45802447 CAGGGAATAGAGGAGCAGGCTGG + Intronic
906681165 1:47726301-47726323 CAGAGAATGAAGGGGGAGTAAGG - Intergenic
907278553 1:53330017-53330039 CACAGAGTGGAGGAGGAGGAGGG - Intergenic
907332134 1:53678309-53678331 CTGGGAGTGCAGGAGGGTGAGGG + Intronic
907481653 1:54749054-54749076 TAGGGAACACAAGAGGAGGAAGG - Intergenic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
907859522 1:58338279-58338301 GAGGGAGAGCAGGAGGAGGGAGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908894436 1:68882470-68882492 CTGGGACTGTAAGAGGAGGAGGG + Intergenic
909132433 1:71754630-71754652 TAGGGAATGCAGGTGGGGGTGGG - Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909609736 1:77539624-77539646 CGGGGACTGCAGGAGAAGCAGGG + Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910570331 1:88694278-88694300 CAGGGGATGGAGGAGAGGGAAGG - Intronic
911149091 1:94580026-94580048 GATGGAATGCCTGAGGAGGAAGG - Intergenic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911406665 1:97449346-97449368 CAGAGAATTGAGGAGGAGGGAGG + Intronic
911490255 1:98556181-98556203 CAGGGAATGGAAAAGGAAGAGGG + Intergenic
912449520 1:109760586-109760608 CAGGCAGAGCAAGAGGAGGATGG - Intronic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
912887359 1:113488958-113488980 AAGGGAATGCAGCTGGAGCAGGG - Intronic
912961143 1:114196932-114196954 CAGAGATTGGAGGAGGGGGAGGG + Intergenic
913111842 1:115664142-115664164 CAGGTAATGGATGAAGAGGAGGG - Exonic
913332699 1:117680471-117680493 AAGGGAATGAATGAGCAGGAAGG - Intergenic
914196779 1:145451871-145451893 CAGGCAAAGTGGGAGGAGGAGGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914758523 1:150580041-150580063 CAGGGGTTGAAGGAAGAGGACGG + Intergenic
915148093 1:153807391-153807413 GAGGGAAGGGAGGAGGTGGAAGG + Exonic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915273417 1:154771909-154771931 CAGGGAAGGGAGGAGGAGTAGGG - Intronic
915279178 1:154810603-154810625 TAGGGAAACCAGGAGAAGGAAGG + Intronic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915488147 1:156236245-156236267 CAAGGAATGAAGGAGGCGGAAGG - Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915952489 1:160198759-160198781 GAGGGAAGGCAGGGGGAGGTGGG + Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916145237 1:161732641-161732663 CAAGGAATTCAGGAGTTGGATGG - Intergenic
916944458 1:169711863-169711885 CAATGAGTGAAGGAGGAGGAGGG - Intronic
917069802 1:171137956-171137978 CAGTGAATGCTAGAGCAGGAAGG - Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
917591707 1:176482916-176482938 CATGTAATGAGGGAGGAGGATGG + Intronic
917630211 1:176884212-176884234 AGGGCAATGCAGGAGGAGCAGGG - Intronic
918315185 1:183317242-183317264 CAGGGTATGCTGGAGGATGTGGG - Intronic
918457003 1:184731587-184731609 GAGGGAGGGCATGAGGAGGAAGG - Intronic
918653720 1:186998706-186998728 TGGGGGTTGCAGGAGGAGGATGG - Intergenic
919401968 1:197129759-197129781 CGGGGAATGAGGGTGGAGGAAGG + Intronic
919420908 1:197369338-197369360 GAGGGGATGCAGGAGGAGAGGGG - Intronic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
920031496 1:203040067-203040089 CTGGGAATGCAGGAGGGAGCAGG + Intronic
920379530 1:205527664-205527686 CAGGGTGTGCAGGAGAATGAGGG + Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920820104 1:209372262-209372284 CAGGAAATGGAGGAAGTGGAAGG + Intergenic
921380907 1:214523742-214523764 CAGCCACCGCAGGAGGAGGAGGG - Intronic
921739054 1:218662948-218662970 CAGGGATTTCATGAGGATGATGG - Intergenic
921747878 1:218758259-218758281 CAGGGAGGGAAGGAGGAGGTGGG + Intergenic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
922772726 1:228196363-228196385 CAGGGTCTGCAGGGGGAGTAGGG - Intergenic
922790072 1:228306401-228306423 CAGAGTCTGCAGGCGGAGGAGGG + Exonic
922818823 1:228470430-228470452 GGGGGAGTGCAGGAGGAGGTGGG + Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923474699 1:234321517-234321539 CAAAGAATGTAGGGGGAGGACGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924279521 1:242422210-242422232 GAGGGAGGGCAGGAGGAGAAGGG + Intronic
924365110 1:243284605-243284627 CACGGAATGCAAGAGGGGGCTGG + Intronic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
1062950065 10:1492450-1492472 CAGAGATTGAAGGAGCAGGAAGG + Intronic
1062972485 10:1659794-1659816 CAGGCAATGGAGGAAGAGGGTGG - Intronic
1062972515 10:1659915-1659937 CAGGCAATGGAGGAAGAGGGTGG - Intronic
1062972546 10:1660036-1660058 CAGGCAATGGAGGAAGAGGGTGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063088741 10:2842669-2842691 CAAGGAATACAGGAAGAGAAGGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063556140 10:7081437-7081459 TGGGGAATGCAGGCAGAGGAGGG - Intergenic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1064008301 10:11715152-11715174 GAGGGAAAGAGGGAGGAGGAAGG + Intergenic
1064287325 10:14003186-14003208 CACGGAATAGAGGAGCAGGACGG + Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1064978873 10:21146505-21146527 CTGATAATGCAGGAGTAGGATGG - Exonic
1065024193 10:21526033-21526055 CCGGGAATGGAGGATTAGGAAGG - Intergenic
1066602842 10:37126028-37126050 CCGGGGCTGCAGGAGGAGGTGGG + Intronic
1066626819 10:37415527-37415549 GAGGGAAAGGAGGAGAAGGAGGG + Intergenic
1066792445 10:39080803-39080825 TAGGGGTTGCAGGAGGATGAAGG + Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067147302 10:43702924-43702946 CAAGGAAGGAAAGAGGAGGAAGG - Intergenic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068709771 10:60121332-60121354 GAGGGAGTGCAGGGGGTGGAGGG + Intronic
1069617210 10:69813809-69813831 CAGGGACTGCAGGAGAGGGCTGG - Intronic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069771739 10:70904815-70904837 CAGGGAGTGGAGGAGGAAGCTGG + Intergenic
1069773513 10:70913875-70913897 AGGTGAATGGAGGAGGAGGAGGG + Intergenic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1070330255 10:75411196-75411218 AAGGGGATGCTGGAGGAGGTTGG + Intergenic
1070338047 10:75472287-75472309 CAGGTAATGAAGGAGGCAGAAGG + Intronic
1070750535 10:78961645-78961667 GAGTGAATGCAGGAGGTGGTGGG + Intergenic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1071821328 10:89284155-89284177 GAGGGGTTGCTGGAGGAGGAGGG + Intronic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1071967767 10:90869998-90870020 GAGGGATTGAGGGAGGAGGATGG + Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073319022 10:102602763-102602785 CCGGGAAGGCAGTGGGAGGAGGG - Intronic
1074226854 10:111493431-111493453 AAGGGAAGGGAGGAGAAGGAAGG - Intergenic
1074532246 10:114305657-114305679 GAGGGGATGCAGGTGCAGGAGGG + Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074693339 10:116026475-116026497 CAGGGAATGCAGATGGAGTCTGG + Intergenic
1074808138 10:117074723-117074745 CAGGAAATGCAGCAGTAGGCAGG + Intronic
1074828130 10:117229152-117229174 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1074828586 10:117232280-117232302 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1075265801 10:120998997-120999019 CTGGGCCTGCAGGAGGAGCAAGG + Intergenic
1075663503 10:124214676-124214698 CAGGCAGAGCAGGAAGAGGAGGG + Intergenic
1075668268 10:124245831-124245853 CAGGGACTGCAGGAGGATGCTGG + Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075922461 10:126224683-126224705 CAGGGAAGGCAGGAAGCAGAGGG - Intronic
1075924515 10:126239976-126239998 CACGGAAGGATGGAGGAGGAGGG - Intronic
1076009359 10:126974994-126975016 TATGGGAGGCAGGAGGAGGAAGG - Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076694803 10:132242310-132242332 GGGGGAGTGCAGCAGGAGGACGG + Intronic
1076755839 10:132571169-132571191 CTGGGAATGCAGCATGAGGCAGG + Intronic
1076816735 10:132918793-132918815 CAGGGGATGCAGGAGGAGTTGGG - Intronic
1076891066 10:133283675-133283697 CAGGGAATGCGGGAGAGGCAGGG - Intronic
1076891081 10:133283729-133283751 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1076891086 10:133283748-133283770 CAGGGAATGCAGGGAGACGCAGG - Intronic
1076891089 10:133283766-133283788 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1077068710 11:657268-657290 CAGGGAATGCAAGAGGAGGCTGG + Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077237712 11:1489880-1489902 CTGGGAATGCAGGGGGAGCCTGG - Intronic
1077249083 11:1552841-1552863 CGGGGGCTGCAGGAGGAGGTAGG - Intergenic
1077497352 11:2892609-2892631 GAGGGAAGGAAGGAGGAGGGAGG - Intronic
1077592381 11:3502419-3502441 CAGGGGCTGCAGGAGGGGGTAGG - Intergenic
1077998911 11:7477064-7477086 AAGAGATTGGAGGAGGAGGAAGG + Intergenic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078578760 11:12522964-12522986 GAGGGAATGTAGAAGGGGGAGGG + Intronic
1079003811 11:16778877-16778899 CAGGGAATCCGGCCGGAGGAAGG - Intronic
1079006082 11:16791956-16791978 GAGGGAATTTAGGAGGTGGAAGG - Intronic
1079074919 11:17378681-17378703 CAGGGAATGAGAAAGGAGGAAGG + Intergenic
1079505954 11:21152156-21152178 AATGGAATGCAGGGGGTGGAGGG + Intronic
1079826410 11:25200990-25201012 GAAGGAATGAAGGAGGAGGGAGG + Intergenic
1080695937 11:34603043-34603065 CAGGGAAGACAAGAGGAGAAGGG - Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1082079445 11:48000741-48000763 GAGGAAATGAAGGAGGATGATGG - Intronic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082767337 11:57180215-57180237 CGGGGATTCCAGGAGGAGGGAGG + Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083106478 11:60363210-60363232 CAGGGAAAGATGGAAGAGGAAGG - Intronic
1083152333 11:60799655-60799677 AAGAGAATCCAGGTGGAGGAAGG - Intronic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1084005843 11:66323082-66323104 CAGGCAAAGCAGGAGAAGAAAGG + Intergenic
1084476082 11:69390565-69390587 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
1084677397 11:70643901-70643923 AAGGGACTGCAGGTGGAGGGGGG + Intronic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1085309369 11:75507110-75507132 CAGGGAAAGAAAGAGGAGAAGGG + Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1085965509 11:81518314-81518336 CTGGGAATACAGGAAAAGGAAGG + Intergenic
1086947798 11:92860466-92860488 GAGAGAAGGCAGGAGAAGGAGGG + Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087701785 11:101443403-101443425 TAGGGAAGGCAGGACAAGGAAGG - Intergenic
1088318382 11:108530455-108530477 CAGGGAAGGCAATAGGAAGATGG + Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088737011 11:112736113-112736135 CAAGGCAGGCAGGAGCAGGAGGG + Intergenic
1088897117 11:114086971-114086993 CAGGAAATACCAGAGGAGGAGGG - Intronic
1088909754 11:114181897-114181919 CAGGCAAGGCAAGAGGAGCAAGG - Intronic
1089369443 11:117944603-117944625 CACGGAAAGAAGGACGAGGAAGG + Intergenic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090241907 11:125189814-125189836 CAGGGAAGGAAGGAGAGGGAGGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1090902562 11:131045880-131045902 CAGGGAAGGAAGGAGGTGGCGGG + Intergenic
1091012899 11:132022653-132022675 CAGGGAATTCAAGAGAAGCATGG - Intronic
1091113890 11:132996023-132996045 CATGGATGGCAGGGGGAGGATGG - Intronic
1091119340 11:133043648-133043670 CAAAAAATGCATGAGGAGGAAGG - Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091233176 11:134001580-134001602 CAGGGAAGGCAGGCATAGGATGG - Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091652909 12:2323098-2323120 CAGGGAAGGAAGGAGGAAGGCGG - Intronic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1091972288 12:4797414-4797436 CTGAGAGTGCTGGAGGAGGAGGG + Intronic
1092118836 12:6029505-6029527 CAAGAAATCCAGGAGGATGAAGG + Intronic
1092140791 12:6182108-6182130 CAGGGGATGGAGGAGGAGTTGGG + Intergenic
1092164246 12:6333265-6333287 CACAGAATACAGGAGGGGGAAGG + Intronic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092493446 12:8967976-8967998 AAGGGAAGGAAGGAGGAGGGAGG + Intronic
1092834013 12:12471088-12471110 CAGGAAATGCAGGATGTGGCCGG - Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1093465112 12:19440398-19440420 CCGGGAGTTCAAGAGGAGGAAGG - Intronic
1093812026 12:23503069-23503091 CGGGTAATGCAGGTAGAGGACGG + Intergenic
1094170507 12:27486336-27486358 AAGGGGATGCAGGAGAAGGCTGG - Intronic
1094636710 12:32233528-32233550 GAAGGAAGGAAGGAGGAGGAAGG - Intronic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096467620 12:51856067-51856089 CCGGGAATGAAGGAGGCGGGCGG + Intergenic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096798606 12:54094367-54094389 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1096806270 12:54143041-54143063 CAAGGAAGGAAGAAGGAGGATGG + Intergenic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097189077 12:57210903-57210925 CAGGGCATGCGGGAGGGTGACGG + Intronic
1099890445 12:88583202-88583224 CAGGGAATGGTGGAGGTGGGAGG - Intergenic
1100447932 12:94678504-94678526 GAGGGAGGGCAAGAGGAGGAAGG - Intergenic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1101403874 12:104411599-104411621 GAGATGATGCAGGAGGAGGAAGG - Intergenic
1101841311 12:108329269-108329291 CAGGGATGGCAGGAGGAGGTCGG - Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102745191 12:115243846-115243868 GAGGGAAGGAAGGAGGAGAAGGG + Intergenic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1102866920 12:116382030-116382052 CAAGGAATGCAGAAGGGGGGTGG - Intergenic
1102988380 12:117297172-117297194 CAAGGATTGCAGGAGGGAGAGGG + Intronic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1103877551 12:124140419-124140441 CAGGGAATGCTGGGGGACCATGG + Intronic
1103892328 12:124249334-124249356 TAGGGAATGAAGGAGGGGGTGGG + Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1103977557 12:124713404-124713426 CAGGGAAGGCAGGAGGAACGGGG + Intergenic
1104024144 12:125013980-125014002 GATGGAATGCAGGTGGAGGTGGG - Intronic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1105008858 12:132740909-132740931 CCAGGAGTACAGGAGGAGGAAGG + Intronic
1105038573 12:132944157-132944179 TCCGGAAAGCAGGAGGAGGAAGG - Intronic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1105891726 13:24686926-24686948 CAGGGAAGGCAGGAGGGTGGAGG + Intronic
1107430696 13:40337837-40337859 CTGGGGATGCACGTGGAGGAAGG + Intergenic
1107851641 13:44577344-44577366 CGCGGAGCGCAGGAGGAGGAGGG + Intergenic
1107917641 13:45168900-45168922 GAGGGAAGGAAGGAGGAGGGAGG - Intronic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108519628 13:51234655-51234677 GATGGAAGGAAGGAGGAGGAAGG + Intronic
1108546893 13:51503891-51503913 GAGGAAATGAAGGAGCAGGAAGG + Intergenic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1110215509 13:73020609-73020631 CAGGTAATAGAGGAGGATGAAGG - Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110713105 13:78671587-78671609 CTGGGAATCCAGGAGGTAGAAGG + Intergenic
1110882408 13:80588204-80588226 TAGGAAATGCAGGCGGAAGAAGG + Intergenic
1111405529 13:87799614-87799636 CAGGGAAAGAAGGAAGAGCATGG + Intergenic
1112202549 13:97291094-97291116 GAGGGATGGTAGGAGGAGGAAGG + Intronic
1112280151 13:98055933-98055955 CAGGCAATGAAAGAGGAGAAGGG + Intergenic
1112458550 13:99583344-99583366 CAGGGATGGAGGGAGGAGGAAGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113646313 13:111998946-111998968 CGGGGGATGCAGGAGGAGAGAGG + Intergenic
1113802890 13:113095686-113095708 CAGGGCCTGGAGCAGGAGGACGG - Intronic
1113957718 13:114108157-114108179 CAGGGGATGACGGAGGATGATGG - Intronic
1114265703 14:21071406-21071428 CAGGGAGTGGAGGAGGGGCAGGG + Intronic
1114450058 14:22819581-22819603 GGGGAAGTGCAGGAGGAGGATGG - Intronic
1114657030 14:24322478-24322500 CAGGGAGTGAAGGAGAAGAAAGG + Intronic
1114675074 14:24434845-24434867 CATGGCCTGCAGGAGGAGGTGGG + Intronic
1115129130 14:30032586-30032608 CATAGAATGCAGGAGGACAAAGG - Intronic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116950748 14:50876452-50876474 CTGAGAATACAGGAGCAGGAAGG + Intronic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1118034884 14:61856079-61856101 AAGGGAGTGCAGGAGGAGGGAGG + Intergenic
1118451584 14:65907235-65907257 AAGGGAATGAGGGAGAAGGAAGG + Intergenic
1118760622 14:68878559-68878581 TCGGGAAGGCAGGAAGAGGAAGG + Intronic
1118878986 14:69810302-69810324 CAGGGACAGCAGGAGGAGCTGGG - Intergenic
1119211645 14:72836439-72836461 CAGGGCAGGCAGGAGCAGGGAGG - Intronic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120212750 14:81650140-81650162 GAGGGAATGAAGGTTGAGGAGGG - Intergenic
1121098359 14:91233480-91233502 GAAGGAAGGCAGGAGGGGGAAGG - Exonic
1121111132 14:91313882-91313904 CAGCGACTCCAGGAGGAGAACGG - Exonic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121592393 14:95125746-95125768 CAGGGAGGGGAGGAGGGGGAGGG + Intronic
1121605255 14:95235873-95235895 TCGGGCATGCAGGAGGCGGAGGG + Intronic
1121607722 14:95253514-95253536 CAGGGAATGCAGGGAGATGGAGG + Intronic
1121622982 14:95363065-95363087 CAGGGAAGGTTGGATGAGGACGG - Intergenic
1121993336 14:98582480-98582502 AAGGTAATGCAGGAGGAGACCGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122196539 14:100091574-100091596 CAAAGGATGCAGGAAGAGGATGG - Intronic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122364309 14:101185427-101185449 CAGAGTCTGCAAGAGGAGGAAGG + Intergenic
1122487989 14:102094535-102094557 AAGGGCATGCAGGAGAGGGAGGG + Intronic
1122731658 14:103804187-103804209 CAAGAAATGCAGGATGAGGCAGG + Intronic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1123043541 14:105500243-105500265 CAGAGGCTGCAGGTGGAGGAGGG - Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124512200 15:30336845-30336867 CAGGGAAAGTAAGAGGAGGCAGG + Intergenic
1124730714 15:32193906-32193928 CAGGGAAAGTAAGAGGAGGCAGG - Intergenic
1124788943 15:32708364-32708386 CAGGGACTCAAAGAGGAGGAAGG + Intergenic
1124889072 15:33715011-33715033 CAAGGGATGCATGAGGAAGAAGG + Intronic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1126064920 15:44819366-44819388 CAGAGACTGCAGCAAGAGGAGGG - Intergenic
1126094914 15:45081221-45081243 CAGAGACTGCAGCAAGAGGAGGG + Intergenic
1126652835 15:50943034-50943056 CAGGGAGGGCAGGAGGGGAAAGG - Intronic
1126921429 15:53529942-53529964 GAGGAAATGTAGCAGGAGGAAGG - Intronic
1127306275 15:57708504-57708526 AAGGGAATGCAGGAAGAATAGGG - Intronic
1127642508 15:60929265-60929287 GAGGGAGGGCTGGAGGAGGAGGG - Intronic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128585431 15:68845367-68845389 CACGGGATGCAGGTGGAGGGAGG - Intronic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1128994908 15:72288996-72289018 CAGGGAGTGTGGGAGGTGGACGG + Intronic
1129227138 15:74176555-74176577 CAGGGAATGGGAGAGGAGGATGG + Exonic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129810847 15:78508347-78508369 AAGGGAATGTAGGAGAAGAAAGG + Intronic
1130093634 15:80840568-80840590 CAGGGAATGCTGTAGGAGCCAGG - Intronic
1130140321 15:81220819-81220841 GAAGGAAGGAAGGAGGAGGAAGG + Intronic
1130461390 15:84160086-84160108 CAGGCAAGGCAGGAGGTGGCCGG - Intergenic
1131407219 15:92175343-92175365 CATGGGATGCAGGAAGTGGAGGG - Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131809501 15:96158172-96158194 CAAGGAAAGCTGGAGGAGAAAGG + Intergenic
1131852141 15:96554731-96554753 GAGGTGATGGAGGAGGAGGAGGG - Intergenic
1131892016 15:96983352-96983374 CTGGGAATGCAGTGGGAGGGAGG + Intergenic
1132093972 15:98968545-98968567 CAGGAAATGCTGGAAGAGGTGGG - Exonic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1132703601 16:1231876-1231898 CAGAGAATGGAGGAGAAGCAGGG - Intergenic
1132704908 16:1239485-1239507 CAGAGAATGGAGGAGAAGCAGGG + Intergenic
1132707917 16:1254519-1254541 CAGAGAATGGAGGAGAAGCAGGG + Intergenic
1133379468 16:5318001-5318023 AGGGGAATGCAGGTGCAGGAAGG + Intergenic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1133821373 16:9239704-9239726 AAAGAAATGCAGGAGGAGAAGGG - Intergenic
1134023867 16:10940407-10940429 CAGGTAATGCAGGAGAGGGGTGG + Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1135074346 16:19380720-19380742 GATTGAATGAAGGAGGAGGAGGG - Intergenic
1135189620 16:20344179-20344201 CAGGGAATGGGGGTGGAGGGGGG + Intronic
1135195470 16:20390497-20390519 TAGGGAATGCATGGGGTGGATGG - Intronic
1135985769 16:27182848-27182870 GAGGGAAGGCAAGAGAAGGAGGG + Intergenic
1136474881 16:30506678-30506700 CAGGGAAAGATGGAGGAGGGAGG - Intronic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137668901 16:50267847-50267869 CAGGAAGTGCAGGAGGCTGAGGG + Intronic
1137776415 16:51058415-51058437 CAGGAAATCCAGGAGCAGAATGG + Intergenic
1138106045 16:54287486-54287508 CTGGGAATGGGGGAGGAGCAGGG + Intergenic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138597140 16:58035078-58035100 AAGGGAATGCAGCTGGAGGCCGG - Intronic
1138849039 16:60604785-60604807 CATGGCAGGCAGGAGGAAGAGGG + Intergenic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1140041932 16:71413861-71413883 CAGGCAGTGCAGGAGGAGGGTGG + Intergenic
1140155982 16:72427186-72427208 ATGGGAGTGAAGGAGGAGGAGGG + Intergenic
1140177660 16:72679951-72679973 CAGGGGCTGCAGGGTGAGGAGGG + Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140788450 16:78366455-78366477 CAATGAATGCAGGAGAAGAAAGG - Intronic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1141075618 16:81004409-81004431 CAGGGACTGCCTGGGGAGGAAGG + Intronic
1141405503 16:83789282-83789304 CAAGGATTGGAGAAGGAGGAGGG + Intronic
1141417495 16:83887688-83887710 CGGGGAATTCAGAAGGAGGGAGG + Intergenic
1141461707 16:84181767-84181789 CAGGCAATGCAGGTGGAGAAAGG - Exonic
1141659491 16:85434353-85434375 CCGGGTATACAGGAGGCGGACGG - Intergenic
1141692701 16:85605642-85605664 CCGGGGGTGCAGGGGGAGGATGG - Intergenic
1141740991 16:85892865-85892887 CAGTGAAGGCTGGAGTAGGAAGG + Intergenic
1141741515 16:85896310-85896332 CAGGGAAGGGATGAGGAGGCCGG + Intergenic
1141798567 16:86291580-86291602 CAGGGAGTGCATGAGGAAGCTGG + Intergenic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1141859942 16:86709689-86709711 CAGGGACTGGATGCGGAGGACGG + Intergenic
1141862600 16:86728202-86728224 CAGGGAATGCGGGAGCAGGGTGG + Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141964768 16:87434444-87434466 CAGCGAAGGCTGGTGGAGGAAGG - Intronic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1142878164 17:2864813-2864835 GAGGTAATTCAGGAGGGGGAGGG - Intronic
1142968327 17:3594788-3594810 GAGGGACTGCAGGAGGGGGCAGG + Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143421000 17:6792285-6792307 GAGGGAATGTAGGAGAAGGAGGG - Intronic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1144036991 17:11376137-11376159 CAGAGACTGCAGGACAAGGAAGG + Intronic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144312000 17:14022748-14022770 CAGGTAATGCATGAGGGGAAGGG - Intergenic
1144332758 17:14238571-14238593 CAGGTAATGCATGAGGGGAAGGG + Intergenic
1144555893 17:16282604-16282626 CAGAGAATGCAGGAGTTAGAAGG - Intronic
1144580437 17:16456077-16456099 GAGGGAGAGGAGGAGGAGGAAGG + Intronic
1144665348 17:17098587-17098609 GAGGGAATCCAGGAGAAAGAAGG + Intronic
1144730328 17:17522291-17522313 CAGGAAGTTCAGGAGCAGGATGG + Exonic
1144764112 17:17723696-17723718 GGGGGAAGGGAGGAGGAGGAGGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146661165 17:34666003-34666025 CGGGGACCGCAGGAGGAGGTGGG + Intergenic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147544944 17:41393989-41394011 TAGGGAATGCCAGAGGAGCAAGG - Exonic
1147579981 17:41622735-41622757 CAGGGAATAGAAGAGAAGGAGGG - Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1148560652 17:48604091-48604113 GAGGGATGGCAGGAGGGGGAGGG + Intronic
1148615174 17:48996198-48996220 CAGGAACGGCGGGAGGAGGAGGG + Intergenic
1148697964 17:49572460-49572482 CAGGGAAGGCTGGAGGCAGAGGG + Intergenic
1149176305 17:53876082-53876104 TAGGGGGTGCAGGGGGAGGAAGG - Intergenic
1149567467 17:57650306-57650328 CAGGGGATGCTGGAGGGAGAGGG - Intronic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152268613 17:79310643-79310665 TGGGGAATGCGGGAGGAGGGTGG - Intronic
1152340810 17:79723385-79723407 CAGGGTATGAAGGGGGTGGAGGG + Intergenic
1152448234 17:80359084-80359106 CAGGGAATGAGGGACGGGGAGGG - Intronic
1152555721 17:81052287-81052309 GAGGGAAGGCAGGACTAGGAGGG - Intronic
1152727089 17:81952798-81952820 CAGGGAAAGCCGGGGCAGGAGGG + Exonic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1152926855 17:83091295-83091317 AAGCAAATGCAGGAGGAGGTGGG + Intronic
1203168922 17_GL000205v2_random:128709-128731 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1153029826 18:703220-703242 CTGGGAATGGAGGAGGAGAGGGG + Intronic
1153321088 18:3774918-3774940 CAGGGAGTGCAGGAGGTGGTGGG - Intronic
1153642096 18:7166006-7166028 AAGGCAATGCAGGCGGAGGTTGG + Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153927544 18:9847355-9847377 CAGGGAGCTAAGGAGGAGGAGGG - Intronic
1154122474 18:11663127-11663149 CAGGTAACCAAGGAGGAGGAGGG + Intergenic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1155032786 18:21998767-21998789 TAGGGATGGCAGGGGGAGGAGGG + Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155248383 18:23932974-23932996 CAGGGATTGGAGCAGGAGGTGGG + Intronic
1155845415 18:30699514-30699536 CAGAGAATGCTGGAAGAGGGGGG + Intergenic
1156454964 18:37287663-37287685 CAGGGAATCCAGGAGGGCCATGG - Intronic
1156463222 18:37333317-37333339 GAGGGAGTGGAGGGGGAGGAGGG - Intronic
1157005406 18:43577443-43577465 GAGGGAAAGAAGGAGAAGGAGGG - Intergenic
1157145554 18:45158977-45158999 GAGGGAAAGGAGGAGGAGAAAGG - Intergenic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157545430 18:48543181-48543203 CAGGTCATGAAGGAGGAGGCAGG + Intronic
1157570198 18:48707104-48707126 TGGGGAGTGCAGGAGGTGGAGGG + Intronic
1157586790 18:48806128-48806150 GAGGGAATGTGGGAGCAGGAAGG + Intronic
1157622322 18:49023786-49023808 CCAGGCATGGAGGAGGAGGAAGG - Intergenic
1157729133 18:49988711-49988733 CTGGGAAGGAAAGAGGAGGATGG + Intronic
1158570024 18:58590384-58590406 CCAGGAATGCAGGGGGAGGGAGG + Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158600427 18:58851702-58851724 CAGTGAATGAAGTTGGAGGAAGG + Intergenic
1159310225 18:66698355-66698377 GAGGGAGGGGAGGAGGAGGAAGG + Intergenic
1159310249 18:66698427-66698449 GAGGGAGGGGAGGAGGAGGACGG + Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1160239792 18:77114920-77114942 CAGGGAGAGCAGGAATAGGAAGG - Intronic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160965734 19:1746195-1746217 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1160965798 19:1746366-1746388 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1161026462 19:2039497-2039519 CTGGGAATCCAGGCAGAGGAGGG + Exonic
1161139588 19:2639694-2639716 CAGGGAGTGGGGGAGGAGGGGGG + Intronic
1161347907 19:3777290-3777312 TGGGGGAGGCAGGAGGAGGAGGG + Intergenic
1161520983 19:4723471-4723493 GAGGGAAAGAAGGTGGAGGAGGG + Intronic
1161964403 19:7540324-7540346 CAGGGGCTGCTGCAGGAGGATGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162207989 19:9070330-9070352 CTCAGAATGGAGGAGGAGGAGGG + Intergenic
1162419927 19:10560312-10560334 GAGGAAATGGAGGAAGAGGAGGG - Exonic
1162467138 19:10849075-10849097 GAGGGAGGGCAGGAGAAGGAAGG - Intronic
1162563309 19:11430660-11430682 CTGGAAATGAAGGAGGAGGTGGG + Intronic
1163177171 19:15572466-15572488 TGGGGAAGGCATGAGGAGGATGG + Intergenic
1163260817 19:16188801-16188823 GAGGGAATGAAGGAGAAGGGGGG + Intronic
1163501031 19:17676363-17676385 CAGGGGATGCAGGGAGAGGGAGG - Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1164611963 19:29638458-29638480 TAGGGAATGCAGGAGGGTAAGGG + Intergenic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165799052 19:38536513-38536535 GAGGGAATGAAAGAAGAGGATGG - Intronic
1165949868 19:39468238-39468260 GAGGGAATGCAGGCTCAGGAAGG - Intronic
1166203498 19:41253736-41253758 CAGGGAGTGCAGGAGCAGTTGGG - Intronic
1166349581 19:42189448-42189470 CAGGGATTGAAGTAGCAGGAAGG - Intronic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1166720511 19:44993349-44993371 GAAGGAAGGCACGAGGAGGAGGG - Intergenic
1166934311 19:46321800-46321822 CAGGGAAGGCGGGTGCAGGAAGG - Exonic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167381394 19:49140236-49140258 CAAGGTAGGCGGGAGGAGGAGGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167698785 19:51030244-51030266 CGGGGAATGGAGGAGGGGGAGGG - Intronic
1168098916 19:54130653-54130675 CAGGGAGGGGAGGAGGTGGAAGG + Intronic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168232917 19:55044792-55044814 CTGGGAATGGCCGAGGAGGAAGG - Exonic
1168251582 19:55145343-55145365 GAGGAAGTGGAGGAGGAGGAGGG + Intronic
1168345872 19:55649987-55650009 CAGGGACGGGAGGAGGAGCAGGG - Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
1168488251 19:56783660-56783682 TAGGGAATACAAGAGGAGGCAGG + Intronic
1168514980 19:57003629-57003651 CAGGGGCTGCAAGAGGAGGAGGG - Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925198639 2:1948372-1948394 CAGGAACTGCAGTAGGAGAATGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
927076284 2:19581088-19581110 GATGGAATGCAGGAGGAGGAAGG + Intergenic
927145634 2:20164032-20164054 CAGGGAAGGCATGAGAAGTAGGG - Intergenic
927517400 2:23680349-23680371 CTGGGCATGCAGGAGGAAGTGGG + Intronic
927925399 2:27009736-27009758 AGGGGAATGCATGGGGAGGAAGG - Intronic
928102962 2:28450104-28450126 GGGGGAAAGAAGGAGGAGGAGGG - Intergenic
928518191 2:32063620-32063642 CACCGACTGCAGGAGGAGAAGGG + Exonic
929631161 2:43463825-43463847 CAGGGAAGGAAAGAGCAGGATGG + Intronic
929822458 2:45284317-45284339 CAGGGAGGGCAGGAGGGGAAGGG - Intergenic
929959716 2:46487440-46487462 CAGGAATTAAAGGAGGAGGAAGG - Intergenic
930158400 2:48128497-48128519 GAGGAAATGGGGGAGGAGGAAGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931679002 2:64727524-64727546 GAGGGAATACTGGAGCAGGATGG + Intronic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
931985388 2:67736657-67736679 AAGGGGATGGAGGAGGAGAATGG - Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
932467110 2:71931012-71931034 AAGAGAAGGCAGGAGGAGAAAGG + Intergenic
932578916 2:72980845-72980867 AGGGGAATGCAGGAGGGGGCAGG - Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932758988 2:74427314-74427336 AAGGGAATGTAGCAGGAGAAAGG - Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932851869 2:75195375-75195397 AAGGGAAGGTAGGAGAAGGAGGG - Intronic
933180631 2:79222643-79222665 AAAAGAAGGCAGGAGGAGGAAGG - Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
934936669 2:98470516-98470538 CAGGCACTGAAGGAGCAGGAAGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935514931 2:104024041-104024063 CAGGGAATGATGGAGGTGGAGGG + Intergenic
935622799 2:105144034-105144056 GAGGGAGAGGAGGAGGAGGACGG - Intergenic
936692150 2:114902958-114902980 CTGGGAATGAGGGAGGAGGGAGG - Intronic
937203610 2:120222377-120222399 CAGGGACCGCAGGAACAGGAGGG + Exonic
937244293 2:120482598-120482620 CAGGCCATGCAGGAGGCCGAAGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938120089 2:128627001-128627023 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
938314712 2:130317702-130317724 GAGGGAAGGCATGAGGGGGAGGG - Intergenic
938413869 2:131088294-131088316 CAAGAAACGCAGGAGTAGGAGGG + Intronic
938828523 2:135031210-135031232 AAGTGAATACAGGAGGATGATGG + Intronic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
940195638 2:151091411-151091433 CAGGAAATGAAGGAGGGAGATGG + Intergenic
940277376 2:151953391-151953413 CAGGGAAGGGAGGAGTTGGAGGG - Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941519314 2:166519558-166519580 CAGCTCATGCAGGAGGGGGAGGG - Intergenic
942135976 2:172925938-172925960 GAGGGAAGGAAGGAGGGGGAGGG + Intronic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942654029 2:178195415-178195437 CCGGGGATGCTGGGGGAGGAGGG + Intronic
942816700 2:180060867-180060889 TAGGGGTTGCAGGAGGATGAAGG - Intergenic
943445295 2:187977870-187977892 CTGGTGTTGCAGGAGGAGGAAGG + Intergenic
943581342 2:189687109-189687131 CAGGGAATGGTGGGGCAGGAGGG - Intronic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944658738 2:201902521-201902543 CATGGAATGCTGGAAGTGGATGG + Intergenic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945167275 2:206959377-206959399 CAGGGATGGCAGGAGGTGAATGG + Intronic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
945774503 2:214088149-214088171 CAGGGAGTGGAGGAAGAGGATGG + Intronic
945862550 2:215140286-215140308 CCAGGAATTCAGGAGAAGGAAGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946239787 2:218346486-218346508 CAGACAAGGCAGGAGGAGCAGGG - Exonic
946254892 2:218435221-218435243 CAGTGAATGTAGTAGGAGGGTGG + Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947521282 2:230848006-230848028 CCGGGAAGGAAGGCGGAGGAGGG + Intergenic
947586152 2:231358173-231358195 CAGGGTATGAATGAGGGGGAGGG + Intronic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948384999 2:237575706-237575728 CAGGCCCTGCAGGAGGAGGAAGG - Intronic
948402485 2:237693703-237693725 CATAGATGGCAGGAGGAGGATGG + Intronic
948458560 2:238118458-238118480 GAGTGAATGGAGGAGGTGGATGG + Intronic
948458587 2:238118565-238118587 GAGTGAATGGAGGAGGTGGATGG + Intronic
948570869 2:238916429-238916451 GAGGGAAAGAAGGAGGAGGGAGG + Intergenic
948800172 2:240429916-240429938 CAGGGAGGGAAGGAGGAGGGGGG - Intergenic
1168965614 20:1896208-1896230 CGGGGAAGGCAGGAGGAAGGGGG - Intronic
1169130988 20:3166364-3166386 CAGGAAACGCAGGAGGGGGCTGG + Intronic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1170075570 20:12415273-12415295 CACAGAATGCTGGAGGAAGAGGG - Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170601889 20:17847611-17847633 CAGGGAAGGAGGGAGCAGGACGG - Intergenic
1170953410 20:20956575-20956597 CAGGGAATGCAGACGTGGGAGGG + Intergenic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171048468 20:21833388-21833410 CAGTTAATGCAGCAGTAGGAAGG - Intergenic
1171087420 20:22250577-22250599 GGGGGAGTGGAGGAGGAGGAGGG + Intergenic
1171151909 20:22834893-22834915 AAAGGAATGGAGGAAGAGGAGGG - Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171287572 20:23954373-23954395 CAGAGCATGCAGGAGGAGAGTGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171797813 20:29579973-29579995 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1171850434 20:30304188-30304210 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172595928 20:36151183-36151205 CAGGAAAGCCAGGAGGAGAACGG - Intronic
1172771701 20:37386009-37386031 CAGGGAAGGCATGGGCAGGATGG - Intronic
1172846475 20:37932447-37932469 CAAGGCAAGCAGGAGGAGCAGGG + Intronic
1172890343 20:38260050-38260072 CAGGCAGTGCAGGGCGAGGAGGG - Intronic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173438845 20:43057301-43057323 GAAGGAATGGAGGAGGAGGGGGG + Intronic
1173596010 20:44258710-44258732 GAGGGAGAGAAGGAGGAGGAAGG - Intronic
1173644881 20:44627033-44627055 CAGGGAATGAGGGAGAAGGAAGG - Intronic
1173815593 20:45985736-45985758 AATGGAAGGCAGGAGGAGGCAGG + Intergenic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1174112463 20:48205895-48205917 CAGAGAAGGAGGGAGGAGGAGGG - Intergenic
1174168773 20:48603624-48603646 CAGAGAAGGAGGGAGGAGGAGGG + Intergenic
1174173283 20:48629983-48630005 CAGGGAATGCTGGGGGCAGAAGG - Intronic
1174340311 20:49891219-49891241 CAGGGAATGCGGGGGGTGGAGGG - Exonic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175437645 20:58965580-58965602 CAGGGAAGGCAGGAGCTGGGTGG - Intergenic
1175551662 20:59821875-59821897 CAGGAAGTTGAGGAGGAGGAGGG + Intronic
1176310084 21:5144860-5144882 CGGGGACTGGAGGAAGAGGAAGG - Intronic
1176402832 21:6330445-6330467 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1176434325 21:6658659-6658681 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1176458587 21:6985729-6985751 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1177023082 21:15887273-15887295 CTAGGAATGCAGGTAGAGGATGG - Intergenic
1177341452 21:19806416-19806438 TAGGGAATGATGGAGGAAGATGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177786608 21:25678413-25678435 AAAGGAATGCAGGAGAAGAAAGG + Intronic
1178068030 21:28928113-28928135 TAGGGAAAGAAGGAGGAGAATGG + Intergenic
1178255459 21:31048200-31048222 CAGTGAAAGCAGGAGAAGGCTGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178741568 21:35206707-35206729 GAAGGAAGGAAGGAGGAGGAGGG - Intronic
1178929419 21:36804626-36804648 TGGGGATGGCAGGAGGAGGAAGG - Intronic
1179131187 21:38638803-38638825 AAGGGGATGTGGGAGGAGGAGGG - Intronic
1179534311 21:42041360-42041382 CAGGGAGTGCAGCAGAAAGAAGG + Intergenic
1179644742 21:42768590-42768612 CAAGGACTGCAGAAGCAGGAGGG + Intronic
1180033170 21:45226020-45226042 CAGGGACTGGTGGAGGTGGATGG + Exonic
1180117859 21:45723965-45723987 CAGCTTATGCTGGAGGAGGACGG - Intronic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1181090498 22:20469278-20469300 CAGGGAATTAAGAAGGTGGACGG + Intronic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181534356 22:23534013-23534035 AAGGGAAGGCAGGAGGGAGAGGG + Intergenic
1181552993 22:23651675-23651697 CAGGGAGTTGAGGAAGAGGAGGG + Intergenic
1181675675 22:24450101-24450123 CAGGGAATGGGGTAAGAGGATGG - Intergenic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183706193 22:39476175-39476197 CAGGGACTGGAGGTGGGGGAGGG + Intronic
1184014807 22:41777990-41778012 GAAGGAAGGAAGGAGGAGGAGGG - Intronic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184248838 22:43249013-43249035 CAGGGGGTGCTGGTGGAGGAAGG + Intronic
1184293425 22:43509781-43509803 GAGGGAGGGAAGGAGGAGGAAGG - Intergenic
1184402346 22:44281326-44281348 TAGGGAGTCCAGCAGGAGGACGG + Intronic
1184420981 22:44382788-44382810 CAGGGGGTGGAGGAGCAGGAGGG - Intergenic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184939188 22:47748505-47748527 GACGGACTGGAGGAGGAGGAGGG + Intergenic
1184950645 22:47840364-47840386 AAAGGAAGTCAGGAGGAGGAAGG - Intergenic
1185187645 22:49412180-49412202 GAGGGAGTGGAGGAGGAGGAGGG + Intergenic
1185420895 22:50733802-50733824 CAGGGATTGCAGGAGGTGGGGGG - Intergenic
949949433 3:9216998-9217020 CAGGGAATGGGGGAGGAACAGGG + Intronic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950351430 3:12357398-12357420 CAGAGAATGCCAGAGGAAGAGGG - Intronic
950352470 3:12369940-12369962 GAGAAAATGCAGGAGGAAGAAGG - Intronic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
950567992 3:13782597-13782619 CAGTGACTGCAGGAGGGTGAAGG - Intergenic
951109592 3:18786198-18786220 AAGGGAGTGCAGGGGGTGGAGGG - Intergenic
951767659 3:26217414-26217436 CAGGGCATGCATGATGAGGCTGG + Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952678206 3:36058978-36059000 CCAGGAATTCAGGAGGAGGTAGG + Intergenic
952883686 3:38000409-38000431 GAGGGAAGGGAGGAGGAGGTGGG + Intronic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953178496 3:40574254-40574276 CAGAGAATGAGGGAGGAGGGAGG + Intronic
953428821 3:42819850-42819872 AAGGAAGTGCAGGAGGAGAAAGG - Intronic
953862010 3:46552572-46552594 GAAAGAAGGCAGGAGGAGGATGG - Intronic
953871295 3:46629705-46629727 AGGAGAATGGAGGAGGAGGAGGG + Intergenic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954539501 3:51384464-51384486 CCGGGGAGGCAGGAGGAGGCTGG + Intergenic
954852754 3:53617310-53617332 GAGGGGAGGCAGGAGGAGGTAGG + Intronic
954976405 3:54699277-54699299 CATGGGATGCTGGAGGAGCAAGG + Intronic
955117220 3:56017664-56017686 CAGGGAGTGCTGGAGTAGAATGG - Intronic
955143013 3:56288316-56288338 AAGGTAAAGCAGGAGGATGAGGG + Intronic
955320329 3:57969937-57969959 CCTGGAAGGCAGGATGAGGAGGG - Intergenic
955406974 3:58631659-58631681 AAGGGAGTGGAGGAGCAGGATGG + Intergenic
955935217 3:64096497-64096519 CAGAGAATGCTGAATGAGGAAGG - Exonic
955973232 3:64456752-64456774 GAGGGAATGCAGGAGCTGTAGGG + Intergenic
956223755 3:66933369-66933391 AAGGGACTGCAGGGGGAGGATGG - Intergenic
956384562 3:68703032-68703054 CAGTGAATGCAGGCAGAGCAAGG + Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
957210346 3:77250717-77250739 CAGGGAATGCTGCAGCAAGAAGG - Intronic
957590367 3:82189384-82189406 GAGGGAATGATAGAGGAGGAGGG + Intergenic
957810597 3:85215939-85215961 TAGAGAATGAGGGAGGAGGAGGG + Intronic
958019377 3:87978989-87979011 CAGGGACTGGAGGGGAAGGAAGG + Intergenic
958167013 3:89889243-89889265 CAGGGATTGCTGGAGGAGATGGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
960319009 3:116211177-116211199 CAGGGATGGGAGGAGGGGGAAGG + Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961539390 3:127589924-127589946 CGGGGAATGCAGGTGGGGGCTGG - Intronic
961745152 3:129059760-129059782 TTGGCCATGCAGGAGGAGGAAGG + Intergenic
962214253 3:133506779-133506801 GAGGGAAGGCAAGAAGAGGAAGG + Intergenic
962405238 3:135094659-135094681 GAGGGAAAGCAGGAGGGAGAAGG - Intronic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
962494434 3:135924900-135924922 CAGTTAAGGCAGGAGGAGAAAGG - Intergenic
962636998 3:137341360-137341382 CAGGGGATGCAGGGGGAAAAAGG - Intergenic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963311720 3:143716967-143716989 CGAGGAATGGAGGGGGAGGAAGG + Intronic
963963701 3:151340889-151340911 CAGGAAATGTGGGATGAGGATGG + Intronic
964162354 3:153660513-153660535 CAGGGAGGGAAGGGGGAGGATGG - Intergenic
964419954 3:156491295-156491317 CAGAGACTGCAGCAGGACGATGG + Intronic
964527353 3:157629749-157629771 CAGGGTGTGGAGGAGGAGGCAGG + Intronic
964528225 3:157638798-157638820 CAGGGTATGTGGGAGGGGGAGGG - Intronic
964640607 3:158906377-158906399 GAGGGAATGCTGAAGGAGGTGGG - Intergenic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
965384429 3:168029225-168029247 CAGGGAATCCAAGGAGAGGAAGG - Exonic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
965885276 3:173437858-173437880 TAGGGAAGGCAGGATCAGGAAGG - Intronic
966446988 3:180011760-180011782 AAGGGAAGGGAGCAGGAGGAAGG - Intronic
966974797 3:185074302-185074324 ATGGGCATGCTGGAGGAGGATGG - Intergenic
967656864 3:192060890-192060912 GAGGAAATACAGGAGAAGGAAGG + Intergenic
967934405 3:194715377-194715399 GAGTGAAGGAAGGAGGAGGAAGG - Intergenic
968607007 4:1540303-1540325 CACGGAAGGCAGGAACAGGAAGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968653697 4:1769831-1769853 CAGGGAAGTCAGGTGGAGTAAGG + Intergenic
968659613 4:1793640-1793662 CAGGGAGGGAAGGGGGAGGAGGG + Intronic
968689859 4:1984825-1984847 CTGGGGATGTAGGAGGAGGCGGG + Exonic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969130156 4:4985173-4985195 CAGGGATGGCAGGATGGGGAGGG + Intergenic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969450215 4:7268719-7268741 CAGGGAGTGGAGGAGGAGCAGGG + Intronic
969470337 4:7384102-7384124 CAGGGACTGTGGGAGGAAGAAGG - Intronic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
969692809 4:8713829-8713851 CAGGGAATGGGGTAGGGGGAGGG + Intergenic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970444159 4:16110142-16110164 GAAGGAAGGAAGGAGGAGGAAGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
970730334 4:19095841-19095863 GAGGGAAGGAGGGAGGAGGAAGG + Intergenic
971167492 4:24199027-24199049 CAGGGAAAGAAGGAAGAGTAGGG - Intergenic
971261742 4:25063482-25063504 CAGGGAATGGAGCAGAAGAATGG + Intergenic
972160665 4:36222931-36222953 CAGGGAATTTATGAGGAAGAAGG - Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972679212 4:41289469-41289491 CAGGTAGTGGTGGAGGAGGAGGG - Intergenic
973631632 4:52825591-52825613 CAGAGAGTGCTGGAGCAGGAAGG + Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973936552 4:55852454-55852476 CAGGGAATCCAAGAGGAGAGAGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975499242 4:75066967-75066989 CAGGGACTACTGGAGGGGGAGGG + Intergenic
975803212 4:78084679-78084701 CAGGAAATGTATGAAGAGGACGG - Intronic
975815459 4:78212280-78212302 CAGCGAATGCAAGAGGAAGGAGG - Intronic
976217554 4:82729324-82729346 CAAGGACTTCTGGAGGAGGAGGG + Intronic
976246483 4:83010832-83010854 CGGGGAGGGGAGGAGGAGGAAGG - Intronic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
976841352 4:89436326-89436348 CAAGGAAGGCAGGAGGAGCCTGG + Intergenic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978838602 4:113183221-113183243 GAGGGGATGGAGGTGGAGGAGGG + Intronic
979506404 4:121502617-121502639 GAGGGAAGGAAGGAGGGGGAGGG - Intergenic
981598812 4:146460657-146460679 CAAGGACTGCAGGTAGAGGAAGG + Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982348115 4:154384334-154384356 CAGGTGGTGCATGAGGAGGAGGG - Intronic
983519655 4:168694456-168694478 CAGGGAATGAAGGAGGTGAGGGG - Intronic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
986128010 5:4901606-4901628 CAGGGAGTGAACGAGGATGAAGG - Intergenic
986221994 5:5776354-5776376 CCTGGGATGCAGGAGGAGGGAGG + Intergenic
986427071 5:7644267-7644289 GAGGAAATCAAGGAGGAGGATGG - Intronic
986709433 5:10478028-10478050 GAGGGAATGCGGGATGAGAAGGG - Intergenic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988070605 5:26284089-26284111 CAGAGACTGCGGGAGGGGGAGGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988297839 5:29390008-29390030 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
988497710 5:31758910-31758932 CAGGGAACGCATGTGGAGGCGGG - Intronic
988722440 5:33892148-33892170 CGGGGCATGCGGGAGGCGGAGGG - Exonic
989285634 5:39696242-39696264 GAGGGAATGAAGGGGGTGGAAGG - Intergenic
989465184 5:41746797-41746819 CCAGGACTGCAGGAGGAGAAGGG - Intronic
989693472 5:44171734-44171756 AAGGGCATTCAGGAGCAGGAGGG - Intergenic
990043300 5:51398246-51398268 CAGGGAGCGAAGGAGGGGGAGGG + Intergenic
990466170 5:56073914-56073936 CAGGGTATGCACCAGGAGGCTGG + Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990970644 5:61502197-61502219 CAGGGATGCCAGGAGCAGGAAGG + Intronic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992152087 5:73914824-73914846 CAGTGAGTCCAGGAGGTGGATGG - Intronic
992187677 5:74259881-74259903 TAGGGAATGGAGGTGGAGGAGGG - Intergenic
992222117 5:74583387-74583409 CATAGGATGCAGGAAGAGGAAGG - Intergenic
992760473 5:79947063-79947085 GAGGGAATGAAGGAACAGGAGGG + Intergenic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
995616392 5:113969057-113969079 TGGGGAATGAAGGAGAAGGATGG + Intergenic
996314746 5:122149141-122149163 TAGTGAATGCAAGCGGAGGAAGG + Intronic
996400012 5:123052287-123052309 CAGGGAGTACAAGAGGAAGATGG - Intergenic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
997385245 5:133467371-133467393 CTGGGCCTGCAGGAGGAGGCTGG + Intronic
997530100 5:134576739-134576761 CAGGGAAAGTGAGAGGAGGAGGG - Intronic
997980197 5:138464100-138464122 CAGGGACTGCAGGGGGAGCCCGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998359582 5:141573650-141573672 CGGGAAATGGAGGAGGTGGAGGG + Exonic
998484089 5:142486609-142486631 TAGTGAATGTGGGAGGAGGAGGG - Intergenic
998541323 5:142984162-142984184 GAAGGAAGGCAGGAAGAGGAAGG + Intronic
998910953 5:146959705-146959727 CAGGCAAGGGAAGAGGAGGATGG + Intronic
999133155 5:149299745-149299767 CAGGGGCTGCCGCAGGAGGAAGG + Intronic
999904443 5:156124091-156124113 CAGGGAAAGGGGGAGGAGAAAGG - Intronic
1000245077 5:159442381-159442403 CTGAGAGCGCAGGAGGAGGAAGG - Intergenic
1001076009 5:168628678-168628700 GAAGGAGGGCAGGAGGAGGAAGG - Intergenic
1001247788 5:170117987-170118009 CAGGGAATGGCGGTGGGGGAAGG + Intergenic
1001321617 5:170687018-170687040 CAGGGAACTCAGGGGGAGAATGG - Intronic
1001837587 5:174845038-174845060 CAGAGAAGGCAGGAGGCTGACGG - Intergenic
1001952788 5:175827864-175827886 CAGGGCACGCAGGAGGCAGATGG - Intronic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002080890 5:176736735-176736757 CAGGGAGGACAGGAGAAGGAAGG - Intergenic
1002189212 5:177470102-177470124 CCGGGAATCCAGGAAGGGGAGGG - Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002929845 6:1625459-1625481 TGGGGAAAGCGGGAGGAGGAAGG - Intronic
1003414819 6:5898383-5898405 GAGGGAGGGCAGGAGGAGGGAGG - Intergenic
1003550453 6:7098325-7098347 CAGGGAAAGCAGGAGGGGTGAGG - Intergenic
1003599374 6:7503218-7503240 CATGGGATGCAGGAGAAGGGAGG - Intergenic
1003904459 6:10686399-10686421 AAGGGAATGGGGAAGGAGGAGGG + Intronic
1004007801 6:11652833-11652855 CACATCATGCAGGAGGAGGATGG + Intergenic
1004537397 6:16515807-16515829 AAGCGGATGCAGGAGGGGGATGG + Intronic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1004751596 6:18567516-18567538 GAAGGAAAGGAGGAGGAGGAAGG - Intergenic
1004973590 6:20939253-20939275 TAGTAAATGCAGCAGGAGGAAGG - Intronic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005419115 6:25630955-25630977 GAGGAAATGCTGGAGGAGGCTGG - Intergenic
1006153456 6:32001528-32001550 CGGGGTCTGCAGGACGAGGATGG + Exonic
1006159764 6:32034265-32034287 CGGGGTCTGCAGGACGAGGATGG + Exonic
1006185026 6:32176641-32176663 CAGAGAAGGCAGGTGGAGGGGGG - Exonic
1006297082 6:33174468-33174490 CAGGGAAGCGAAGAGGAGGAGGG + Intronic
1006311542 6:33264531-33264553 CAAGGAATGTTGGAGGGGGATGG + Intronic
1006389930 6:33752260-33752282 CAAGGACTGCAGGAGGAAGGTGG + Intergenic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007386368 6:41522973-41522995 GCGGGAAGGAAGGAGGAGGAGGG - Intergenic
1007398474 6:41590353-41590375 CAGGGCAGGTAGGAGGAGGGTGG + Intronic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1007764439 6:44152514-44152536 CAGGGAAGGAGGGAGGGGGAAGG - Intronic
1008040810 6:46796329-46796351 GAGGGAATGAAGGAAGAGTAGGG - Intronic
1008117682 6:47571255-47571277 CTGGCAATGCAGGAGCAAGATGG + Intronic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012319075 6:97820077-97820099 CAAGGATTGCAGGAGGATGGGGG - Intergenic
1013618629 6:111868083-111868105 CAGAGAAGGCTGGAAGAGGAGGG - Intronic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1015626163 6:135182293-135182315 GAGGGAGAGGAGGAGGAGGAGGG + Intronic
1015849004 6:137552410-137552432 AAGGGAAGGAAGGGGGAGGAAGG - Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1016878000 6:148882561-148882583 GAAGGAATGGGGGAGGAGGAAGG + Intronic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017616322 6:156250406-156250428 AAGGGAAGGAAGGAGGAAGAAGG - Intergenic
1017822949 6:158061935-158061957 GAGGGAAGGGAGGACGAGGAGGG - Intronic
1018355449 6:163010531-163010553 CTAGGACTACAGGAGGAGGAGGG - Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018866024 6:167747709-167747731 GAAGGAAGGGAGGAGGAGGAGGG + Intergenic
1018921744 6:168180195-168180217 CAGGGACGGCAGGAGAAGGTCGG + Intergenic
1019208035 6:170378955-170378977 CAGGCAAATCAGGAGGAGCAAGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019554825 7:1624026-1624048 CAGGGACTGAGTGAGGAGGAGGG - Intergenic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019826028 7:3285114-3285136 GAGGGAAGGCAGCAGGAAGAGGG - Intergenic
1020026829 7:4905398-4905420 GAGGAAGTGGAGGAGGAGGAGGG + Intergenic
1020339733 7:7096802-7096824 CAGTGAATGCATGAAGAGAATGG - Intergenic
1021527294 7:21603027-21603049 CAGGGCATGGAGGAGGATAATGG - Intronic
1021601050 7:22363738-22363760 CAGGGAATAGAGGAGTAGCAGGG + Intergenic
1021685538 7:23182159-23182181 CTAGGGGTGCAGGAGGAGGACGG + Exonic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021817457 7:24461644-24461666 CGGGGAATGCAGGAAGAAGATGG - Intergenic
1021840763 7:24719921-24719943 CAGGGAATACAGGATTATGATGG + Intronic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022274470 7:28841927-28841949 CAGGGAAGGGAGGAGGGGAAGGG + Intergenic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1023341244 7:39222563-39222585 CAGGGACTGGGGGAGGGGGATGG - Intronic
1023363650 7:39441425-39441447 CAGAGAAAGCAAGAGGAGCAAGG + Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023879899 7:44312403-44312425 CTGGGAGGGCAGGAGAAGGAGGG + Intronic
1023974148 7:45015451-45015473 CAGTGAATCCAGGAAGGGGAAGG - Intronic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024109783 7:46133618-46133640 GAGGGAGAGAAGGAGGAGGAGGG - Intergenic
1024171357 7:46791147-46791169 AAGGGAAAGCAAGAGAAGGAAGG + Intergenic
1024233121 7:47377820-47377842 CATGGAATTTAGGAAGAGGAGGG - Intronic
1025942443 7:66083997-66084019 CAGGGAGTTGAGGAAGAGGAGGG - Intronic
1026136025 7:67661555-67661577 CAGGTGATGGAGGAGAAGGATGG - Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026806125 7:73430450-73430472 AAGGGGATGGAGGGGGAGGAGGG - Intergenic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027853481 7:83479207-83479229 CAGAGAAAGCAGGGGTAGGAAGG - Intronic
1028109513 7:86921797-86921819 CAAGAAATGCAGGAGGACAATGG + Intronic
1028193362 7:87876788-87876810 AAGGGACTGCAGGCGGAGGAGGG - Intronic
1029160832 7:98550645-98550667 CATGGTCTGGAGGAGGAGGAAGG + Intergenic
1029253118 7:99250973-99250995 CTGGGAACCCAGGAGGAGAATGG - Intergenic
1029355468 7:100048530-100048552 CATGGATGGCAGGAGGGGGATGG + Intergenic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029436752 7:100568042-100568064 CAGGAAAGGCAGGAAGAGCAGGG - Exonic
1029438907 7:100576873-100576895 CAGGGATTTTGGGAGGAGGATGG - Intronic
1029443982 7:100602879-100602901 GAGGGATTGTAGGGGGAGGAGGG + Intronic
1029619534 7:101681309-101681331 GAGGGAAGCCAGGAGGGGGACGG - Intergenic
1029644550 7:101845546-101845568 GAGGGAATAGAGGAGGAGGCTGG + Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1032489645 7:132314549-132314571 TAGGGAAGGGAGGAAGAGGAAGG + Intronic
1032505150 7:132428737-132428759 CAGGGAATGGAGTGGGAGGTAGG - Intronic
1032622693 7:133553461-133553483 CAGGGAATGAAATCGGAGGAAGG - Intronic
1033124796 7:138698158-138698180 GAGGGAAAGAAGGAGGGGGAAGG + Intronic
1033463169 7:141565680-141565702 CAGGGAATGAAGGAGGATAAAGG - Intronic
1034044946 7:147917848-147917870 CAGAGAATGCAAGGTGAGGAGGG - Intronic
1034056650 7:148042356-148042378 CAGGGCATGGTGGAGGGGGAAGG + Intronic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1034286694 7:149888647-149888669 CAGGGAAGGAAGGAGGAAGTGGG + Intergenic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035293896 7:157857117-157857139 CTGGGGATGCTGGAGGGGGAGGG + Intronic
1035517795 8:251268-251290 CAGGGAATAGTGGTGGAGGAGGG + Intergenic
1035720314 8:1786216-1786238 GAGGGGCTGCAGGAGGAGGGGGG + Exonic
1036544828 8:9757564-9757586 CTGGGAAGGAAGGAGCAGGAAGG - Intronic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036655909 8:10677168-10677190 AATGAAGTGCAGGAGGAGGAGGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1036723431 8:11200034-11200056 CTGGGAGTGCAGGAGGGGGAAGG + Intronic
1036748655 8:11429121-11429143 CAGGGGCTGGAGGAGGGGGATGG - Intronic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037319853 8:17632026-17632048 CAGGGATGGCACGCGGAGGATGG - Intronic
1037658672 8:20908735-20908757 TAGGGAAGGGAGGAGGAGAAAGG - Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1037855865 8:22370246-22370268 CAGGTAAGGAAGGAGGAAGAAGG - Intronic
1037877060 8:22553524-22553546 CAGGGAATGGAGGGGCAAGAGGG - Intronic
1038596460 8:28890577-28890599 GAGGGAAGGCGGGAGGGGGAGGG - Exonic
1039454756 8:37699150-37699172 GAGGGAATGAAGGGGGAAGAGGG - Exonic
1039689285 8:39846290-39846312 CAGGGAATGCAAGAATGGGAAGG + Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1039902811 8:41765643-41765665 AAGGGAATGGAAGAGAAGGAAGG + Intronic
1039931984 8:42001015-42001037 GAGGGAAGGAAGGAGGAGGAAGG + Intronic
1040071935 8:43195648-43195670 GAGGGGCTGGAGGAGGAGGAGGG + Intronic
1040561634 8:48527951-48527973 CAGGGAAGGAAGGAACAGGATGG - Intergenic
1041145412 8:54870940-54870962 CAGGGAAGGCAGGAGGGCCAAGG - Intergenic
1041714426 8:60921441-60921463 CCGGGAGGGCAGGGGGAGGAGGG - Intergenic
1041746160 8:61211358-61211380 AAGGGAAAGAAGGAGAAGGAGGG - Intronic
1042040807 8:64586620-64586642 CATGGAAAGCAGGAGTGGGAGGG + Intergenic
1042322750 8:67495246-67495268 ATGGGAATGGAAGAGGAGGATGG - Intronic
1042537083 8:69870000-69870022 GAGGGAGGGCAGGAGGAAGATGG - Intergenic
1042576039 8:70219667-70219689 CAGGAAGGGCAGGAGGAGGGTGG + Intronic
1042676992 8:71332398-71332420 CAGGAAATGCAAGAGGAGCACGG - Intronic
1042781102 8:72491900-72491922 GAGGGAAGGAGGGAGGAGGAAGG + Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1045252184 8:100491464-100491486 CTGGGACTGCAGGAGAGGGATGG + Intergenic
1045379508 8:101609203-101609225 CAGGGAAGGAAGGAAGGGGAAGG + Intronic
1045805673 8:106158542-106158564 TAGAGATTGCAGGAGGAGAATGG - Intergenic
1046101277 8:109616832-109616854 CTGGGAATGCAAAAAGAGGATGG + Intronic
1046451983 8:114405431-114405453 CAGGGAAGGAAGGAAAAGGAAGG + Intergenic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046588395 8:116175945-116175967 AAAGGAAGGAAGGAGGAGGAAGG + Intergenic
1046695639 8:117336249-117336271 CAGGGAAGGCAGCAAGAAGAAGG - Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1046823283 8:118659125-118659147 CAGGGCATGAAGTAGGTGGATGG - Intergenic
1047052768 8:121131404-121131426 CAGGGCATGCAGGAGGGGTGAGG + Intergenic
1047646823 8:126878547-126878569 CATGGCAGGCAGGTGGAGGAAGG + Intergenic
1047782687 8:128123026-128123048 CAGGGAGAGAGGGAGGAGGAAGG - Intergenic
1048053997 8:130846624-130846646 GAGGGAAGGAAGGAGAAGGAAGG - Intronic
1048256138 8:132906568-132906590 CAGGGAAGGGGAGAGGAGGAGGG + Intronic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1048852811 8:138660451-138660473 CAGGAAATCCAGGAGAAAGAGGG - Exonic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049372193 8:142273217-142273239 CTGGGACGGCAGGAGGACGATGG - Intronic
1049451100 8:142662009-142662031 GAGGGGCTGCAGGAGGAGCAGGG + Intronic
1049508559 8:143016464-143016486 CTCAGAAAGCAGGAGGAGGAGGG + Intergenic
1049538082 8:143191780-143191802 CAGGGAGTGCAGGAAGGGGTGGG + Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1049853798 8:144849197-144849219 CAGAGAATGCAGGAAGTGGCTGG + Intronic
1050085100 9:1957141-1957163 CTGGGAAGGCAGGAAGCGGAAGG - Intergenic
1050675798 9:8051845-8051867 AAGGGAAGGAAGGAGAAGGAAGG + Intergenic
1050745448 9:8870774-8870796 GAAGCATTGCAGGAGGAGGAAGG + Intronic
1051093410 9:13436985-13437007 CAGTGACTTCAGGAGGAGGCTGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051856061 9:21566776-21566798 CAGGGAAGGCAGGAGAGGTAGGG - Intergenic
1052960246 9:34289498-34289520 GAGGGAATGGGGGAGGTGGAAGG - Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1053788214 9:41667479-41667501 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1054156925 9:61647289-61647311 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1054476697 9:65578297-65578319 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055174172 9:73297648-73297670 CAGGGAATGTAATAGGAGAATGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055604119 9:77949993-77950015 GAGGGAATGGAGCTGGAGGAGGG - Intronic
1056320622 9:85431382-85431404 CAGGGAAGGAAGGAGAGGGATGG - Intergenic
1056395819 9:86180277-86180299 CAGGGAAAGCAAGATGGGGAAGG - Intergenic
1056617021 9:88177525-88177547 GAGGGCATGCAGGAGAAGGATGG + Intergenic
1057081986 9:92180085-92180107 AAGGGAAGGCAGGAGGCAGAAGG + Intergenic
1057133527 9:92670694-92670716 CAGTGAATTTAGGAGAAGGAAGG - Intergenic
1057469554 9:95345332-95345354 AGGGGAATGCAAGAGGAGAATGG - Intergenic
1057491710 9:95525303-95525325 CTTGGAATGCAGGAGGTGAAGGG + Intergenic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058708798 9:107660655-107660677 CTGGGAATGCAGGTGGATGTAGG + Intergenic
1058918218 9:109587874-109587896 CAGAGACTGCAGGAGGAAGGTGG + Intergenic
1058999118 9:110329913-110329935 CAGGAAATGGAAGGGGAGGAGGG + Intronic
1059081830 9:111258082-111258104 CAGTTAAGGCAGGAGGTGGAAGG + Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059751932 9:117255778-117255800 CAGGGAGGGGAGGAGGAAGAAGG + Intronic
1060027784 9:120187573-120187595 CTGGGAATCCTGGAGGAGCAGGG - Intergenic
1060044889 9:120332120-120332142 TAGGGAAGGCAAGAGAAGGATGG - Intergenic
1060755084 9:126206679-126206701 CAGGGAGAGCAAGAGAAGGAAGG - Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061178710 9:129011906-129011928 CAGAGACAGCAGGAGGTGGAGGG + Intronic
1061287251 9:129631108-129631130 CAGGGAGTGCTGGAGGGGGTGGG - Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061386966 9:130296105-130296127 CAGGGCTGGCAGGAAGAGGAGGG + Intronic
1061967613 9:134025184-134025206 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1061967640 9:134025266-134025288 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1062022875 9:134327351-134327373 GCGGGATGGCAGGAGGAGGAGGG - Intronic
1062513257 9:136919654-136919676 GAGGGAAAGAAGGAGGGGGAGGG - Intronic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1203437211 Un_GL000195v1:149983-150005 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1185575552 X:1169230-1169252 CGAGGAAGGTAGGAGGAGGAGGG + Intergenic
1185586329 X:1244445-1244467 AAGGGAAGGAAGGAGAAGGAAGG + Intergenic
1185627603 X:1493428-1493450 GAGGGAGGGAAGGAGGAGGAAGG + Intronic
1185680010 X:1880806-1880828 TAGGGAGGGAAGGAGGAGGATGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG + Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188050415 X:25478536-25478558 GAGGGAGAGCAAGAGGAGGAAGG - Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1190677744 X:52796715-52796737 GAAGGAATGCAGGTTGAGGAAGG + Intronic
1190762445 X:53447854-53447876 AAGGGAATGCAGGAGGAAGAGGG - Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191779554 X:64850712-64850734 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
1191850572 X:65582930-65582952 AAGGGAGAGCAGGAGGGGGAGGG + Intergenic
1192267466 X:69548689-69548711 CAGCTAGTGCAGGAGGTGGAGGG + Intergenic
1192730145 X:73794905-73794927 CAGTGAGTGCAATAGGAGGAGGG - Intergenic
1194921454 X:99771392-99771414 GAGGGAAGGAAGGAAGAGGAAGG + Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195350157 X:103987935-103987957 CAGCGGATGCAGGAGGAAAAAGG - Intergenic
1195351762 X:104003155-104003177 CAGCGGATGCAGGAGGAAAAAGG + Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1197174434 X:123470206-123470228 AAGGAAATGAGGGAGGAGGATGG + Intronic
1197290372 X:124649037-124649059 GAGGGACTCCAGGAGGAAGATGG + Intronic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197782437 X:130171659-130171681 CCGGGAATGCAGGCAGGGGAGGG + Exonic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1198115138 X:133537402-133537424 GAGGGAAGGAAGGAAGAGGAAGG + Intronic
1198177529 X:134171849-134171871 CCGGGAATGGAGGGGGAGGGAGG - Intergenic
1198804567 X:140481208-140481230 TAGGGGATGCAGGCTGAGGAGGG - Intergenic
1198854665 X:141003323-141003345 GAAGGAATGCAGGTTGAGGAAGG - Intronic
1199034503 X:143033919-143033941 GAAGGAATGCAGGTTGAGGAAGG - Intronic
1199073904 X:143509246-143509268 GAAGGAATGCAGGTGGAGGAAGG + Intronic
1199092915 X:143712583-143712605 GAAGGAATGCAGGTTGAGGAAGG + Intronic
1199215422 X:145255565-145255587 GAAGGAATGCAGGTGGAGGAAGG - Intronic
1199600237 X:149537324-149537346 AGGGGAAGGCAGGAGCAGGACGG + Intergenic
1199650347 X:149942616-149942638 AGGGGAAGGCAGGAGCAGGACGG - Intergenic
1200921555 Y:8617965-8617987 CAGGTCTTGCTGGAGGAGGATGG - Intergenic
1201609307 Y:15823169-15823191 GAGGGAGTGCAGGAGCAAGATGG + Intergenic