ID: 1142575984

View in Genome Browser
Species Human (GRCh38)
Location 17:908006-908028
Sequence ACCACAGGTGTCTCTAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142575984_1142575992 28 Left 1142575984 17:908006-908028 CCCTCTCTAGAGACACCTGTGGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1142575992 17:908057-908079 CTAAAGGTTCCAAGAAAAAAAGG 0: 1
1: 0
2: 2
3: 32
4: 434
1142575984_1142575988 3 Left 1142575984 17:908006-908028 CCCTCTCTAGAGACACCTGTGGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1142575988 17:908032-908054 TTCAAAGGCATTCCTGCTTTAGG 0: 1
1: 0
2: 0
3: 12
4: 267
1142575984_1142575989 12 Left 1142575984 17:908006-908028 CCCTCTCTAGAGACACCTGTGGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1142575989 17:908041-908063 ATTCCTGCTTTAGGACCTAAAGG 0: 1
1: 0
2: 0
3: 13
4: 113
1142575984_1142575993 29 Left 1142575984 17:908006-908028 CCCTCTCTAGAGACACCTGTGGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1142575993 17:908058-908080 TAAAGGTTCCAAGAAAAAAAGGG 0: 1
1: 0
2: 3
3: 46
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142575984 Original CRISPR ACCACAGGTGTCTCTAGAGA GGG (reversed) Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
902241524 1:15093154-15093176 ACCGCAGGTCTCTGTGGAGATGG + Intronic
903022847 1:20406032-20406054 CCCACAGGTGTCTGCAGGGAGGG + Intergenic
905469911 1:38183947-38183969 ACCACACCTGACTTTAGAGATGG - Intergenic
909181787 1:72433560-72433582 ACCACAGGTCCCTCTGGGGAGGG - Intergenic
909928204 1:81463257-81463279 ACCACAGGTGCATCTAGCAAAGG - Intronic
916126131 1:161572921-161572943 AAGACAGGTGTTTCTAAAGAGGG - Intergenic
916136049 1:161654762-161654784 AAGACAGGTGTTTCTAAAGAGGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
919023092 1:192134334-192134356 GTCACAGGTGTCTCTAAATATGG + Intergenic
919676496 1:200388826-200388848 CCCACAGTTCTCTCAAGAGAAGG + Intergenic
920386057 1:205570523-205570545 AGCACAGGTGTCAGTACAGATGG + Intronic
922584756 1:226725260-226725282 AGCACAGGTGTCTGCAGACAAGG + Intronic
922796898 1:228344696-228344718 ACCTCGGGTGTCTCCAGGGAGGG + Intronic
924158296 1:241204138-241204160 AACACAGGTGTGTATAGAGAAGG + Intronic
924278892 1:242416407-242416429 CCTACAGGTGTCTTAAGAGAAGG + Intronic
1064218178 10:13417765-13417787 ACCACAGGTATCTCTTGGGCAGG + Intergenic
1067267122 10:44756037-44756059 GCCAGAGGTGTCTCGGGAGACGG - Intergenic
1069781837 10:70961783-70961805 TCCACAGGTGGCTCCACAGAGGG + Intergenic
1071228338 10:83557829-83557851 ACCATAGGTGTTTCTAGGTATGG + Intergenic
1076721078 10:132393552-132393574 ACCACAGATTTCTCCAGAGCTGG - Intergenic
1077245179 11:1533473-1533495 ACCACAGCTTCCTCTGGAGAGGG + Intergenic
1077293623 11:1813384-1813406 AACACAGGTGTGTATATAGAGGG - Intergenic
1078270742 11:9792524-9792546 ACCACAGGTGTTCCTAAACAAGG + Intronic
1081618374 11:44603800-44603822 TCCACAGGTAGCTCTAAAGAGGG + Intronic
1084348460 11:68575008-68575030 ACCACAGTTGTCACCAGGGATGG + Intronic
1085031042 11:73271018-73271040 ACTACAGGTGTCTCAAGGGCAGG + Intronic
1086167744 11:83798963-83798985 AACACAGGGGACCCTAGAGATGG - Intronic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1087412896 11:97814503-97814525 AAGCCATGTGTCTCTAGAGAAGG + Intergenic
1088242135 11:107783768-107783790 ACCACATGTGTCTGCATAGAAGG + Intergenic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1097319887 12:58213474-58213496 ATCACAGCTGCCTCTAGAGGTGG - Intergenic
1098082380 12:66801886-66801908 ACCCCATGTGTTTCTCGAGACGG - Intronic
1098787686 12:74780642-74780664 ACCTCTGTTGTCTTTAGAGATGG - Intergenic
1101332531 12:103768670-103768692 ATCTCAGGTGTTTCTACAGAAGG - Intergenic
1101860437 12:108478146-108478168 ACCAGAAGTGTCTCTGGAGCAGG + Intergenic
1103730394 12:123023379-123023401 ACCAGAGCCATCTCTAGAGAAGG + Intronic
1104927906 12:132323082-132323104 ACCACACGGGTCTCAAGACATGG + Intronic
1107368838 13:39718743-39718765 ACCCCAGGAGTCTCTCAAGAAGG - Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1111041781 13:82757958-82757980 TCCAGAGGTGTTTGTAGAGATGG - Intergenic
1112588392 13:100740422-100740444 ACCACAAGGGATTCTAGAGATGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115053455 14:29093060-29093082 AACACAGGTTTCTCTAGCCAAGG + Intergenic
1117026176 14:51622417-51622439 ACTAAAGGTAGCTCTAGAGAAGG + Intronic
1118338048 14:64871451-64871473 ACCACTGGTGGCTTTTGAGAAGG + Intronic
1118894624 14:69935600-69935622 AACACAGGTGTCTCTTTAAAAGG - Intronic
1119124084 14:72108518-72108540 ACAACAGGAGTCTCTAAAGAAGG - Intronic
1119614818 14:76092047-76092069 GCAACAGGTGTCGCTATAGAGGG - Intergenic
1120190479 14:81435944-81435966 ACAACAGGTGTCCCTGGGGACGG - Intronic
1121250107 14:92493131-92493153 CCCCCATTTGTCTCTAGAGAAGG + Intronic
1122351886 14:101100938-101100960 ACCACAGGTGTGTAAAGGGAAGG - Intergenic
1124815683 15:32989653-32989675 ACCAGAGGTGTTTTAAGAGACGG + Intronic
1127702126 15:61511897-61511919 ACCACTGTTGTCTCTAGAGCAGG - Intergenic
1128181548 15:65609893-65609915 TCCAGAGGTGTCTTCAGAGAAGG - Intronic
1133404347 16:5510867-5510889 ACCAGAAGTGTCTCTAGCTATGG + Intergenic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1135580872 16:23625359-23625381 ATCACAGGTTTATCTAGATATGG - Intronic
1135810914 16:25585971-25585993 TTCCCCGGTGTCTCTAGAGATGG + Intergenic
1137496374 16:48972194-48972216 TTCCCAGGTGTCTGTAGAGATGG - Intergenic
1137546832 16:49410604-49410626 ACCACAGGTGCCATTACAGAAGG + Intergenic
1137923638 16:52517965-52517987 AAAACAGGTGCCTCTACAGATGG + Intronic
1140687951 16:77451613-77451635 ACCACCTTTGTCTCTAGAGCAGG - Intergenic
1141231671 16:82172881-82172903 ACAACAGGGGTCCATAGAGAAGG - Intergenic
1142575984 17:908006-908028 ACCACAGGTGTCTCTAGAGAGGG - Intronic
1143502545 17:7347647-7347669 GTCACAAGTGTCACTAGAGAAGG + Intronic
1144540876 17:16141173-16141195 CTCAAAGGTGTCTCTAGAAATGG + Intronic
1144735743 17:17554357-17554379 ACGACAGCTCTCTCTAGAGTAGG - Intronic
1146483682 17:33226030-33226052 ACCACAAGTGCCTCAAAAGATGG - Intronic
1147409118 17:40236474-40236496 ACTACAGGCGTGTGTAGAGATGG + Intronic
1148161866 17:45454738-45454760 ACGAGAGGTGTTTCTAAAGATGG - Intronic
1150530564 17:65977122-65977144 AGCGAAGGTGTCTCTTGAGATGG + Intronic
1150650622 17:67007823-67007845 AACACAGGTGTCCGTTGAGAGGG - Intronic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1151663458 17:75531955-75531977 AAGTCAGGTGTCTCGAGAGAAGG - Intronic
1152079292 17:78176557-78176579 ACTGCAGGGGTCTCTGGAGAAGG + Intronic
1152272684 17:79334205-79334227 GACACAGGAGTCTCGAGAGAGGG - Intronic
1153433633 18:5045647-5045669 TCCACATGTGTCTCTCAAGAGGG - Intergenic
1154276983 18:12970326-12970348 ACCACAGATGAGTCTAGGGAGGG + Intronic
1155387242 18:25291845-25291867 AGTACAGTTGTATCTAGAGAGGG - Intronic
1155713699 18:28913194-28913216 ACATGAGGTGTCTCCAGAGACGG - Intergenic
1156752407 18:40474937-40474959 GCCACAGTTTTCTCGAGAGATGG - Intergenic
1157826209 18:50814624-50814646 AAGACAGCTGTCTCTAGAGAGGG + Intronic
1160129126 18:76208789-76208811 ACCCCGGGTGTCTCTGGAGAGGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161515309 19:4693096-4693118 ACCACAGATGTCCCTAGATGTGG - Intronic
1162032211 19:7922435-7922457 ACCACAGCGGACTCTAGTGATGG - Exonic
1163185337 19:15635288-15635310 ACCACAGCTGTATCTACACAGGG + Intronic
925821433 2:7803172-7803194 CCCACAGGTATTTTTAGAGAAGG - Intergenic
927187465 2:20492122-20492144 ATCACAGGAGTCTCTAGGGAAGG + Intergenic
929252223 2:39771218-39771240 ACCATATATATCTCTAGAGAAGG + Intronic
930398674 2:50855043-50855065 AACCCCGGTGTGTCTAGAGAAGG - Intronic
931288661 2:60853686-60853708 ACCACTGGTGACTTTACAGAAGG - Intergenic
936237964 2:110761415-110761437 ACCTCAGGTATTTCCAGAGAAGG - Intronic
938339469 2:130526095-130526117 AACTCAGGTGTCTTCAGAGATGG + Intronic
938350370 2:130594657-130594679 AACTCAGGTGTCTTCAGAGATGG - Intronic
938842227 2:135174479-135174501 AGCAAAGGTGTCTGTAGAGGAGG - Intronic
939054958 2:137353474-137353496 ACCTAAGGTGTCTCTAAAGCAGG + Intronic
946162557 2:217844807-217844829 ATCTCAGATGTCTCTAGAGGTGG - Intronic
947058760 2:226137754-226137776 ACCACAGGTGTGGGCAGAGAAGG + Intergenic
947503859 2:230692019-230692041 ACCACAGCCGTCCCTAGACAAGG + Intergenic
948133447 2:235618922-235618944 ATCACAGGGGTCTCTATAAAAGG + Intronic
1170118806 20:12890702-12890724 AAAACAGTTGCCTCTAGAGAGGG + Intergenic
1170210156 20:13839780-13839802 ATCACAGGTGTCCTTAGAAAAGG - Intergenic
1170581263 20:17701221-17701243 ACCACAGGTTGCTCTAGCGCCGG - Intronic
1175261972 20:57680373-57680395 ACCACAAGTGTTTCCAGATATGG - Intronic
1175414258 20:58791279-58791301 CTCACAGGGGACTCTAGAGAAGG - Intergenic
1179382241 21:40910594-40910616 ACCACATGTGTCCCTACACACGG - Intergenic
1180606107 22:17060130-17060152 CCCACAGGTATTTCTAGGGAGGG + Intergenic
1181338904 22:22163098-22163120 ACCCCAGGTGTCTGTAGTCAGGG + Intergenic
1182004638 22:26949735-26949757 AACACAGTTGTCTTTAAAGATGG - Intergenic
1182619473 22:31610969-31610991 GCCAGAGCTGTCCCTAGAGAGGG + Intronic
1183240424 22:36653673-36653695 GCCACAGGTGTCTGCAGACATGG + Intronic
1183847325 22:40553078-40553100 TCCACAGATCTCTCTAGAGTAGG - Intronic
1185213299 22:49584212-49584234 AGCACAGGTGCCTCCAGAGCCGG - Intronic
949856842 3:8469764-8469786 AACCCAGGTATCTCTAGATAGGG - Intergenic
951303874 3:21033834-21033856 AGTACAGCTGTCTCTACAGATGG + Intergenic
952406269 3:33008010-33008032 ACCACAGGTGCCTCTTTTGATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
956017953 3:64904276-64904298 ACCACAGGTATCATGAGAGATGG + Intergenic
959765250 3:110019014-110019036 ACCACAGATGTATCTAGAAATGG - Intergenic
961143834 3:124577714-124577736 ACCACACCTGCCTATAGAGATGG - Intronic
963148292 3:142017461-142017483 ACCACAGCTGTCACTAAGGAAGG - Intronic
963417648 3:145018049-145018071 CCTACAAGTGTCTCTAGAGCAGG - Intergenic
966603353 3:181796978-181797000 ACTACAGGTGACTCTATAGTAGG + Intergenic
967552139 3:190809031-190809053 ACAACAGGTGATTCCAGAGAGGG + Intergenic
967976960 3:195040871-195040893 ACCACACGTGACTCCAGGGAGGG - Intergenic
970658707 4:18260641-18260663 ACCACAGGGATCTCTTGGGAGGG - Intergenic
972213108 4:36862351-36862373 AGCACAGGTGTCCCTATAGATGG - Intergenic
978040718 4:104057787-104057809 ACCTCAGCTGTCTCTGGAGGTGG - Intergenic
979600996 4:122586424-122586446 ACCACAGTAGTGTCTAGAGGTGG - Intergenic
983607512 4:169606647-169606669 ACCACAGATATCTCTAGATTGGG + Intronic
983707232 4:170676428-170676450 ATCATCAGTGTCTCTAGAGAAGG + Intergenic
989266381 5:39479478-39479500 GACACAGGGGTTTCTAGAGAGGG - Intergenic
996767093 5:127045479-127045501 ATCACAGGTGTCTCTATAAGAGG - Exonic
997306108 5:132837862-132837884 ACCACAGTTGTCTAAAGATAGGG + Intergenic
997661508 5:135592697-135592719 ACCACAGGTGTGTCCTGAAATGG + Intergenic
999714587 5:154350068-154350090 TCCACACTTGTCTCTAGAGTAGG - Intronic
1001150790 5:169225753-169225775 AGCAGAGGTGACACTAGAGAGGG + Intronic
1002885418 6:1289574-1289596 GCCACCGGTGTCTTTAGAGATGG + Intergenic
1003470098 6:6421481-6421503 ACCACAGGTCCCTTTGGAGAAGG + Intergenic
1005895149 6:30171770-30171792 ACCACAGATGTTCCTAGAGCAGG - Intronic
1015320778 6:131871522-131871544 ACAACGGTTGTTTCTAGAGAGGG - Intronic
1016549068 6:145256447-145256469 ACCACAGGTATCTCTAAACTGGG - Intergenic
1017205099 6:151796395-151796417 ACCTCAGCTGTCTCCAGAGAGGG + Intronic
1026961817 7:74413326-74413348 ACCACATTTGTTTATAGAGATGG - Intergenic
1030050840 7:105535928-105535950 ACCACAGGTTTCAATAGACAAGG - Intronic
1031888063 7:127261328-127261350 ACCACAGGTGGGTCTACAGTTGG + Intergenic
1032287421 7:130551095-130551117 AACACAGGTTTCTCTAGAAATGG + Intronic
1032649349 7:133860461-133860483 ACTACTGGTGACTCCAGAGATGG + Intronic
1032850218 7:135788683-135788705 AACACAGGTGTCTCTAGGGAGGG + Intergenic
1035632545 8:1119757-1119779 ACCACAGCTGCCTCTAGAGTTGG + Intergenic
1036685191 8:10904789-10904811 GCCACAGGAGTGCCTAGAGATGG + Intronic
1037280880 8:17240571-17240593 AACAAAGGTGTTTCTAGAAAAGG + Intronic
1037346296 8:17904965-17904987 ACCACATGTGGCTCTCTAGATGG - Intronic
1037416823 8:18660167-18660189 ATCACAAGTGTCTTTATAGAAGG + Intronic
1039863070 8:41476345-41476367 AAGACAGGTGGCTCTAGGGAGGG - Intergenic
1041479978 8:58309051-58309073 ACCACAGATATATCTAGAAATGG + Intergenic
1043139928 8:76575441-76575463 ATCACCTGTGTTTCTAGAGATGG + Intergenic
1043988905 8:86728292-86728314 ACCACATGTGCCTGTACAGAAGG - Intronic
1048252331 8:132877064-132877086 ACCACAGGTGTCTGTAATGAGGG - Intronic
1048364560 8:133727402-133727424 ACCACAGGTGTCCTTATAGGAGG - Intergenic
1049426474 8:142540171-142540193 GCCAGGGCTGTCTCTAGAGAAGG - Intronic
1050243375 9:3660935-3660957 CACACACGTGTCTCTATAGAGGG + Intergenic
1050305590 9:4302300-4302322 ACAACACTGGTCTCTAGAGAGGG - Intronic
1051437692 9:17050590-17050612 AGCACAGTTGTCTCTGGAGAAGG - Intergenic
1052326842 9:27224507-27224529 ACCACATGTATCTCAATAGATGG + Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1057939287 9:99266770-99266792 ACCACAGGTGCCTCCAGCGGGGG + Intergenic
1059456890 9:114405567-114405589 ATCACTGCTGTCTCTAGAGCTGG - Intronic
1187022520 X:15399042-15399064 ACCACAGAAGGCTGTAGAGAGGG + Intronic
1191252813 X:58267484-58267506 ACCAAAAGTGCCCCTAGAGAGGG - Intergenic
1191640296 X:63424301-63424323 AGCTCAGGTGGCTCTAGGGAGGG + Intergenic
1194461318 X:94172806-94172828 ATCACAGGTGACTCTAGGCAGGG - Intergenic
1195412256 X:104580275-104580297 AACACAGATGTCTATATAGAAGG - Intronic
1198445337 X:136708165-136708187 ACCTCATGTGTCTCCAGGGAGGG + Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic