ID: 1142567284

View in Genome Browser
Species Human (GRCh38)
Location 17:848918-848940
Sequence CTCCATACCACACATGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142567279_1142567284 11 Left 1142567279 17:848884-848906 CCAAGTACCTATCCACTGCTCAG 0: 1
1: 0
2: 1
3: 4
4: 149
Right 1142567284 17:848918-848940 CTCCATACCACACATGTGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 199
1142567283_1142567284 -1 Left 1142567283 17:848896-848918 CCACTGCTCAGCAGGACGTCGGC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142567284 17:848918-848940 CTCCATACCACACATGTGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 199
1142567281_1142567284 4 Left 1142567281 17:848891-848913 CCTATCCACTGCTCAGCAGGACG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1142567284 17:848918-848940 CTCCATACCACACATGTGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142567284 Original CRISPR CTCCATACCACACATGTGCC TGG Intronic
901478098 1:9504697-9504719 CTCAATGCCACACCTGTACCAGG + Intergenic
903561068 1:24228117-24228139 CTCCATAACATACAAGTGCAAGG - Intergenic
907730626 1:57062105-57062127 CTCCAAACCACTGAAGTGCCCGG - Intronic
909695074 1:78458755-78458777 CTCCATAACACAAAAGTGCAAGG + Intronic
915849085 1:159301971-159301993 CTGAATACCAAACATATGCCAGG - Intronic
916118143 1:161505609-161505631 CTCCTTACCACACTGGTACCTGG - Intronic
919422150 1:197383164-197383186 CTTCATCCCACACATATCCCTGG + Intronic
919494971 1:198253321-198253343 CTCCATACTACACTTGTTTCTGG - Intronic
922776672 1:228217314-228217336 CTCCCCACCCCACATGGGCCTGG - Intronic
923014649 1:230117105-230117127 CTCCATACCATAAACGTGCAAGG - Intronic
924177440 1:241406537-241406559 CTCCATCCCAGACATGTAACTGG - Intergenic
924656856 1:245980276-245980298 CTACCTGCCACACATGTGCAAGG - Intronic
1067814149 10:49459316-49459338 CACAAGACAACACATGTGCCAGG + Intronic
1067832068 10:49616040-49616062 CTCCACACCAGAGATGTGGCCGG + Intronic
1068081441 10:52322726-52322748 CTCCATAACACAAAAGTGCAAGG + Intergenic
1068940858 10:62679656-62679678 CTCCATAACATAAATGTGCAAGG - Intergenic
1069800164 10:71077043-71077065 CTCCTTACCACACATTTTCATGG - Intergenic
1070619897 10:78001295-78001317 CTCCAACCCACACATGCTCCTGG - Intronic
1071083188 10:81837499-81837521 CTCCATTCCACAGATGTGGGGGG - Intergenic
1071763833 10:88639282-88639304 CTCCATAACACAAAAGTGCAAGG - Intergenic
1071990560 10:91097243-91097265 CCCTATACCACACCTCTGCCTGG + Intergenic
1075236621 10:120736627-120736649 CTCCACACCTGCCATGTGCCGGG - Intergenic
1076513484 10:131029024-131029046 CTCCATAACACAAAAGTGCAAGG + Intergenic
1076550052 10:131272564-131272586 CTCCCTACCAGCCCTGTGCCTGG + Intronic
1082254325 11:50015695-50015717 CTCCTTAGAACACATTTGCCAGG - Intergenic
1083161996 11:60860051-60860073 CTCAGGCCCACACATGTGCCAGG + Intergenic
1083700583 11:64475202-64475224 CTCTTTCCCACACATGTGTCAGG - Intergenic
1084570349 11:69956091-69956113 CTCCCCACCACACCTCTGCCAGG - Intergenic
1084964882 11:72739324-72739346 GGCCACACCACACATGGGCCAGG - Intronic
1087141671 11:94770121-94770143 CTGCATACCACTCCTGGGCCCGG + Intronic
1087792937 11:102426294-102426316 ATCCATAGCACTTATGTGCCAGG + Intronic
1089459961 11:118646917-118646939 CTCCTTTCCCCACATTTGCCAGG - Intronic
1089700396 11:120240782-120240804 CTCCATTTCACACATATGCCCGG - Intronic
1089783946 11:120894805-120894827 CTCGAAGCCACACACGTGCCAGG - Intronic
1090062070 11:123472806-123472828 CTCCTTACCATACATGTGGCTGG + Intergenic
1091003612 11:131932096-131932118 CTCCATGCCAACCATGTGCCAGG + Intronic
1091199231 11:133760404-133760426 CTCCATAGCACAAAAGTGCAAGG + Intergenic
1093028266 12:14264505-14264527 TTCCATTCCAGACATTTGCCAGG + Intergenic
1093575204 12:20719775-20719797 CTCCATAACACAAAAGTGCAAGG + Intronic
1094280069 12:28727055-28727077 CTCCATAACACAAAAGTGCAAGG - Intergenic
1094846619 12:34364165-34364187 CTTCCCACCACACATGTGCAGGG - Intergenic
1094847849 12:34369192-34369214 CTCCCTACCGCACATGCGCATGG - Intergenic
1094855612 12:34401541-34401563 CTCCACACCACGCATGTGCAGGG + Intergenic
1094872659 12:34606869-34606891 CTCCCCACCACACATGTGCGGGG + Intergenic
1096240545 12:49957636-49957658 CTCCATAGCACATATGGCCCAGG - Exonic
1096716474 12:53494352-53494374 CTCTAAGCCATACATGTGCCAGG + Intronic
1097009084 12:55939856-55939878 CCCCACACCATCCATGTGCCAGG - Intronic
1098206615 12:68117471-68117493 CTCTATAACACAAATGTGCAAGG - Intergenic
1099218403 12:79881579-79881601 CTCCATATCATACAAGTGCAAGG + Intronic
1100883422 12:99043030-99043052 CTCCATACCACTCATGTAGATGG + Intronic
1101155887 12:101927252-101927274 CATCATATCACACATGTGCAAGG + Intronic
1101309896 12:103567468-103567490 CTCCAAACCACACAAGTACATGG + Intergenic
1101531553 12:105577761-105577783 CTCCACACCACATATCTTCCGGG - Intergenic
1103014043 12:117480320-117480342 CCCCCTACCACACCCGTGCCAGG - Intronic
1103024730 12:117564192-117564214 CTCCACACCAGATATGGGCCAGG + Intronic
1104461766 12:128962148-128962170 CGCCATAGGACACAAGTGCCAGG - Intronic
1105962520 13:25354979-25355001 CCCCAAACCACGCATGTGCAGGG + Intergenic
1105998539 13:25696557-25696579 CTCCATAACATAAAAGTGCCAGG - Intronic
1107143748 13:37034571-37034593 CTCCATAACACAAAAGTGCAAGG + Intronic
1107257937 13:38453038-38453060 CTCCATAACACAAAAGTGCAAGG + Intergenic
1108226791 13:48297547-48297569 CTGCATGCCTAACATGTGCCTGG - Intergenic
1108256853 13:48619306-48619328 CCCCATACTGCACATGTGTCGGG - Intergenic
1108517809 13:51219602-51219624 CTACATACCTCTCAGGTGCCTGG + Intergenic
1109131306 13:58589716-58589738 CTCCATAACATAAAAGTGCCAGG + Intergenic
1109749592 13:66672417-66672439 CCCCATAGCACACCTCTGCCTGG - Intronic
1110559762 13:76898329-76898351 CTCCATAGCAAACTTCTGCCTGG + Intergenic
1112588403 13:100740544-100740566 CTCCCTGCCACAGATGTGTCTGG + Intergenic
1113484448 13:110643983-110644005 GTCCGTACAAAACATGTGCCAGG + Intronic
1113517320 13:110914121-110914143 CTCCATCCCACACAGCTGCCGGG + Intronic
1114259914 14:21029190-21029212 CTCCATGCTACACTTGAGCCTGG + Intronic
1114695635 14:24624636-24624658 CTCCTTACCCCACATGGGCTTGG + Intergenic
1115376140 14:32677929-32677951 CTCCAACCCACACATTTGCATGG - Intronic
1115495519 14:34000595-34000617 TTCCATTCCTCACATCTGCCAGG + Intronic
1120582060 14:86264624-86264646 CTCAAAACCACACAAGTGCATGG - Intergenic
1121567220 14:94919130-94919152 CACAATCCCACACATGTCCCAGG + Intergenic
1122163490 14:99803250-99803272 CACCATGCCACACATGTGACAGG + Intronic
1123095712 14:105766109-105766131 CCTCATGCCACCCATGTGCCAGG + Intergenic
1125033355 15:35095089-35095111 CTCCTTACCATACACGTGGCTGG - Intergenic
1125933530 15:43616371-43616393 CTGCATACCACACAGCTGTCTGG + Exonic
1125946628 15:43715833-43715855 CTGCATACCACACAGCTGTCTGG + Intergenic
1130408105 15:83620962-83620984 CTCCATAACATAAATGTGCAAGG - Intergenic
1131878911 15:96841595-96841617 CTCCATACCACAAAAGTGCAAGG + Intergenic
1135933401 16:26758842-26758864 CTGAACACCACCCATGTGCCTGG + Intergenic
1138297964 16:55902819-55902841 TTCCTTACAACACATGTGCCTGG + Intronic
1138433233 16:56982698-56982720 CACCATAGCACACGTGTGCTGGG + Intronic
1138738568 16:59280605-59280627 CACCATACACCACAAGTGCCTGG + Intergenic
1139042900 16:63019637-63019659 CTCCATACTAGACATGTTCTAGG - Intergenic
1139094195 16:63684784-63684806 CTCCCAATCACACATGTTCCTGG + Intergenic
1140229679 16:73107570-73107592 CTCCACATCACTCCTGTGCCTGG + Intergenic
1141021931 16:80505525-80505547 GTCCATATCACACAGTTGCCTGG + Intergenic
1141557411 16:84845296-84845318 CTCCTTACTACGCATGTTCCAGG - Intronic
1141678943 16:85532763-85532785 CTCCAAAATACACATGTGGCAGG - Intergenic
1142567284 17:848918-848940 CTCCATACCACACATGTGCCTGG + Intronic
1144780991 17:17808322-17808344 CTGCATGCCACACATGTGCAGGG + Intronic
1145277681 17:21444040-21444062 CTCCATAACATAAAAGTGCCAGG - Intergenic
1145315516 17:21729919-21729941 CTCCATAACATAAAAGTGCCAGG - Intergenic
1145797759 17:27665813-27665835 CTCCGTGCCACACCTGTGCCGGG - Intergenic
1148885886 17:50772413-50772435 CTCCACAGCACAGGTGTGCCGGG - Intergenic
1150178002 17:63082655-63082677 CTACAGTCCATACATGTGCCGGG - Intronic
1150361480 17:64538720-64538742 CTCCATACCAGATATGAGGCTGG - Intronic
1151769856 17:76153477-76153499 CTCCAGAGCACACGTATGCCCGG - Intronic
1154144571 18:11856380-11856402 CTGCATAGCAAACGTGTGCCTGG + Intronic
1155239165 18:23848595-23848617 CTCCATAATATCCATGTGCCTGG - Intronic
1155799347 18:30081613-30081635 CTGCATGCCACTCATGGGCCTGG - Intergenic
1159175580 18:64829337-64829359 CTCCATAACATAAATGTGCAAGG - Intergenic
1160189090 18:76700143-76700165 CTGCATTCCACACTTCTGCCTGG - Intergenic
1163434836 19:17289250-17289272 CTACATACAAAACATGAGCCGGG + Intergenic
1165417664 19:35704673-35704695 CCCCATACCCCAGATTTGCCTGG - Intronic
1166660017 19:44640688-44640710 CTCTAGACCACAAATGTGCATGG + Intergenic
925953688 2:8939609-8939631 CTCCACACCACACAGGTCCTAGG + Intronic
933082206 2:78004796-78004818 CTCCAGCCCTCACCTGTGCCTGG - Intergenic
933562189 2:83901580-83901602 CTCCTTACTATACATGTGGCTGG + Intergenic
933979061 2:87535927-87535949 CTCCTTACCCCAGATGGGCCAGG + Intergenic
935124085 2:100207594-100207616 CTCCCTTCCCCACATGAGCCTGG + Intergenic
935168827 2:100593784-100593806 CTCCATAACACAAAAGTGCAAGG - Intergenic
935711849 2:105906030-105906052 CCCCATATCACAAAAGTGCCTGG - Intergenic
935850827 2:107217004-107217026 CTCCTTACCGTACATGTGGCTGG - Intergenic
936314766 2:111414865-111414887 CTCCTTACCCCAGATGGGCCAGG - Intergenic
936551760 2:113449026-113449048 CTCCATAACACAAAAGTGCAAGG - Intronic
937338752 2:121077575-121077597 CACCATACCCCACATGGGCCAGG + Intergenic
938313998 2:130314184-130314206 TCCCATACCACACCTGTGCCTGG + Intergenic
938405373 2:131029930-131029952 CTCCATGCCCCACATCTGACAGG - Intronic
942065539 2:172267999-172268021 CTCAAAACCACACAAGTACCTGG - Intergenic
947525027 2:230872472-230872494 CTCCAGGCCACACATGTGTGGGG - Intronic
947764568 2:232629038-232629060 CTCCCTCCCTCACATGTCCCAGG - Intronic
948439580 2:237978163-237978185 CTCCACACCACACCTGTCCCAGG - Intronic
948734452 2:239991865-239991887 CTCTATACTACACATGGTCCAGG - Intronic
948807268 2:240458492-240458514 CCCCATACCAGACTCGTGCCTGG + Intronic
1169195605 20:3680755-3680777 ACCCACACCACACCTGTGCCCGG - Intronic
1169695966 20:8386851-8386873 CTCCATAACATACAAGTGCAAGG - Intronic
1172184243 20:33021386-33021408 CTCCATATCCCACATCTGCTCGG + Intronic
1172215552 20:33233276-33233298 CTGGATCCCATACATGTGCCTGG - Intergenic
1174421424 20:50401452-50401474 TTCTATAGCACTCATGTGCCTGG + Intergenic
1174633436 20:51978352-51978374 CCTCTTACCACACATGTGTCAGG - Intergenic
1177807975 21:25893720-25893742 CTCCATAACACAGAAGTGCAAGG + Intronic
1181434155 22:22900555-22900577 CTCCAGAACACACATTTGGCTGG + Intergenic
1181435093 22:22905921-22905943 CTCCAGAACACACATTTGGCTGG + Intergenic
1182036044 22:27199067-27199089 CTGCCTCCCACAGATGTGCCAGG - Intergenic
1183402728 22:37614103-37614125 CTCCTGACCACACCTTTGCCAGG + Intronic
1184870612 22:47235642-47235664 CTCCATGCCAAAAATGTGCATGG - Intergenic
950255180 3:11498753-11498775 CTTCATACCACACAGGGGCCAGG + Intronic
950452126 3:13071479-13071501 CTCCCTGCCACACCTTTGCCTGG - Intronic
950706499 3:14785736-14785758 CTCCATGCCCCACAGCTGCCGGG + Intergenic
952931933 3:38367223-38367245 CTCTATGCCAATCATGTGCCTGG - Intronic
953138494 3:40205049-40205071 CTCTATGCCACACAGGTGCCAGG + Intronic
953151357 3:40328318-40328340 TTCCAAACTACACATATGCCTGG + Intergenic
954542095 3:51400322-51400344 CCCCATACCACAAACTTGCCTGG + Intronic
954883785 3:53854564-53854586 ATTCATACCACAGAGGTGCCGGG + Intronic
955151051 3:56367549-56367571 ATCCATCCCACCCATGGGCCAGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
956960708 3:74396845-74396867 CTCCATAACATACAAGTGCAAGG + Intronic
958800810 3:98753363-98753385 CTCCATAACACAAAAGTGCAAGG + Intronic
960035619 3:113099989-113100011 CTCCATAACATACAAGTGCAAGG - Intergenic
961372917 3:126442345-126442367 CTCCATACCCCACCTGTGGGTGG + Intronic
964721114 3:159767934-159767956 CTCCATCCCAGGCATGTTCCAGG - Intronic
964942203 3:162172557-162172579 CTCCATAACATAAAAGTGCCAGG + Intergenic
965989585 3:174800501-174800523 CTCTATACCAAACTTTTGCCTGG - Intronic
970945073 4:21681525-21681547 ATCCATACCACAAAAGTGCAAGG - Intronic
971261259 4:25058918-25058940 CTCCCTACCATACACGTGGCTGG - Intergenic
974087220 4:57273965-57273987 CTCCATACCACACCAGGGCATGG - Intergenic
975611297 4:76206174-76206196 CACCATACCCCAAATCTGCCGGG + Intronic
976114209 4:81709804-81709826 CTCTATACCACAAAGGTGACAGG + Intronic
980689890 4:136281507-136281529 GTCCTTGCCCCACATGTGCCTGG - Intergenic
982795627 4:159640363-159640385 CTGAATACCACATGTGTGCCAGG - Intergenic
984192958 4:176626078-176626100 CTCCTTACAATACATGTGGCTGG - Intergenic
984853510 4:184173761-184173783 CTCCGTACCTAACCTGTGCCTGG - Intronic
985083068 4:186286238-186286260 CACGATATCGCACATGTGCCAGG - Intronic
985482734 5:127044-127066 CTCCTTACTATACATGTGGCTGG + Intergenic
987154561 5:15076199-15076221 CCCCATGCCACACATGGGCATGG - Intergenic
989952965 5:50322657-50322679 CTCCATAACATAAATGTGCAAGG + Intergenic
991931332 5:71755781-71755803 CTCCATTGCACACTTGAGCCAGG - Intergenic
993247133 5:85465437-85465459 GTCCTTGCCTCACATGTGCCTGG + Intergenic
997835493 5:137189112-137189134 CTCCATAACACAAAAGTGCAAGG + Intronic
998064819 5:139149435-139149457 CTGCAATCCAGACATGTGCCAGG + Intronic
999076371 5:148799633-148799655 CTCCATTCCTATCATGTGCCTGG + Intergenic
999254457 5:150202337-150202359 CTTCAATCCACACCTGTGCCGGG - Exonic
1000448674 5:161357329-161357351 CAATATACCACACATGTTCCTGG - Intronic
1003660021 6:8051447-8051469 CTCCATAACATACAAGTGCAAGG + Intronic
1008535742 6:52504944-52504966 CAGCATACATCACATGTGCCAGG + Intronic
1009627353 6:66152356-66152378 CTCCATAACATACAAGTGCAAGG + Intergenic
1015120172 6:129692429-129692451 CTCCATACAAACCATTTGCCTGG + Intronic
1015312263 6:131778971-131778993 TTCCAAAACACACATGTGGCCGG + Intergenic
1017355227 6:153497232-153497254 CTCCATAACATACAAGTGCAAGG + Intergenic
1018376941 6:163221826-163221848 CTCCAATACACACCTGTGCCTGG - Intronic
1018751832 6:166813156-166813178 CTCCATATCACACATGGGGGAGG + Intronic
1018783561 6:167090801-167090823 CTATATACCACACATGAGGCAGG + Intergenic
1019698609 7:2461370-2461392 CTCCACACCACACCTGGGGCAGG - Intergenic
1020403033 7:7799371-7799393 CTTCACACAACACATCTGCCTGG - Intronic
1020430578 7:8112895-8112917 CTCCCTGCCACACATGTCACAGG - Intergenic
1022948995 7:35317551-35317573 CTGCATACCATCCATGTGCCAGG + Intergenic
1023468079 7:40480809-40480831 CTTCAGACCACAAAAGTGCCCGG + Intronic
1023981527 7:45073395-45073417 CTCCATCCCACACACGTTTCAGG - Intronic
1025195964 7:56933778-56933800 CTCCATAACACAAAAGTGCAAGG + Intergenic
1025675984 7:63643158-63643180 CTCCATAACACAAAAGTGCAAGG - Intergenic
1030310668 7:108066161-108066183 ATCAATAACACACATTTGCCTGG - Intronic
1033286949 7:140049543-140049565 GTCCATAGTACACCTGTGCCTGG - Intronic
1035329552 7:158087400-158087422 CTTCTTACCATAGATGTGCCTGG - Intronic
1035360607 7:158310969-158310991 CCCCACACCACACATCTGCCTGG + Intronic
1035689190 8:1548737-1548759 CGCCAGACCACACGTGTGCCCGG - Exonic
1038680703 8:29664376-29664398 CTCCATTCTACACTTGTCCCTGG + Intergenic
1042822167 8:72941665-72941687 CTCAATTTCACACATGTCCCTGG + Intergenic
1045612666 8:103864462-103864484 CTCAAAACCACACAAGTACCTGG - Intronic
1046445950 8:114319450-114319472 ATCCATACCACACATGGAGCAGG - Intergenic
1046917602 8:119693554-119693576 TTCCATACTGCACATGTGCCAGG + Intergenic
1047139137 8:122116726-122116748 CTCCAAACTACACAAGTACCTGG + Intergenic
1047171060 8:122492603-122492625 CAGCATTCCTCACATGTGCCTGG - Intergenic
1047434410 8:124824005-124824027 CTCCATCCCACAAATGGGCAGGG - Intergenic
1048268017 8:133004724-133004746 CTGCCAACCACACATCTGCCTGG + Intronic
1051353883 9:16223489-16223511 TTCCATACCCCACTGGTGCCTGG + Intronic
1051903267 9:22065290-22065312 CTCCATCTCACAAATGAGCCAGG - Intergenic
1053296573 9:36918840-36918862 CTCCATAACACAAAGGTGCAAGG + Intronic
1056093744 9:83230241-83230263 CTCCATAACATAAATGTGCAAGG - Intergenic
1057138359 9:92711018-92711040 CTCCACTCCACTCATGTGCGTGG + Intergenic
1060909754 9:127340186-127340208 CTCTTTCCCACACATGTGCATGG - Intronic
1061826189 9:133259740-133259762 CCACATGGCACACATGTGCCAGG + Intronic
1061921647 9:133785724-133785746 CCCCATACAACTCATCTGCCAGG + Intronic
1188205894 X:27358084-27358106 TTCCATTCCCAACATGTGCCAGG - Intergenic
1191665684 X:63700279-63700301 CTCTATACCACACAAGTTTCTGG + Intronic
1191728943 X:64313300-64313322 CTCCATAACACAAAAGTGCAAGG - Intronic
1201532585 Y:15008520-15008542 TTCCTTACCACACATGTGGTTGG - Intergenic