ID: 1142576539

View in Genome Browser
Species Human (GRCh38)
Location 17:912466-912488
Sequence AGTGTTGGCAAGGATGTAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 5, 2: 9, 3: 47, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142576539 Original CRISPR AGTGTTGGCAAGGATGTAGA CGG (reversed) Intronic
900381675 1:2387288-2387310 AGGGTTGGAAAGGAGGTAGGGGG - Intronic
900754500 1:4424362-4424384 AGTGATGCCAGGGATGCAGAGGG - Intergenic
901438338 1:9263002-9263024 GGTGTTGGCAAGGAGGGACAAGG - Intronic
901818530 1:11810036-11810058 AACGTGGGTAAGGATGTAGAAGG + Intronic
904974247 1:34443556-34443578 AGTATTGGCCATGATGAAGATGG - Intergenic
907099783 1:51819666-51819688 TGGGTTGGAAAGGAAGTAGATGG - Intronic
907901655 1:58746968-58746990 AGTGTTTACAAGGATGTGGGTGG - Intergenic
910650211 1:89558543-89558565 AGTGGTAGCAAGATTGTAGAAGG + Intronic
911924948 1:103817703-103817725 AGTGTTGGCAAGGACTGTGATGG - Intergenic
915159437 1:153907003-153907025 AGTGTTGGCAGGGACGTGGAGGG + Intronic
916645060 1:166776592-166776614 AGTGTTAGAGAGGATGTAGGAGG + Intergenic
917733245 1:177897447-177897469 AGGGCTGGCAAGGAAGTAGCAGG + Intergenic
917756702 1:178108055-178108077 ATTGCTGGTAAGGATGTAAAAGG - Intronic
918606360 1:186431759-186431781 AGTAATGGCAAAGATGTGGAAGG + Intergenic
920760566 1:208780128-208780150 AGGTTTGGGAAGGATGGAGAAGG - Intergenic
921412477 1:214850526-214850548 AGTGTTGGGAGGGATGGAGGAGG - Intergenic
921579686 1:216881590-216881612 AGGGTAGGCAAGGATGGTGATGG - Intronic
1062946178 10:1464042-1464064 AATGCTGACAAGGATGTGGAGGG + Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063913033 10:10851951-10851973 AGTGTTGGCAAGTATGGGGAGGG + Intergenic
1064913507 10:20429775-20429797 AGAGTTGGTGAGGATGTTGATGG + Intergenic
1075580126 10:123611291-123611313 AGTGATGGCGATGATGTTGATGG - Intergenic
1075581687 10:123623580-123623602 GATGATGGCAAGGATGAAGAAGG + Intergenic
1076987997 11:253243-253265 AGTGGTGACAAGGATGTGGATGG - Intergenic
1079199500 11:18363770-18363792 TGTGTTGGAAAGGATGCTGAGGG + Intronic
1080175209 11:29355064-29355086 CATTTTGGCAAAGATGTAGATGG + Intergenic
1080325489 11:31067446-31067468 AGAGTTGGCAAGAATGTGAAGGG + Intronic
1080771856 11:35349140-35349162 ACTGGAGGCAGGGATGTAGATGG + Intronic
1080853162 11:36088954-36088976 AGTGTGGGGAAGGATGAAGCAGG - Intronic
1081712573 11:45226801-45226823 ACTGTTGGCTTGGGTGTAGATGG + Intronic
1084470170 11:69354842-69354864 AGAGTTGGCAAGTCTGTAGAGGG + Intronic
1087576136 11:99992070-99992092 ATGGTTGGCAAAGATGTTGAAGG + Intronic
1087685382 11:101256971-101256993 ATTGTAAGCAAGGATGTATAAGG + Intergenic
1088079029 11:105887525-105887547 AGTGTTGGAAAGCATGTTAAAGG + Exonic
1088644537 11:111906888-111906910 ACTGTTGGCAAGGCTGAAGGTGG + Intergenic
1088978334 11:114835839-114835861 AGTGTTGTCAAGGGTGTGGAGGG + Intergenic
1089457474 11:118633996-118634018 AGTGATGGCAATGGTGTGGAGGG + Intronic
1090068175 11:123521185-123521207 AGTGTTGGAAAGGAGCTAGTGGG - Intergenic
1090982917 11:131739146-131739168 AGTGTGAGGAAGGATTTAGAGGG - Intronic
1091679599 12:2517406-2517428 AGTATTGGCATTGCTGTAGAAGG - Intronic
1093443368 12:19226534-19226556 AGTGTTGACAGGAATGTAAATGG - Intronic
1093606278 12:21093164-21093186 AGTCTTGGCAAGGATTTATTAGG - Intronic
1094620168 12:32073226-32073248 ATTTTGGGCAAGGATGGAGAGGG + Intergenic
1094644495 12:32308828-32308850 ACAGTTTGCAAAGATGTAGAGGG + Intronic
1095377105 12:41543083-41543105 AGTGTTGGCTACCATGAAGAGGG - Intronic
1095381579 12:41600891-41600913 AGTGTTGGCAAAGACATGGAGGG - Intergenic
1095396417 12:41767332-41767354 AGTTAAGACAAGGATGTAGAGGG + Intergenic
1096448525 12:51717089-51717111 AGTGTTGGTCAGGAAGCAGAAGG - Intronic
1096893447 12:54795570-54795592 AATGTTGCCAAAGATGCAGAAGG + Intergenic
1097152234 12:56987501-56987523 ACTGGTGGGCAGGATGTAGAGGG + Intergenic
1097989120 12:65816258-65816280 AAAGCTGGCAAGGATGTGGATGG + Intergenic
1098995454 12:77114323-77114345 ATTGGTTGCAAGGATGTACAAGG - Intergenic
1099436473 12:82652096-82652118 AATGTTTGCAAAGATCTAGAGGG + Intergenic
1100046142 12:90383263-90383285 AGTGGTGGCAGGCATGGAGAGGG - Intergenic
1101922587 12:108944850-108944872 AGTGTCGGCAAGGGTATGGAAGG - Intronic
1102415708 12:112760852-112760874 TGTGTTGAGAAGGATGCAGAGGG - Intronic
1102597660 12:114005306-114005328 AGAGTTGGCCAGGAGGTAGTGGG + Intergenic
1102638901 12:114348927-114348949 AGTGGTGGTGAGGATGTTGATGG + Intergenic
1102748382 12:115270617-115270639 ACTGTTGACAAGCATGTAAATGG + Intergenic
1103329277 12:120142662-120142684 GGTGTTGGCAGGGCTGTACATGG - Exonic
1103464843 12:121133709-121133731 AGTGTTGGAAATGATGGTGAAGG - Intronic
1103742055 12:123097558-123097580 AGTGATGGCATGGATGGGGAGGG + Intronic
1103883819 12:124186308-124186330 AGAGTTGGGGAGGAGGTAGAAGG + Intronic
1104897277 12:132170588-132170610 AGTGTCTGCCAGGATGGAGAGGG - Intergenic
1106090494 13:26588695-26588717 GGTGTTGGCCAGGATGGGGAGGG - Intronic
1106404007 13:29457783-29457805 AATGTTGGCAAGAATGTAGAGGG - Intronic
1106633125 13:31498049-31498071 AGTGTTGGACAGGAGGCAGAGGG + Intergenic
1106744758 13:32689372-32689394 AGTGAGGACAAGGTTGTAGAGGG + Intronic
1107157250 13:37183407-37183429 AGTGCTGAGAAGGATGTCGATGG - Intergenic
1107179270 13:37439453-37439475 CATGTTGGCGAGGATGTGGATGG - Intergenic
1107608837 13:42092091-42092113 AGTTTTGGCAAGGATGTAAGGGG + Intronic
1110357274 13:74581878-74581900 AGTATTGGCAAGGATGAAACAGG + Intergenic
1112679461 13:101745893-101745915 AGTGCTCGCAAGATTGTAGATGG + Intronic
1114730451 14:24987411-24987433 ACTGTTGTGAAGGATGAAGAAGG + Intronic
1115019516 14:28659358-28659380 AGTATTGGCAAGGATGAAAAGGG + Intergenic
1115032508 14:28814002-28814024 AGTGTTGGCAGAGCTGCAGAGGG + Intergenic
1115727330 14:36231654-36231676 AGCTTTGGGAAGGATGTACATGG + Intergenic
1116005009 14:39283335-39283357 ACTACTGGCAGGGATGTAGATGG - Intronic
1116144894 14:41052587-41052609 AGTCTTGGCAAGCATGCTGAAGG - Intergenic
1116240827 14:42340397-42340419 AGTGTTGCCAAAGGTGTGGAAGG + Intergenic
1117259211 14:54013171-54013193 AGTTTTGGCAATTATGTATAAGG + Intergenic
1117613473 14:57508013-57508035 AGTGTATGCAAGGATGTTCATGG - Intergenic
1117695578 14:58358995-58359017 AGTGTTGGCAAGAATATGAAGGG - Intronic
1118451738 14:65909049-65909071 AGTGCTGGTAAGGGTGTGGAAGG - Intergenic
1118986350 14:70759069-70759091 AGTGTTTGCTAGGGAGTAGAAGG + Intronic
1119150975 14:72358921-72358943 AGTCTTGGGAAGGATGCAGTGGG + Intronic
1119769751 14:77213125-77213147 CGTGTTGGCAAAGACCTAGAGGG - Intronic
1121729943 14:96179503-96179525 AGTGCTGGCAAGGCTCTGGATGG - Intergenic
1124343754 15:28907540-28907562 GCTGTTGGCCAGGATGTGGAAGG + Intronic
1124906569 15:33874040-33874062 AGTATTGGGAAGGATGGGGAGGG - Intronic
1127795892 15:62438045-62438067 AGTGTTAGAGAGGATGTAGTGGG + Intronic
1127963499 15:63907376-63907398 AGTGGTGGCAGTGAGGTAGAGGG + Exonic
1129707783 15:77804620-77804642 AGTGTGTGCAAGGATGTGCAGGG + Intronic
1130286489 15:82559516-82559538 GGTGTTGGCCAGGTTGTAGAGGG - Intronic
1132176955 15:99723597-99723619 AGTGTTGGTCAGGAGGCAGAAGG - Intronic
1132327286 15:100982243-100982265 AGTGTGGTCAAGCAGGTAGATGG - Intronic
1133517196 16:6520923-6520945 AGTGTTGGAAAGAGTGTAGGGGG + Intronic
1133872318 16:9700975-9700997 AGGGTTGGTCAGGATGCAGAGGG + Intergenic
1134179035 16:12032822-12032844 GGAGTTGGCAAGGATGTGGAAGG - Intronic
1134895855 16:17886277-17886299 AGGGGTGGGTAGGATGTAGAGGG - Intergenic
1135160765 16:20094045-20094067 AGTGTTGGGAAGAAAGTAGTTGG + Intergenic
1135305781 16:21366560-21366582 GGAGTTGGCAAGGATGTGGAAGG - Intergenic
1135605916 16:23824595-23824617 AGAGTTGACAAGTATGTAAATGG + Intergenic
1136100822 16:27994367-27994389 AGGGTTGGAAAGGAATTAGAGGG - Intronic
1136302525 16:29345714-29345736 GGAGTTGGCAAGGATGTGGAAGG - Intergenic
1136643003 16:31583340-31583362 ATTGTTGGCAGGGACGTGGATGG - Intergenic
1137227457 16:46528063-46528085 AGACTTGGCAAATATGTAGAGGG - Intergenic
1137933530 16:52611191-52611213 AGTGGTGGCAGGGAGGAAGAAGG + Intergenic
1138544625 16:57708741-57708763 AGTATTGGCAAGGATGTGGATGG - Intronic
1138618325 16:58190411-58190433 ATGGTTGCCAAGAATGTAGAAGG + Intronic
1138732857 16:59215169-59215191 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1138862332 16:60773683-60773705 TGAGATGGCAAGGATGAAGAAGG + Intergenic
1139874098 16:70131346-70131368 AGTGTTCGCAGGCATGTAGCGGG - Exonic
1140361677 16:74349793-74349815 AGTGTTCGCAGGCATGTAGCGGG + Intergenic
1140519345 16:75567934-75567956 AGTGTGGGCAAGGAGGTGGGTGG - Intronic
1140856697 16:78984237-78984259 AGTCTTGGCAAACATGTACAGGG - Intronic
1141070260 16:80948210-80948232 TGCACTGGCAAGGATGTAGAGGG - Intergenic
1141405686 16:83790906-83790928 AGTATTAGCAAGAATGTAAAAGG + Intronic
1141415517 16:83869404-83869426 ACTGTTGGTGAGAATGTAGATGG + Intergenic
1141415715 16:83871528-83871550 AGTGTTAGCAAGGATGCAGAGGG - Intergenic
1142576539 17:912466-912488 AGTGTTGGCAAGGATGTAGACGG - Intronic
1143299001 17:5895327-5895349 TGTGGTGGCAAGGAAGAAGATGG - Intronic
1143631638 17:8143456-8143478 AGGGCGGGCAAGGATGGAGAAGG + Exonic
1144610716 17:16711748-16711770 ACTGTTGGCAATGATGATGATGG + Exonic
1144902030 17:18603649-18603671 ACTGTTGGCAATGATGATGATGG - Intergenic
1144929037 17:18842297-18842319 ACTGTTGGCAATGATGATGATGG + Intronic
1145130472 17:20342427-20342449 ACTGTTGGCAATGATGATGATGG + Intergenic
1145974606 17:28976928-28976950 AGTGCTGGCAGGGATGGGGATGG - Intronic
1147512526 17:41083722-41083744 AATGTTGGAAAGGAATTAGAAGG - Intergenic
1147513987 17:41098551-41098573 AATGTTGGGAAGGAATTAGAAGG + Intronic
1147514691 17:41104904-41104926 AATGTTGGAAAGGAATTAGAAGG - Intronic
1147516089 17:41118781-41118803 AATGTTGGGAAGGAATTAGAAGG + Intergenic
1147985449 17:44304666-44304688 ACTGTTGGCAGGAATGTAAAAGG + Intergenic
1148185364 17:45639473-45639495 AGTGTGGGAAAGGCTGTAGTGGG - Intergenic
1149968046 17:61187585-61187607 AATGTTGGCAACCATGTATAGGG + Intronic
1150530249 17:65973605-65973627 AGTTTTGGGAAAGATGTGGAGGG + Intronic
1152384563 17:79963718-79963740 AGTGTCGGTGAGGATGTGGAGGG - Intronic
1155076270 18:22358442-22358464 AGATTTGGAAAGGATCTAGAAGG - Intergenic
1155339862 18:24802997-24803019 AGCCTTGGGAGGGATGTAGAGGG - Intergenic
1155563624 18:27108399-27108421 AGTGTGGGCAAGTATTTAAATGG + Intronic
1158779654 18:60632103-60632125 AGTGTAGCCAAGTATATAGAAGG + Intergenic
1159772709 18:72566169-72566191 GGTGTTGGCCAGGATATGGAGGG + Intronic
1160315011 18:77835117-77835139 AGTGTTGGCACGGAAGCTGAAGG + Intergenic
1160363170 18:78301700-78301722 AGTGTTTGCAAGGGGGCAGAAGG - Intergenic
1160599838 18:80004186-80004208 AGGGTTGGCAGGTAAGTAGAGGG + Intronic
1162226007 19:9223466-9223488 AGTGTAGACAGGTATGTAGATGG - Intergenic
1165205888 19:34185433-34185455 AGTGTGGGTAAGGGTGAAGAAGG + Intronic
1165615650 19:37197866-37197888 AATGTTAACAGGGATGTAGAAGG + Intronic
1165638441 19:37363627-37363649 AGTGTGGGCAAGGCTTTAGCCGG + Exonic
1165870436 19:38968585-38968607 AGAGTTTGCATGGAGGTAGAAGG - Intronic
1166117889 19:40667097-40667119 AGTGTTGGACAGGATGGAGGGGG - Exonic
1166598164 19:44069839-44069861 AATGTTGGTGAGGATGTGGAAGG - Intergenic
925202677 2:1981617-1981639 AGTGTTGGAAGGGATGTACCGGG + Intronic
925591654 2:5515934-5515956 ATTTTTCTCAAGGATGTAGAAGG + Intergenic
926348285 2:11969805-11969827 GATGTTGGCAAGGATGTGGGAGG - Intergenic
928069871 2:28203940-28203962 AGTATTGGCAAGGATGTAGGAGG - Intronic
928729650 2:34216402-34216424 AGTGTTGGCAATGAGGGATAGGG - Intergenic
930042581 2:47139333-47139355 AGTGTTATCAGGGATGAAGAGGG - Intronic
930158554 2:48129754-48129776 AGTGTTGGCAAGCATGTGTTGGG + Intergenic
932278586 2:70470373-70470395 AGTCTTAGCAAGGATGTATAAGG + Intronic
932749011 2:74359188-74359210 AGTGGAGGGAAGGAGGTAGATGG + Intronic
933283259 2:80356013-80356035 AGAGTTGCCAAGGATAAAGAGGG - Intronic
933763207 2:85688913-85688935 AATGTTGGCAATGTTGTAAATGG + Intronic
934926418 2:98384777-98384799 GGTGTGGGCAAGGATGTGGGTGG + Intronic
936065238 2:109326483-109326505 AGTGTCGGCAAGGGCGCAGAAGG - Intronic
937389421 2:121470811-121470833 AATGTTGGCAATGGTGTGGAAGG - Intronic
937478626 2:122237202-122237224 AGTGGATGCAAGGATGTAAAAGG - Intergenic
937892961 2:126953797-126953819 AGAGTTGGCAAGGAAATAAAAGG + Intergenic
938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG + Intronic
938809622 2:134841097-134841119 AATGATGGAAATGATGTAGATGG - Intronic
938932630 2:136100107-136100129 AGAGGTGGCCAGGAAGTAGAGGG + Intergenic
939827329 2:147030460-147030482 GGTGTTGGCAAGGAAGTATATGG - Intergenic
941046185 2:160678190-160678212 AGTGTTGGCAAGCATGTAATGGG - Intergenic
942327796 2:174790368-174790390 AATGCTGGCAAGGATAGAGAGGG - Intergenic
943944911 2:194046403-194046425 AATCTTGGTAAGGATTTAGAGGG - Intergenic
944546586 2:200804983-200805005 AGGGATGGCAAAGATGAAGAGGG - Intergenic
945112382 2:206372891-206372913 AGTGTTGGTGAGGATGTGGAGGG - Intergenic
945448272 2:209964096-209964118 ACTGTTTGAAAGGATCTAGAGGG - Intronic
947125209 2:226861584-226861606 ACTGTTGGCAATGATATTGAAGG + Intronic
947849263 2:233271906-233271928 ATTCTTGGCCAGGATGTAGAAGG - Intronic
948639263 2:239364066-239364088 TGTGTTGGTAAGGATGTGGTTGG + Intronic
948766056 2:240219693-240219715 GGTGTTGGCAGGAATGGAGACGG - Intergenic
948942811 2:241204508-241204530 TGTGGTGGGCAGGATGTAGAGGG + Intronic
1169848154 20:10018618-10018640 GGTGTTGGTGAGGATGTGGATGG - Intronic
1171324890 20:24282653-24282675 AGGGGTGACAAGGATGTAGTTGG + Intergenic
1171724093 20:28599543-28599565 ACTCTTGGCAAGGATGTAACTGG + Intergenic
1172044601 20:32071473-32071495 AGAGGTGGCAAGGATGGAGTGGG + Intronic
1173313282 20:41919873-41919895 AGTGTTGATAGGGATGTACAAGG - Intergenic
1174280608 20:49436178-49436200 AGTGCTGGCAAGGATGTAGAGGG + Intronic
1174773149 20:53320072-53320094 AGTGTTGGCAGTGATGATGATGG - Intronic
1174827650 20:53783242-53783264 AGAGTAGGCAAGAATGTAGAGGG + Intergenic
1174871098 20:54183128-54183150 AGTGTTGGGGAGGATGTAGAGGG - Intergenic
1175032373 20:55968725-55968747 CGTGTTGGTAAGGATGTGGAGGG - Intergenic
1175380970 20:58563989-58564011 AGTGTTGACGAGGATGTGGAAGG + Intergenic
1175596640 20:60239838-60239860 AGTCGTGGCAAGGATGCAGGTGG - Intergenic
1177057636 21:16327887-16327909 AGTGTTAGCTTGGAAGTAGATGG + Intergenic
1177273646 21:18878333-18878355 TGTGTTTACAAGGATGTTGAAGG + Intergenic
1178153461 21:29823586-29823608 AGTGGAGGAAAGAATGTAGAAGG + Intronic
1178586064 21:33872153-33872175 AGTGTTGGCAAAGATCTGGGTGG + Intronic
1178814717 21:35918365-35918387 AGTGTTCACAGGGATGAAGAAGG + Intronic
1180297645 22:10958219-10958241 ACTCTTGGCAAGGATGTAACTGG + Intergenic
1180860884 22:19081588-19081610 AGAGTTGGAGAGGATGTGGATGG + Intronic
1181898320 22:26130722-26130744 AGTGTTGGCGAGGATGTGGAGGG - Intergenic
951184722 3:19699960-19699982 AATCCTGGCAAGGATCTAGATGG - Intergenic
953488231 3:43323456-43323478 AGTGCTGGCAAGGGTGTGAATGG + Intronic
954767629 3:52934186-52934208 AGTGTTGGCAAGGAAGTAGAGGG + Intronic
956006679 3:64787034-64787056 AGTGTTGGCAAGGATGCAACTGG + Intergenic
956754799 3:72373867-72373889 AGTCTTGGAAAGGATCTGGAAGG - Exonic
957887638 3:86309745-86309767 AGTGTTAGTAAGGATGTGGAGGG - Intergenic
958155845 3:89754875-89754897 CATGTTGGCAAGGATGTGGTGGG + Intergenic
958421353 3:93935175-93935197 GATGTTGGCAAGGATAAAGAAGG + Intronic
960631631 3:119737955-119737977 AGAGTTGGTTAGGATTTAGAGGG + Intronic
960699221 3:120424647-120424669 AGTGGTGGCATGGTTATAGAAGG + Intronic
961331083 3:126138678-126138700 ACTGCTGGCAGGGATGTAAATGG + Intronic
963621992 3:147622066-147622088 AGTGTTGGAAAGGATGTTAAAGG + Intergenic
963822974 3:149919882-149919904 AGCGTTGGCACGGAAGTGGAGGG - Intronic
964751382 3:160057140-160057162 AGTATAGGGAAGGATGTACATGG + Intergenic
966216012 3:177503421-177503443 AGCTTTGGCAAGGATGTACATGG + Intergenic
966869067 3:184278264-184278286 AGAGTCGGCACTGATGTAGACGG - Exonic
967378433 3:188831181-188831203 GGAGTTGGCAAAGATGGAGAAGG + Intronic
967659885 3:192093228-192093250 AGCTTTGGGAAGGATGTACATGG - Intergenic
968896400 4:3406345-3406367 AGTCCTGGAAAGGCTGTAGAAGG - Intronic
969153442 4:5189799-5189821 AGTGCTGACGAGGATGTGGAGGG - Intronic
970058395 4:12001151-12001173 AGAGTTTGGAAGGATGTGGAGGG - Intergenic
970682820 4:18530792-18530814 AGTATTGGCAAGGATGCATTAGG - Intergenic
971224778 4:24741352-24741374 AGTGTTGGGAAGCATGAAAACGG + Intergenic
971589522 4:28449606-28449628 AGTTTTGTCAAGGATGTTGTAGG - Intergenic
975981632 4:80167470-80167492 AGTGTTGGCAAAGATATGGTAGG - Intergenic
976679405 4:87738618-87738640 CCTGTTTGCAAGGATGTAGGAGG + Intergenic
976999824 4:91483214-91483236 TGTGTTGGCAAAGATGCTGATGG + Intronic
977081973 4:92541730-92541752 AGTGTTTGCATCCATGTAGAGGG + Intronic
978524690 4:109653430-109653452 ATTGCTGGCAAGAATGTAAATGG - Intronic
980341614 4:131556202-131556224 ATTCTTTGCAGGGATGTAGATGG + Intergenic
981054789 4:140349734-140349756 GGTGGTGGCAGGGATGGAGAAGG - Intronic
981150639 4:141376496-141376518 ATTGGTGGCAAGTATGGAGAAGG - Intergenic
981476276 4:145190408-145190430 AGTGTTGGAGAGGATGTGAAGGG - Intergenic
981579458 4:146237334-146237356 AGTGCTGGGAGAGATGTAGAAGG + Intergenic
982155842 4:152520093-152520115 AGAATTGGCAAGGAAGGAGAGGG - Intronic
982620901 4:157703631-157703653 AGTGTTTGCAATGTTCTAGACGG - Intergenic
983787422 4:171751241-171751263 TTTGTTAGCAAGAATGTAGATGG - Intergenic
983940894 4:173533091-173533113 AGTGGTGGCAATGAAGGAGAGGG + Intergenic
984265538 4:177494868-177494890 AGTATTGGCAAATATGAAGAGGG + Intergenic
985272844 4:188210443-188210465 AGTGTTGCCCAGTATGTGGAGGG - Intergenic
985437415 4:189944086-189944108 ACTCTTGGCAAGGATGTAACTGG - Intronic
985570952 5:644625-644647 AGTCCTGGCATGGATGTAGGAGG + Intronic
985716842 5:1467649-1467671 AGTGTTTCCAAGGAGGTAGAGGG - Intronic
986131165 5:4932470-4932492 AGTGTTGGCAAAGCTGTACAAGG - Intergenic
986286940 5:6366074-6366096 CGTGTTGGCACAGATGCAGATGG - Intergenic
986755772 5:10834689-10834711 AGGGATGGCAAAGATGTGGAAGG - Intergenic
987075710 5:14380124-14380146 AGTGATGTCAAGGATGTAACTGG - Intronic
987396956 5:17433195-17433217 GGTGTTTGCAAGCATGTAGGTGG - Intergenic
987516086 5:18910949-18910971 TGTGTTGGCAAAGATGCATAAGG + Intergenic
988678390 5:33458064-33458086 GATGTTGGCAAGGAGGTAGGAGG + Intronic
991219993 5:64202611-64202633 AGTATTGGCAAAGATGTAACTGG - Intronic
992081526 5:73238078-73238100 AGTGTTGGCAGGGATATGAAGGG + Intergenic
992245103 5:74812808-74812830 AATGTTGGTGAGGATGTGGAGGG + Intronic
992678740 5:79131934-79131956 AGTGTTGACTAGGATGGAGAGGG - Exonic
993482125 5:88437145-88437167 AGTGTGTAGAAGGATGTAGAAGG - Intergenic
994293577 5:98061529-98061551 AGTGTTGGTAAAGATGTGGAAGG + Intergenic
995016083 5:107310594-107310616 AGTGTTGGTGAGGATGTAAATGG + Intergenic
996585053 5:125078091-125078113 AGTGTTGGCGAGGCTGTTGGTGG + Intergenic
996799110 5:127382951-127382973 AGTGTTGCCAAGGATGTGAAAGG + Intronic
997359315 5:133284528-133284550 GATAATGGCAAGGATGTAGAGGG - Intronic
999397065 5:151236292-151236314 AGTGTTGGTGAGAATGTAAATGG + Intronic
999873772 5:155779785-155779807 AGTGTTGGCAAGGATGCAGGAGG - Intergenic
1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG + Intergenic
1002685586 5:181006937-181006959 AGTGTTGGTGAGGATGTGGAGGG + Intergenic
1002994256 6:2268205-2268227 GTTTATGGCAAGGATGTAGAGGG + Intergenic
1003829401 6:9990446-9990468 AGTGTCGGCAAGGATGAAGAGGG + Intronic
1005400481 6:25427696-25427718 AGTGTTGGGGAGGATGTGGAGGG - Intronic
1005842226 6:29751107-29751129 ACTGTTGGCAGGAATGAAGAAGG + Intergenic
1006098069 6:31668617-31668639 ACGGTTGGTAAGGATGTAGCGGG - Exonic
1006420312 6:33929651-33929673 AGTGTTGGTGAGGATGTGGAAGG + Intergenic
1006464625 6:34185196-34185218 CGTGTTGTCAAGGATGTGGTAGG + Intergenic
1007222440 6:40289684-40289706 AGAGTTGGCAATGATGGAGCTGG - Intergenic
1007250277 6:40490561-40490583 AGTGTCGGCAGGGCTGAAGAGGG - Intronic
1007286024 6:40748094-40748116 AGTGATGGCAACAATCTAGAGGG - Intergenic
1008142085 6:47843706-47843728 AGAAAAGGCAAGGATGTAGAGGG - Intergenic
1008822936 6:55655697-55655719 AGTGTTGGTAAGTATGAAGGTGG - Intergenic
1009702396 6:67201267-67201289 AGTGTTGGCTGTGATGAAGATGG - Intergenic
1009906022 6:69870561-69870583 AGTGTTTGGAAGGAGGTAGCAGG + Intronic
1010075661 6:71794203-71794225 AGGACTGGCCAGGATGTAGATGG - Intergenic
1012150111 6:95739301-95739323 AGTGTTGGCTAGAATTTGGAGGG + Intergenic
1012218766 6:96622214-96622236 AGTATTGTTACGGATGTAGAGGG + Intergenic
1012260339 6:97081142-97081164 AGGGTTGGTGAGGAGGTAGAAGG + Intronic
1012351276 6:98253895-98253917 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1013913104 6:115302012-115302034 AGTTTTGGCAAGGACGTGAAGGG - Intergenic
1014102611 6:117528467-117528489 AGTGTTGGCAATGTTTTAAAAGG - Intronic
1016704086 6:147086788-147086810 AGTGTTAGTGAGGATATAGAGGG + Intergenic
1018110855 6:160535678-160535700 AGTGGTGGCGATGATGTTGATGG + Intronic
1018336353 6:162794108-162794130 AGTGTTGGTGAGGATATGGAGGG - Intronic
1018362746 6:163087889-163087911 AGTGTTGGTGAGGATGGAGAGGG + Intronic
1018557462 6:165063980-165064002 AGTCTTTGCAAGAATGCAGAAGG + Intergenic
1019037917 6:169077247-169077269 AATGCTGGCAAGGAAGAAGATGG + Intergenic
1019108551 6:169690555-169690577 AGTGCTGGGAAGGAGGTGGATGG - Intronic
1019694349 7:2436808-2436830 GGTGTTTGCAGGGATGTGGAGGG + Intergenic
1021018461 7:15565439-15565461 AGTGTTAGCAAGAGTGTGGAGGG - Intergenic
1021138733 7:16996818-16996840 AATGCTGGCAAGGCTGCAGAGGG - Intergenic
1021168420 7:17369083-17369105 AGTGTTTGCTAGAATGTAGCTGG + Intergenic
1021340985 7:19462339-19462361 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1024192408 7:47026138-47026160 AGTCATGGTAAGAATGTAGATGG - Intergenic
1024642131 7:51338663-51338685 AGTGTTGGAGAGGTTGTGGAGGG + Intergenic
1026437221 7:70410034-70410056 CCTGTTGGCTGGGATGTAGAGGG + Intronic
1028422171 7:90645651-90645673 AGTGTTATCAAGTATGTAGTAGG - Intronic
1028572079 7:92301331-92301353 AGTGATGGCAAAAATGTGGAAGG - Intronic
1030257188 7:107523469-107523491 TGTGTTGGCATGGTTGTAGGGGG + Intronic
1030986008 7:116243440-116243462 CCTGTTGGCAAAAATGTAGAGGG - Intronic
1034323368 7:150206019-150206041 AGAGTTGGAAAGGAAGTAAATGG + Intergenic
1034389332 7:150772049-150772071 AGTGTTGGTGAAGATGTGGAGGG + Intergenic
1036028981 8:4944751-4944773 ACTGTTGGCGAGGATGTAAAGGG + Intronic
1036659782 8:10700453-10700475 AGCGAAGGCAAGGAAGTAGAAGG + Exonic
1036959550 8:13228940-13228962 AGTGTTGGTAAGGATGTGGAGGG + Intronic
1036988791 8:13568156-13568178 AGTTTGGGCCAGGATGTTGATGG + Exonic
1038583085 8:28766892-28766914 AGGTTTGGCAAGGTTGGAGATGG + Intergenic
1038966583 8:32579852-32579874 AGTGTTGGCAGGGCTGCAGGAGG + Intronic
1039138979 8:34361272-34361294 AGAGTTTCCAGGGATGTAGATGG + Intergenic
1039294182 8:36131431-36131453 AGTCTTGGCAAGGAAATAGAAGG - Intergenic
1039584075 8:38690979-38691001 AGGGTGGGGATGGATGTAGAGGG + Intergenic
1040846921 8:51853192-51853214 ATTTTTGGCAAGGGTGTAGGAGG + Intronic
1042023392 8:64396136-64396158 AATGTTGTCAAGGATGTTGATGG + Intergenic
1043694288 8:83201049-83201071 ATTGTTTGCAAGGCTGTGGATGG - Intergenic
1044052855 8:87530614-87530636 TGTGATGGCAAGGATATAAAAGG + Intronic
1046377193 8:113399186-113399208 AGTATTGGCAAGAATGTGGAGGG + Intronic
1046528597 8:115414448-115414470 AGTTTTGGCAAGGATTTGGTAGG + Exonic
1046952496 8:120031722-120031744 AATGTTGGCAATGATGGAAATGG - Intronic
1048856691 8:138692745-138692767 AGTGTAGGCAAGGAGGAAGCTGG - Intronic
1049333273 8:142067103-142067125 AGCGCTGGCAAGGATGTGGGGGG + Intergenic
1050151515 9:2622633-2622655 AGTGTTGGGAAGGAGGCAGAGGG + Intronic
1050803179 9:9641224-9641246 AGTGTTGGCAAGGAAATATCAGG + Intronic
1051608418 9:18938931-18938953 GGGGTTGGCAAGGATGGAGGAGG - Intronic
1052278898 9:26710163-26710185 AGTGTTGGTAAGGATGGTGAAGG - Intergenic
1053150983 9:35742642-35742664 AGAGTTGGCATGTATGTGGAGGG + Intronic
1053192649 9:36086005-36086027 TGTATTGGCAAAGATGGAGACGG - Intronic
1053290990 9:36879562-36879584 AGTGCTGGGAGGGAGGTAGAAGG + Intronic
1053725509 9:40995525-40995547 ACTCTTGGCAAGGATGTAACTGG - Intergenic
1055065234 9:72111990-72112012 AATGTTGGAAAGGGTGTAGCAGG - Intergenic
1058144362 9:101395272-101395294 AATGCTGGCAAGGATGTAAAGGG + Intronic
1058574044 9:106381041-106381063 GCTGCTGGCAAGGATGGAGAAGG - Intergenic
1059934553 9:119296390-119296412 CGTGTTAGCAAGAATGTGGATGG + Intronic
1060490928 9:124083541-124083563 AGTGATGGGATGGATGGAGAGGG - Intergenic
1061532672 9:131227325-131227347 AGTGTTGGCAACGTTGCAGAAGG + Intronic
1203449300 Un_GL000219v1:96447-96469 ACTCTTGGCAAGGATGTAACTGG + Intergenic
1186932820 X:14413489-14413511 AGTATTGGCAAGGATGTGAATGG - Intergenic
1188263809 X:28045562-28045584 AATGCTGGCGAGGATGTGGAGGG - Intergenic
1188458245 X:30391994-30392016 AGTGATGGGAAGTATGTATAGGG - Intergenic
1189013813 X:37074940-37074962 AGTTTTGGCAAGGATGTTTAGGG + Intergenic
1193119120 X:77805268-77805290 TGTGTTCACATGGATGTAGAAGG - Intergenic
1194073526 X:89359003-89359025 AGTGTTGGCAACCATGTTGAAGG + Intergenic
1194609196 X:96019779-96019801 ACTATTGGCAAGGATGTAATTGG + Intergenic
1197358263 X:125464705-125464727 AGTGTTTGCAAGCATGTCAATGG + Intergenic
1198257704 X:134939146-134939168 AGAGTTGGAAAGGATCTTGAAGG - Intergenic
1198507398 X:137314170-137314192 AGGGTTGCCAAGGATATAGCAGG - Intergenic
1199105220 X:143858423-143858445 GGTGTTGGCAAGGTTGCAGAGGG + Intergenic
1200268372 X:154658874-154658896 AGAGTTGGGAAGGATGTAGCAGG + Intergenic