ID: 1142545664

View in Genome Browser
Species Human (GRCh38)
Location 17:700853-700875
Sequence TTCTGGCTACCTCTGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142545664 Original CRISPR TTCTGGCTACCTCTGATGGG AGG Intronic
901810984 1:11766649-11766671 TCCTTGCTTCCTCGGATGGGAGG + Intronic
903460169 1:23515340-23515362 AGCTGGCTACCCCTGATGGAAGG - Intronic
904944145 1:34186985-34187007 TCCTGGCTACCTCTGGGTGGTGG - Intronic
906533542 1:46538458-46538480 TTCTGGCTAGCTCTGTTGTGGGG + Intergenic
910619282 1:89235699-89235721 GTCTGGCGACCTCTATTGGGAGG + Intergenic
914218421 1:145655727-145655749 GTCTGGCAACCCCTGGTGGGGGG + Intronic
914458123 1:147855556-147855578 TTCTGTCGACCCCTGCTGGGAGG - Intergenic
918786435 1:188769554-188769576 TTCTGGCCACCCCTGTTGGGAGG - Intergenic
919461583 1:197883954-197883976 ATCTGTCAACCCCTGATGGGAGG + Intergenic
922699342 1:227749478-227749500 TTCTTCCTACCTCTGCTGGGAGG + Intronic
924412396 1:243819699-243819721 GTCTGGCGACCCCTGTTGGGGGG - Intronic
1066256450 10:33684081-33684103 TGTTGGCTACCTCTGTTGTGAGG + Intergenic
1068783178 10:60943753-60943775 TTGTGCTTGCCTCTGATGGGAGG + Intronic
1071237064 10:83661489-83661511 TTCTGGCTACCTGTGAATTGTGG - Intergenic
1076877790 10:133225070-133225092 TCCTGGCTCCGTCTGCTGGGAGG - Exonic
1076929423 10:133520295-133520317 CTCTGGCGCCCTCTGGTGGGCGG + Intergenic
1079262478 11:18897034-18897056 GTCTGTCTACCGCTGCTGGGAGG + Intergenic
1080122130 11:28690295-28690317 TGCTTGCTACCTCTGGTGGGGGG + Intergenic
1082569685 11:54723061-54723083 TTCGCTCTACCTCTGATGAGGGG + Intergenic
1082994019 11:59234306-59234328 TTCTGGTGACCCCTGTTGGGAGG - Intergenic
1083062745 11:59891693-59891715 GTCTGGCAACCCCTGTTGGGAGG + Intergenic
1083452573 11:62755674-62755696 TTCTGGTTAGGTCTGATCGGAGG - Intergenic
1084121266 11:67070414-67070436 TTCTGGGTACCACTGCAGGGGGG - Exonic
1084725597 11:70939747-70939769 TTCTGCCTACCTCTAAAGAGAGG - Intronic
1085335096 11:75687556-75687578 GTCTGGCCACCCCTGTTGGGAGG + Intergenic
1085737688 11:79053656-79053678 GCCTGGCTTCCTCTGATGGTGGG - Intronic
1086800552 11:91169670-91169692 TTCTGGCAACCCCTTTTGGGAGG - Intergenic
1089659107 11:119974399-119974421 ATCTAGATACCTCTGATGGCTGG + Intergenic
1090479545 11:127055958-127055980 TTCTACTTACCTCTGATGGATGG - Intergenic
1090596801 11:128329219-128329241 TGCTGGCTCACTCTGAGGGGTGG - Intergenic
1095920558 12:47525998-47526020 TTCTGTCGACCCCTGTTGGGAGG + Intergenic
1096621265 12:52867143-52867165 TTCTGGCTCCCTGAGATGAGAGG + Intergenic
1096871962 12:54598434-54598456 TTCAGGCTTCCTCTGATGCTGGG + Intergenic
1097498515 12:60373748-60373770 GTCTGGCAACCACTGTTGGGTGG - Intergenic
1097910549 12:64965284-64965306 TTCTGGAGACCCCTGTTGGGAGG + Intergenic
1098764466 12:74468939-74468961 GTCTGGTGACCCCTGATGGGAGG + Intergenic
1099781665 12:87202982-87203004 CTCTGGCTACCACAGCTGGGAGG - Intergenic
1100318400 12:93466788-93466810 TGCTGGCTACCTATTATGGGAGG - Intergenic
1101296159 12:103425398-103425420 GTCTGTCGACCTCTGCTGGGAGG - Intronic
1101472600 12:105012913-105012935 TTCTGTCAACCTCTGCTGGGAGG + Intronic
1103517328 12:121515791-121515813 CTCTGCCTGCCTCTGATGGATGG + Intronic
1105316539 13:19270533-19270555 ATCTGTCGACCTCTGCTGGGAGG - Intergenic
1105769488 13:23594825-23594847 GTCTGGCGACCCCTGCTGGGAGG - Intronic
1106426515 13:29636086-29636108 GTCTGTCTACCCCTGCTGGGAGG + Intergenic
1107314739 13:39119391-39119413 GTCTGGCAACCTCTGTTGGGAGG + Intergenic
1107704264 13:43083998-43084020 TACTTGCTACCTCTGATCTGTGG - Intronic
1107968769 13:45621808-45621830 GTCTGTCAACCTCTGCTGGGAGG + Intergenic
1108691524 13:52863168-52863190 TTCTGACTACCTCAGAAGGATGG + Intergenic
1114477500 14:23007189-23007211 TTCTGGCTCCCGGTGATTGGCGG + Intronic
1115612496 14:35062089-35062111 TTCTGCCTTCCTTTGCTGGGAGG + Intronic
1116312255 14:43342069-43342091 GTCTGGCAACCGCTGTTGGGAGG + Intergenic
1118809066 14:69260619-69260641 TTATGGCAACCTCTGCCGGGCGG + Intronic
1119352149 14:73974897-73974919 GTCTGGGTACCTGTGCTGGGGGG - Intronic
1120699140 14:87678855-87678877 TTCTAGCTCTCCCTGATGGGAGG - Intergenic
1121896229 14:97650504-97650526 TTCTGGCTGCATCTGATAGATGG - Intergenic
1122936056 14:104956776-104956798 TTCTGGGCCCCTCTGAAGGGAGG - Intronic
1123885022 15:24718279-24718301 GTCTGGCTAGCCCTGTTGGGAGG + Intergenic
1124806101 15:32884603-32884625 TTCTGCCTACCACATATGGGTGG + Intronic
1125159100 15:36622866-36622888 TTCTGGCTTCCTCTGGTCTGGGG + Intronic
1126780461 15:52135096-52135118 TTCTTGCACCCTGTGATGGGAGG + Intronic
1129421374 15:75429943-75429965 CAGTGGCTACCTCTGAAGGGAGG + Intronic
1130030334 15:80308191-80308213 GTCTGGCGACCCCTGTTGGGAGG + Intergenic
1130985617 15:88842740-88842762 TTCTGGCTACCCCTGCTCAGTGG - Intronic
1131122464 15:89830981-89831003 TTCTTGCTACCAGGGATGGGGGG + Exonic
1131287422 15:91072763-91072785 TGGTGGTTACCTCAGATGGGGGG + Intergenic
1131602293 15:93861936-93861958 TTCTGGCAACCACTGCAGGGGGG + Intergenic
1134213223 16:12295325-12295347 TTCTGGCAACTTCTCCTGGGAGG - Intronic
1134215142 16:12311453-12311475 TCCTGGCTTCCTCTGCTGGCTGG + Intronic
1137969917 16:52974995-52975017 GTCTGTCGACCTCTGCTGGGAGG + Intergenic
1140287434 16:73617839-73617861 ATCTGGGTAGCTCTGAAGGGAGG - Intergenic
1141838431 16:86558635-86558657 ATCTGGCAACCTCTAATGTGAGG - Intergenic
1142172396 16:88629765-88629787 TCCTGGCTGGCTTTGATGGGTGG + Intronic
1142545664 17:700853-700875 TTCTGGCTACCTCTGATGGGAGG + Intronic
1143274802 17:5702486-5702508 ATTTGGGTATCTCTGATGGGTGG + Intergenic
1143375123 17:6462798-6462820 TTCTGGTTAGTTCTGATGTGGGG + Intronic
1145686223 17:26668154-26668176 TTCTGTCTACCTTTTATGTGAGG - Intergenic
1146641482 17:34545122-34545144 TTCTGGGTACCTCATATTGGTGG - Intergenic
1148107283 17:45125797-45125819 CTCTGGGTACCTCACATGGGTGG - Intronic
1148141903 17:45334913-45334935 TACTGGCTACCTCTGGAAGGAGG + Intergenic
1150510790 17:65750825-65750847 TTCTGGCTGCCCCAGAAGGGCGG - Intronic
1151378785 17:73710506-73710528 TTCTGCCTCCCTCTGATGGCTGG - Intergenic
1153991360 18:10403557-10403579 TTCTGTCTCCCTCTGAGGTGGGG + Intergenic
1154558595 18:15795005-15795027 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154559716 18:15810400-15810422 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154560572 18:15822265-15822287 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154565480 18:15890134-15890156 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154668151 18:17297087-17297109 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154670785 18:17332875-17332897 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154677398 18:17423139-17423161 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154699816 18:17730503-17730525 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154758114 18:18529931-18529953 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154763012 18:18596574-18596596 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154791002 18:18981563-18981585 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154822440 18:19413732-19413754 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154843811 18:19708637-19708659 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1154879662 18:20203465-20203487 TTCTGTCTAGCTGTTATGGGAGG - Intergenic
1155762968 18:29589227-29589249 GTCTGGCAACCCCTGTTGGGGGG - Intergenic
1156415072 18:36879451-36879473 GTCTGTCAACCTCTGCTGGGAGG + Intronic
1156827277 18:41446432-41446454 TTCTGGGTACCTCAGATCAGTGG - Intergenic
1157676991 18:49576246-49576268 TACTGGCTACATCTGAAGAGTGG - Intronic
1158290322 18:55933028-55933050 CTCTGTCTACCCCTCATGGGAGG - Intergenic
1160688770 19:450553-450575 CTCTGGGGACCTCTGATGGGTGG + Intronic
1165269970 19:34697370-34697392 ATCTGTCAACCTCTGTTGGGAGG - Intergenic
1166291994 19:41869316-41869338 TCCTGCCTGCCTCTGATAGGAGG - Intronic
1167277083 19:48545249-48545271 CTCAGGCAACCTCAGATGGGTGG - Intergenic
1168077087 19:53986853-53986875 TTGGGGCTGCCTCTGGTGGGTGG - Exonic
926109982 2:10175928-10175950 TTCTAGGTACCTCCTATGGGTGG + Intronic
930455677 2:51605337-51605359 GTCTGGTGACCTCTGTTGGGAGG + Intergenic
930885874 2:56325715-56325737 TTCTGTCTACCTCTGAGAGTTGG + Intronic
933488212 2:82950004-82950026 GTCTGTCTACCCCTGCTGGGAGG + Intergenic
937082900 2:119153233-119153255 CATTGGCTACCTCTGATTGGTGG - Intergenic
937679386 2:124627285-124627307 TTCTGGTGACCCCTGTTGGGAGG - Intronic
938634133 2:133204373-133204395 ATTTGGATACCTCTGATGGGGGG - Intronic
940030477 2:149257076-149257098 GTCTGTCGACCTCTGCTGGGAGG + Intergenic
940957299 2:159742396-159742418 TTCTGTCTACCTCTAAGAGGTGG + Intronic
942119830 2:172765787-172765809 GTCTGGCTGCCACTGTTGGGAGG + Intronic
942226876 2:173824107-173824129 TTCTGTGTACCACTGATGTGGGG - Intergenic
946326257 2:218985952-218985974 TCCTGGCAACTTATGATGGGTGG + Intergenic
947532604 2:230922283-230922305 TCCTGGCTCCCTCTGCTTGGGGG + Intronic
948798278 2:240418144-240418166 TGTTGGCTACTTCTGATTGGTGG - Intergenic
1169176713 20:3522627-3522649 GTCTGTCGACCCCTGATGGGAGG - Intronic
1169399188 20:5265372-5265394 CTCTGGCTACTCCTGATGGGTGG + Intergenic
1170374295 20:15683526-15683548 CTCTGGGTCCCTCAGATGGGTGG - Intronic
1171080845 20:22181967-22181989 TTCTGGCTCTGTCTGCTGGGAGG - Intergenic
1175181273 20:57149260-57149282 TTCTGGTTCCATGTGATGGGAGG - Intergenic
1176534746 21:8028488-8028510 TTCTGCCTACTTTTTATGGGAGG + Intergenic
1178007177 21:28234755-28234777 GTCTGTCTACCCCTGTTGGGAGG - Intergenic
1179728250 21:43352932-43352954 TGTTGGCTGCCTCTGATTGGTGG + Intergenic
1180320299 22:11313606-11313628 TTCTGGTGACCCCTGTTGGGAGG - Intergenic
1185340545 22:50288969-50288991 TTCTGGGCACCTCTGATGGCCGG - Exonic
950723660 3:14901966-14901988 TTCTGGCAACCTCGGCTGGAAGG - Intronic
951254421 3:20432553-20432575 GTCTGTCTACCCCTGCTGGGAGG + Intergenic
952878792 3:37970085-37970107 CTCTCACTACCTCTGATGGCTGG + Intronic
954815265 3:53275348-53275370 TTCTGTCTTCATCTGATGGTGGG + Intergenic
957930874 3:86876592-86876614 GTCTGTCAACCTCTGCTGGGAGG + Intergenic
958515706 3:95112623-95112645 GTCTGGCAACCTCTCTTGGGAGG + Intergenic
959428610 3:106223819-106223841 GTCTGTCGACCTCTGCTGGGAGG + Intergenic
959801073 3:110495735-110495757 GTCTGTCGACCTCTGCTGGGAGG - Intergenic
960277168 3:115741870-115741892 GTCTGGCAACCCCTGTTGGGGGG + Intergenic
964047885 3:152353240-152353262 CTCTGCCTTCCTCTGATGTGTGG + Intronic
967612307 3:191521730-191521752 TTCTGCCTACCACAGCTGGGAGG + Intergenic
969412605 4:7039184-7039206 TGCTGGCTACCTCTGAAGAACGG - Intergenic
971285969 4:25290549-25290571 GTCTGGCAACCTCTGTTGGGAGG + Intergenic
972861077 4:43169563-43169585 GTCTGGCGACCCCTGTTGGGAGG - Intergenic
973028821 4:45309937-45309959 TTCTGGCTGCCTTTGTTGGGGGG - Intergenic
976527805 4:86114620-86114642 GTCTGGCAACCCCTGTTGGGAGG + Intronic
977716770 4:100191277-100191299 TTCTGGCGAGCCCTGTTGGGAGG + Intergenic
979379490 4:119993531-119993553 TAATGGCTACTTCTGTTGGGAGG - Intergenic
980155122 4:129094998-129095020 TTCTGGCTATAACTGATGAGTGG + Intronic
980157564 4:129125956-129125978 TTCTGTCAACCCCTGCTGGGAGG + Intergenic
980200662 4:129652218-129652240 GTCTGTCAACCTCTGTTGGGAGG - Intergenic
980223239 4:129947393-129947415 GTCTGTCTACCCCTGCTGGGAGG + Intergenic
980232213 4:130059864-130059886 AACTGGCAACCTCTGATTGGTGG - Intergenic
980769398 4:137351591-137351613 GTCTGTCGACCTCTGTTGGGAGG - Intergenic
983331316 4:166333152-166333174 GTCTGTCAACCTCTGTTGGGAGG + Intergenic
983958734 4:173727375-173727397 TTCTGTCAACCCCTGCTGGGAGG + Intergenic
984376256 4:178934382-178934404 TTCTGGCTGCCTGTGAAGAGTGG - Intergenic
984914065 4:184704707-184704729 TTCTGGGTACCTCATATGAGTGG - Intronic
986224249 5:5798385-5798407 TTCTGTCTACCACAGATGGCAGG + Intergenic
986586149 5:9320336-9320358 TTAAGGATACCTCTGAGGGGAGG + Intronic
986775777 5:11012582-11012604 CTCTGGCCACCTCTGCTGAGGGG - Intronic
987049236 5:14135644-14135666 TAATTCCTACCTCTGATGGGAGG + Intergenic
987837339 5:23178772-23178794 GTCTGGTGACCTCTGTTGGGAGG + Intergenic
988860716 5:35275235-35275257 AGCTGGCAACCTCTGATTGGTGG + Intergenic
989912727 5:49678248-49678270 TTCTGGCTACTTTTTATGTGAGG - Intergenic
989941538 5:50156862-50156884 GTCAGTCTACCCCTGATGGGGGG - Intergenic
991227746 5:64292563-64292585 GTCTGGATACCTCTGTTGGGAGG + Intronic
991488870 5:67164811-67164833 TTCTGGAGACCTCGGCTGGGGGG - Exonic
994005095 5:94828381-94828403 GTCTGTCGACCTGTGATGGGAGG + Intronic
995829176 5:116334661-116334683 TTCTGGCTGCCTATGATGACGGG - Intronic
995830751 5:116352834-116352856 TACTGGATATCTCTGATGGTAGG + Intronic
996875771 5:128238926-128238948 TGCTGGATACATCTGATGTGGGG - Intergenic
997489851 5:134264598-134264620 TACTGGTTTCCTTTGATGGGAGG + Intergenic
1000782107 5:165495076-165495098 TTTTGCTTACCTTTGATGGGTGG + Intergenic
1003486198 6:6581684-6581706 TTCTGTCTCCCTCAGATGGAGGG - Intergenic
1006200038 6:32279926-32279948 GTCTGTCAACCACTGATGGGAGG - Intergenic
1009570250 6:65375095-65375117 GTCTGTCGACCTCTGTTGGGAGG - Intronic
1011340224 6:86306318-86306340 ATCTGTCTACCTCTGATGTCAGG + Intergenic
1012528817 6:100210080-100210102 TTCTAGCTACATGTGAGGGGGGG + Intergenic
1013932041 6:115545684-115545706 GTCTGGCAACCCCTGTTGGGAGG - Intergenic
1014584674 6:123183160-123183182 GTCTGTCGACCTCTGTTGGGAGG - Intergenic
1014868297 6:126559159-126559181 ATCTGTCTACCTCTACTGGGAGG - Intergenic
1015528478 6:134196635-134196657 TGCTGGCCAACTCTGATGTGAGG + Intronic
1015701270 6:136038314-136038336 TCCTGCCTAGCTCTGCTGGGTGG - Intronic
1018181336 6:161226128-161226150 TACTGGCTACCTCTGCTGGGAGG - Intronic
1018454874 6:163942983-163943005 TCCTGCCTACCTTTGATGAGGGG - Intergenic
1021207941 7:17807677-17807699 GTCTGTCGACCCCTGATGGGAGG - Intronic
1021517492 7:21504197-21504219 CTATGGCTACCTCTGCTGGAAGG + Intronic
1021805707 7:24352850-24352872 GTCTGTCGACCTCTGCTGGGAGG - Intergenic
1024795260 7:53012450-53012472 GTCTGGCAACCCCTGTTGGGAGG + Intergenic
1030586844 7:111431469-111431491 TTTTGGCTGCCTATGTTGGGCGG - Intronic
1030692120 7:112546872-112546894 GTCTGGCGACCCCTGTTGGGAGG + Intergenic
1031164910 7:118216265-118216287 TTCTGGTTTGCTCTGATTGGGGG - Intronic
1033142501 7:138840188-138840210 TACTGGCTGCCTCTGCTTGGCGG + Exonic
1035848840 8:2894004-2894026 TCCTGGCTAGCTCAGATGTGGGG - Intergenic
1036727349 8:11231663-11231685 CTCTGGCTACCTGTCCTGGGAGG - Intergenic
1038043772 8:23749079-23749101 TTCTGGCTTTCTGTGATGTGTGG - Intergenic
1038517143 8:28196974-28196996 TTCTGGCTTCCTCTCCTGCGTGG - Intergenic
1038657189 8:29464055-29464077 TTCTGGGTACCTCATATAGGTGG + Intergenic
1039163068 8:34644184-34644206 TTCTGTCTCCCTCTGCTGGAAGG + Intergenic
1040736629 8:50516007-50516029 TTCTGTCGACCTCTGCTGGGAGG - Intronic
1041699423 8:60771897-60771919 TTCTGGCTAGGTCTGACTGGGGG - Intronic
1045957775 8:107929127-107929149 CTCTTCCTACCTCTGATGGATGG + Intronic
1046176848 8:110587064-110587086 TTCTAGCTACTACTGAAGGGTGG - Intergenic
1049423206 8:142525901-142525923 TCCTGGCCTCCTCTGCTGGGGGG - Intronic
1050300427 9:4253041-4253063 CTCTGTCAACCCCTGATGGGAGG + Intronic
1051611566 9:18967174-18967196 GTCTGTCTACCCCTGCTGGGAGG + Intronic
1052387085 9:27835306-27835328 GTCTGGCAACCTCTGTTGGGGGG + Intergenic
1053140716 9:35680992-35681014 TCTCGGCTACCTCTGCTGGGCGG - Exonic
1056814303 9:89790439-89790461 TCCTGGCTGCCTTTGATTGGAGG - Intergenic
1057688849 9:97264692-97264714 TTCTAGCTACCTCACATGAGTGG - Intergenic
1062038333 9:134392601-134392623 TTCTGGGTCCCTGGGATGGGTGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1203368519 Un_KI270442v1:279360-279382 TTCTGGTGACCCCTGTTGGGAGG - Intergenic
1203406718 Un_KI270538v1:27168-27190 TTCTGTCTACCTTTTATGTGAGG - Intergenic
1186532347 X:10310054-10310076 ATCTGGCTTGTTCTGATGGGAGG - Intergenic
1186913330 X:14193259-14193281 ATCTGGTGACCCCTGATGGGGGG + Intergenic
1190193566 X:48297121-48297143 TTCTGGCTGCTTCTGTTGTGGGG + Intergenic
1190660080 X:52645744-52645766 TTCTGGCTCCTTCTGTTGTGGGG + Intronic
1191043723 X:56113806-56113828 GTCTGGTGACCTCTGTTGGGAGG + Intergenic
1191065476 X:56343054-56343076 TTCTGGAGACCCCTGTTGGGAGG + Intergenic
1191133221 X:57037461-57037483 GTCTGTCGACCTCTTATGGGAGG + Intergenic
1191651046 X:63537748-63537770 GTCTGGCAACCCCTGTTGGGAGG - Intergenic
1192042381 X:67636278-67636300 TAGTGGTTACCTCTGAGGGGAGG - Intronic
1192691260 X:73367089-73367111 TTCTTGCTTCCTCAGCTGGGAGG - Intergenic
1195213043 X:102669273-102669295 GTCTGGCTACCCCTGTTGGGAGG + Intergenic
1195880908 X:109591626-109591648 CTCTAGCTACCACTGATGGGGGG - Intergenic
1197361414 X:125508262-125508284 TTCTGTCAACTTCTGATGGCTGG + Intergenic
1197483033 X:127010813-127010835 TTCAGTCTACCACTGATGGGCGG - Intergenic
1199947610 X:152680957-152680979 GTGTGGCTACCTCTGCTGAGCGG - Intergenic
1199962069 X:152787497-152787519 GTGTGGCTACCTCTGCTGAGCGG + Intergenic
1201961869 Y:19689929-19689951 GTCTGTCGACCTCTGCTGGGAGG + Intergenic