ID: 1142569350

View in Genome Browser
Species Human (GRCh38)
Location 17:862759-862781
Sequence GGCTCCTGGTGAGATGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142569344_1142569350 26 Left 1142569344 17:862710-862732 CCAAATGTTTAACCTCAGCATCA 0: 1
1: 0
2: 0
3: 19
4: 192
Right 1142569350 17:862759-862781 GGCTCCTGGTGAGATGCAACAGG 0: 1
1: 0
2: 1
3: 13
4: 155
1142569346_1142569350 14 Left 1142569346 17:862722-862744 CCTCAGCATCATCAATAACAGGA 0: 1
1: 0
2: 3
3: 22
4: 311
Right 1142569350 17:862759-862781 GGCTCCTGGTGAGATGCAACAGG 0: 1
1: 0
2: 1
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142569350 Original CRISPR GGCTCCTGGTGAGATGCAAC AGG Intronic
900238210 1:1602389-1602411 AGCTCCTGGTGAGAGGCCAGTGG + Intergenic
900623053 1:3596194-3596216 GGCTCCTGCTCAGATGGGACGGG + Intronic
901120221 1:6885774-6885796 GGCAGCAGGTGAGATGCAGCTGG - Intronic
901588219 1:10316278-10316300 GTCTACTGATGTGATGCAACAGG - Intronic
903688022 1:25146742-25146764 GGCTGCTGGTGGGAGGCAGCCGG - Intergenic
903837654 1:26215974-26215996 GGCTCCTGGGATGATGCCACGGG - Intergenic
904908138 1:33913364-33913386 TTCTGCTGGTGAGATGCCACTGG + Intronic
906191854 1:43904163-43904185 GCCTCCTGGTGAAAGGCAGCAGG + Intronic
912698541 1:111859203-111859225 GGCTCCTGCTGGGAAGCCACTGG + Intronic
916308177 1:163363288-163363310 GGCTCCTGATAAGAGGCAGCAGG - Intergenic
921577957 1:216859308-216859330 GGCTCCAGGTCAAATGCAAAAGG + Intronic
923727197 1:236516853-236516875 GTCTCCTGATGAGTTGCAATTGG + Intergenic
1063906424 10:10784476-10784498 GGCTCTTGGTGAGATGGATGGGG + Intergenic
1064296941 10:14087606-14087628 GGCTCCTGGTGGGATGAGAGTGG + Intronic
1067567533 10:47349635-47349657 GGCTCCTGGTGCGAGCCATCGGG + Exonic
1068580055 10:58729856-58729878 GGGGCCTGGTGGGAGGCAACTGG - Intronic
1072938741 10:99738738-99738760 TCCTCCTGATGTGATGCAACAGG - Intronic
1073353319 10:102835075-102835097 CGCTCCTGTTAAGAGGCAACTGG - Intronic
1075207023 10:120457009-120457031 GGCTCCTGGGGAGAGGGATCCGG + Exonic
1078424450 11:11238000-11238022 GGCACCTGGTGAGAGGTAATTGG + Intergenic
1079370542 11:19848360-19848382 AGCACCTGGGGAGATGCAGCGGG + Intronic
1079423538 11:20317719-20317741 AGCTCCTGCTGAAATGCAGCAGG - Intergenic
1081732422 11:45380902-45380924 GGCTTCTGGGGAGACACAACAGG - Intergenic
1081962690 11:47149985-47150007 GCCTCTTGGGGAGATGCCACGGG - Intronic
1082891780 11:58146857-58146879 GGCTTAGTGTGAGATGCAACTGG + Intronic
1084233587 11:67771059-67771081 GGGGCCTGGTGGGAGGCAACTGG + Intergenic
1084584612 11:70050407-70050429 GGCTCCGGGTGAGAAGCAGCAGG - Intergenic
1088424056 11:109681902-109681924 GTCTCCTGATGTGATTCAACTGG + Intergenic
1088923418 11:114278519-114278541 GGCACCTGGTGTGATAGAACAGG + Intronic
1089573405 11:119424230-119424252 GGCTTCTGGTGACATCCAATCGG - Intronic
1090824849 11:130377479-130377501 GCCTCATGGTGTAATGCAACAGG + Intergenic
1091601051 12:1918011-1918033 GGCTCCTGGGGAGAGGCAGGTGG + Intronic
1091800486 12:3321651-3321673 CGCTGCTGGTGAGAGGCAGCAGG + Intergenic
1092112393 12:5972997-5973019 TGCCCATGGTGAGAGGCAACAGG - Intronic
1094050898 12:26219777-26219799 GGCTAGTGCTGAGAGGCAACAGG - Intronic
1101225195 12:102681364-102681386 CTCTCCTGGGGAAATGCAACAGG - Intergenic
1101789288 12:107912813-107912835 GGCTCATGGGGAAATGCAGCTGG + Intergenic
1102467061 12:113135956-113135978 GGCTCCTGGTGAGTTGGCATTGG + Intronic
1108141876 13:47432069-47432091 GCCTCCTGCTGTGATGCAACAGG + Intergenic
1109165702 13:59031776-59031798 GGCTTCTGGTGAGAGGTCACTGG + Intergenic
1109599446 13:64605467-64605489 GGCCCCTGATGAGATTCTACTGG + Intergenic
1111914374 13:94345711-94345733 GGCTCCTGGACATATGCGACAGG + Intronic
1113593001 13:111513855-111513877 GGCTCATGGTGACCTGCAAGGGG + Intergenic
1113698258 13:112364309-112364331 GCCTCCTTGTGATAAGCAACAGG + Intergenic
1114881194 14:26788346-26788368 GGAGCCTGGTGAGAGGCAATTGG + Intergenic
1116350508 14:43856546-43856568 GTCTCCTTGTGGGAGGCAACAGG + Intergenic
1119346222 14:73926919-73926941 GCCTCCTGATGAGATGTAATAGG - Intronic
1120498563 14:85265431-85265453 GGTTCCTGGTGACAAGCAAGAGG - Intergenic
1122386288 14:101350517-101350539 GGCTCCTTTAGAGATGCAAATGG - Intergenic
1122831163 14:104396681-104396703 GGCTCCAGGTGAGCTGCACCTGG + Intergenic
1122831245 14:104397258-104397280 GACTCCAGGTGAGCTGCACCTGG - Intergenic
1127289658 15:57558881-57558903 GGCACCTGGTGGGAGGCGACTGG + Intergenic
1127565145 15:60180505-60180527 GGATCCTAGTGAGTTGTAACTGG - Intergenic
1132605355 16:791440-791462 GGCTCCTGGAGAAAGTCAACAGG - Intronic
1132754708 16:1477333-1477355 GCCTCCTGATGTGATGCACCAGG + Intergenic
1135021925 16:18970091-18970113 GGGACCTGGTGGGAGGCAACTGG - Intergenic
1135389252 16:22075469-22075491 TGCTCCTGGGGAGATGCAAATGG - Exonic
1135760312 16:25132680-25132702 GGGCCCTGGTGAGATAAAACAGG - Intronic
1141796249 16:86277198-86277220 GGGACCTGGTGAGAGGCAATTGG - Intergenic
1142301728 16:89262559-89262581 GGCTGCCGGTGAGAGGCAAAGGG + Intergenic
1142569350 17:862759-862781 GGCTCCTGGTGAGATGCAACAGG + Intronic
1146777491 17:35634396-35634418 GCCTCCTGATAAGATGCAACAGG - Intronic
1147432235 17:40379209-40379231 TGCTCCTGATGTGATGCAATGGG - Intergenic
1147536202 17:41324585-41324607 GGCTGCTGGGGAGATGCCAAGGG - Intergenic
1148125094 17:45232349-45232371 CGCTCCTGGGGAGATGGAATGGG - Exonic
1148785603 17:50144780-50144802 GGCTCCTGGGGAGATGGATGGGG - Intronic
1149623083 17:58060622-58060644 GGCTCCTGGTGAGGAGGAAAAGG - Intergenic
1151670231 17:75568238-75568260 GGCTCCTGGGGGGATACACCTGG - Intronic
1152099830 17:78294557-78294579 GGTTGCTGGTGGGATGCAGCTGG + Intergenic
1152226177 17:79093952-79093974 AGAGCCTGGTGAGAAGCAACCGG + Intronic
1152320724 17:79607757-79607779 GGCTGCAGGGGAGAGGCAACAGG + Intergenic
1153250413 18:3116196-3116218 GGCTCCTGGTAAGATTCCACTGG - Intronic
1155126159 18:22878209-22878231 GTCTCCTGGTGTGATGTAATAGG + Intronic
1157806086 18:50658604-50658626 GGCTTCTGTTAAGATGCAAGTGG + Intronic
1158422631 18:57309505-57309527 GGCACCTGGAAGGATGCAACTGG + Intergenic
1159517066 18:69471323-69471345 GGCTCCAGGCGAGAAGCCACCGG + Intronic
1160674918 19:384933-384955 GGCGCCTGGTGAGCTGTGACCGG + Intergenic
1160674931 19:384975-384997 GGCGCCTGGTGAGCTGTGACTGG + Intergenic
1160674943 19:385017-385039 GGCGCCTGGTGAGCTGTGACTGG + Intergenic
1167153662 19:47725072-47725094 GGATCGTGGGGAGATACAACAGG + Intronic
1168176216 19:54629779-54629801 GGCCACAGGTGAGATGCCACAGG - Intronic
924977765 2:193547-193569 GGCTCCGGGTGAGACGCAGCTGG - Intergenic
925639390 2:5972675-5972697 GGCTACTGGTTTGATGCCACAGG - Intergenic
925837900 2:7963864-7963886 GGGGCCTGGTGAGAGGCAAGTGG - Intergenic
927269164 2:21187292-21187314 GGGACCTGGTGAGAAGTAACTGG - Intergenic
928231199 2:29500190-29500212 GGGACCTGGTGGGAGGCAACTGG + Intronic
930105781 2:47638275-47638297 GGCTCCTTCTGAGATGCACAGGG + Intergenic
931501805 2:62876820-62876842 GGGACCTGGTGAGATGTGACTGG - Intronic
932001995 2:67893657-67893679 TGCTCCAGGTGATATGCAGCTGG - Intergenic
937928379 2:127185247-127185269 GCCTCCTGGTGTGATGTAGCAGG - Exonic
938059412 2:128240378-128240400 GGCTCCTGGTGGGATGACCCTGG - Intronic
938091361 2:128436946-128436968 GACTCCTGGTCAGAGCCAACGGG - Intergenic
939784790 2:146495566-146495588 GGATCCTGGTGGGAGGCAATTGG - Intergenic
945833706 2:214813714-214813736 GACCCCTGGGGAGATGGAACAGG - Intergenic
946109748 2:217404138-217404160 GGCTTCTGGAGAGACTCAACTGG - Intronic
1168809056 20:691582-691604 GGCTCCTGATGGGATGCACAGGG + Intergenic
1169258534 20:4118310-4118332 GGCTCCTGGAGAGCAGCAATGGG - Intergenic
1171497933 20:25570295-25570317 GGGGCCTGGTGGGAGGCAACTGG + Intronic
1175460924 20:59151341-59151363 CCCTCCTGCTGAGATGCCACAGG + Intergenic
1175907813 20:62390172-62390194 GTCTCCTGGTGAGAGGCAGAGGG + Exonic
1177411761 21:20738787-20738809 GGCACCTGGTGGGAGGCACCTGG + Intergenic
1178923469 21:36755999-36756021 GCCTCCTGGTGGGATGCGATGGG - Intronic
1179269633 21:39840691-39840713 GGCTGCTTGCGAGATGGAACTGG - Intergenic
1182047781 22:27289154-27289176 GGCTCCTGGGGAGCAGCAACTGG + Intergenic
1183226097 22:36550934-36550956 GGTTCCTGGCCAGCTGCAACCGG - Intergenic
1183235863 22:36617028-36617050 GGCTCCTGGAGATGTGTAACTGG + Intronic
1184675310 22:46038606-46038628 GGCTGCTGGGGAGATTCAAAGGG - Intergenic
1185346902 22:50314373-50314395 GGCTCCCGGTGAGGTGCAGGGGG - Intronic
952684945 3:36136458-36136480 GGCTCTAGGTGAGAAGAAACAGG - Intergenic
952765623 3:36951395-36951417 GCCTCCTGATGTGATGCAAAAGG + Intergenic
952907694 3:38153367-38153389 GTCACCTGCTGAGATGCAGCGGG + Intergenic
953253104 3:41264263-41264285 TGGTCCAGGTGAGAGGCAACAGG + Intronic
954568438 3:51620043-51620065 TTCTCCTGATGTGATGCAACTGG - Intronic
961215846 3:125159911-125159933 GACTGCTGTGGAGATGCAACTGG + Intronic
962303149 3:134261240-134261262 GGCACCTGGTGAGAGGCATTTGG - Intergenic
962474657 3:135744647-135744669 CGCTCCTGGTGATATGCAACAGG - Intergenic
964778674 3:160310746-160310768 GCCTCCTGATGTGATGCAACAGG + Intronic
964847499 3:161059705-161059727 GGGGCCTGGTGGGAGGCAACTGG + Intronic
968764295 4:2459969-2459991 GGATCCTGGTGGGAAGCATCGGG + Intronic
971435621 4:26619815-26619837 GGCTCCAGGACAGATGCAAGTGG + Intronic
971482594 4:27127638-27127660 GGGTCCTGATGAGAAGAAACGGG - Intergenic
972820348 4:42694655-42694677 GCCTCCTAATGAGATGCAACAGG - Intergenic
976463755 4:85344078-85344100 GGGTCCTGGTGGGAGGCAATTGG - Intergenic
984213415 4:176878328-176878350 GGGGCCTGGTGGGAGGCAACTGG + Intergenic
984841288 4:184070073-184070095 GGGGCCTGGTGGGAGGCAACTGG + Intergenic
985080711 4:186261412-186261434 TTCTCCTAGTGAGAAGCAACCGG - Intergenic
985674521 5:1224109-1224131 GCCTCCTGGGCAGATGCCACAGG - Exonic
985696114 5:1341322-1341344 AGCTCCTGGTGAGAAGCTGCAGG + Intronic
986284454 5:6349119-6349141 GGAGCCCGGTGAGATGGAACAGG - Intergenic
986851056 5:11814571-11814593 GGCTCCTGGCCAGCTGCAAAGGG + Intronic
987450488 5:18077702-18077724 GGCTCCTGTTGACCTTCAACTGG + Intergenic
991957289 5:72007917-72007939 AGATCCTGGTCAGATGCCACAGG + Intergenic
992624271 5:78622805-78622827 GGCTGCTTGTGAGGTACAACTGG + Intronic
995315674 5:110769514-110769536 GGCTTATGATGTGATGCAACTGG + Intergenic
997445859 5:133939722-133939744 GGGGCCTGGTGAGAGGTAACAGG + Intergenic
998450099 5:142227573-142227595 GCCTCCTGAGGAGATACAACAGG + Intergenic
998489966 5:142538113-142538135 GTCTTCTGATGTGATGCAACAGG + Intergenic
1001410149 5:171505598-171505620 GGCTCCTGGGCAGTGGCAACTGG + Intergenic
1001678793 5:173540681-173540703 GGGTCCTGGTGGGAGGCGACTGG + Intergenic
1002212799 5:177608615-177608637 GGCTCCAGGTGAGATTCCCCGGG + Exonic
1005444240 6:25904714-25904736 GGCTCTGGGTGAGATGCTATAGG - Intergenic
1011484504 6:87828234-87828256 GGCCCCTGGTGAGAGGAGACTGG + Intergenic
1015162143 6:130165436-130165458 GGCTCCAGCTGAGATGTAAATGG + Intronic
1015710096 6:136129950-136129972 GGGACCTGTGGAGATGCAACTGG - Intronic
1019260767 7:80685-80707 GGCTCCCAGTGAAATGCTACAGG + Intergenic
1019789647 7:3002776-3002798 GGGTCCTGGTGGGAGGCGACTGG - Intronic
1020317189 7:6914147-6914169 GGGGCCTGGTGGGAGGCAACTGG + Intergenic
1020432820 7:8130943-8130965 TGATCCTGGTGAGATGCCTCTGG + Intronic
1021990095 7:26132784-26132806 GCCTCCTGATGGGATGCAATGGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1031178458 7:118383360-118383382 GGGACCTGGTGGGAGGCAACTGG + Intergenic
1033122943 7:138682331-138682353 GGGTCCTAATGAGATGCAACAGG + Intronic
1035036697 7:155900146-155900168 GGCTCCTGGGGAGGTGGAACTGG + Intergenic
1037339786 8:17832155-17832177 GAAACCTGGTGAGAGGCAACTGG - Intergenic
1039434181 8:37548338-37548360 GGCTCCTGGGGAGATGGCTCTGG - Intergenic
1039973447 8:42339488-42339510 GGCCCCTGGTGAGATGAACAAGG - Intronic
1047230676 8:122995609-122995631 TGCTCCAGGAGAGATGCAGCTGG - Intergenic
1048824294 8:138408804-138408826 GGGACCTGGTGAGAGGTAACTGG - Intronic
1051841096 9:21399135-21399157 GGCCACTGGTGGGATGCAGCTGG + Intergenic
1052104948 9:24502327-24502349 GGCTCCTGTGGGGCTGCAACTGG + Intergenic
1054914520 9:70483561-70483583 GGGTCCTGGTGGGAGGCAATTGG + Intergenic
1055514338 9:77020867-77020889 GGCTCCAGCAGAGAGGCAACGGG - Exonic
1056164964 9:83932222-83932244 GCCTCCTGGTGTGTTGCAACAGG - Intergenic
1056684091 9:88745416-88745438 GAGTCCTGGTGAGAACCAACTGG + Intergenic
1059421193 9:114193469-114193491 GGCTCCTGCTGAGTTAGAACAGG - Intronic
1061095786 9:128456248-128456270 CGCTCCTGGTGAGAGGCCGCCGG + Intronic
1062416497 9:136453789-136453811 GACGCCTGGTGAGATGCACAGGG - Intronic
1062438217 9:136556536-136556558 GGCTCCTCGTGTCATGCAAAGGG + Intergenic
1188974290 X:36654721-36654743 GACTGCTGGAGAGATGCTACAGG - Intergenic
1193090244 X:77486350-77486372 GGGGCCTGGTGAGAGGTAACTGG - Intergenic