ID: 1142576544

View in Genome Browser
Species Human (GRCh38)
Location 17:912549-912571
Sequence CTTTAATTGCAAACAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142576542_1142576544 20 Left 1142576542 17:912506-912528 CCTTTTGCCAGTTTAATAATCAC 0: 1
1: 0
2: 1
3: 8
4: 227
Right 1142576544 17:912549-912571 CTTTAATTGCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 152
1142576543_1142576544 13 Left 1142576543 17:912513-912535 CCAGTTTAATAATCACATATTTC 0: 1
1: 0
2: 1
3: 42
4: 320
Right 1142576544 17:912549-912571 CTTTAATTGCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142576544 Original CRISPR CTTTAATTGCAAACAGAACC AGG Intronic
902282584 1:15385049-15385071 CCTTAAATGCAAACTGAGCCTGG - Intronic
908092299 1:60698982-60699004 CTTGATTTGCAAAAGGAACCAGG + Intergenic
908281561 1:62542608-62542630 CATTAATTCAAAAAAGAACCAGG + Exonic
909822626 1:80085553-80085575 CTAAAAATGAAAACAGAACCAGG + Intergenic
909945709 1:81660686-81660708 ATTTAAAAGAAAACAGAACCTGG + Intronic
910053353 1:83002866-83002888 ATTTAATTTCAAAGAGATCCTGG + Intergenic
911498638 1:98660248-98660270 TTCTAATTGCAATCTGAACCAGG - Intergenic
915897991 1:159826298-159826320 CTATCCTTGCAAACAGAACATGG - Intergenic
919726348 1:200887322-200887344 ATCTGATTGCAAACAGAACTGGG + Intergenic
922204353 1:223433548-223433570 CTTTAGTTGCAAACGGGACTAGG + Intergenic
1063887634 10:10595679-10595701 TTTTAATTGCAAACAGATTAAGG - Intergenic
1064963501 10:20992408-20992430 CTTTAATTCCAAAGAGAACATGG + Intronic
1066192168 10:33066137-33066159 CTTTATTTGCAAAAACAATCTGG - Intergenic
1069282802 10:66676698-66676720 CTTTAATTTCAAATAGATCCTGG - Intronic
1069700794 10:70423876-70423898 GTTTAATTAAAAACAGAACAGGG - Exonic
1073866729 10:107813151-107813173 TCTTAATTACAAGCAGAACCAGG - Intergenic
1074683364 10:115933725-115933747 CTTTTGCTGCAAACAGAAACAGG + Intronic
1076660022 10:132049610-132049632 CTGTACATCCAAACAGAACCGGG - Intergenic
1078172882 11:8942809-8942831 ATTTAATTGCCAGCAAAACCTGG + Intergenic
1078475651 11:11627202-11627224 CTTTCCTTGGAAAAAGAACCAGG + Intergenic
1079598305 11:22281042-22281064 TTTTAAGTGAAAACAGAACAAGG - Exonic
1080249559 11:30217931-30217953 TTTTAAAAGCAAAAAGAACCAGG - Intergenic
1080586527 11:33687905-33687927 CTTTCATTGCAAAAATAAACAGG - Intergenic
1081005815 11:37737382-37737404 CTTTAATTGCAAATAAAGTCAGG - Intergenic
1083115291 11:60453504-60453526 ATCTAATTGCAAATAGAACTTGG - Intronic
1085331254 11:75653241-75653263 CTTTCCTTGCAGACAGAGCCTGG - Intronic
1091339264 11:134797763-134797785 ATTTAAGTGTAAACTGAACCAGG + Intergenic
1093168494 12:15832985-15833007 GTTTAATTGAAATCAGAACAGGG - Intronic
1093520019 12:20038570-20038592 TTTGAGTTGCAAACAGAACCAGG - Intergenic
1093851123 12:24039750-24039772 CTTTAAATGAAAAAAGTACCAGG + Intergenic
1094616896 12:32044038-32044060 CTTTTATTTCTAACAGAACAAGG - Intergenic
1095891520 12:47239114-47239136 CTTTAATTTCATACATATCCTGG + Intergenic
1097629316 12:62040369-62040391 CCTTATTTGGAAACAGAATCTGG + Intronic
1099285715 12:80712088-80712110 TTTTAATTGCAAACACACCAAGG - Intergenic
1101700143 12:107165925-107165947 CTTTAACATTAAACAGAACCTGG + Intergenic
1104232215 12:126896608-126896630 CTCTAATTGCAAGCAGATCCTGG + Intergenic
1108995048 13:56720052-56720074 CTTAAAATGCAAACATAACTTGG - Intergenic
1109696214 13:65962407-65962429 CTTAAATTGCCAACAGAGGCCGG - Intergenic
1109773953 13:67015180-67015202 CTTTAATTGCTATTTGAACCTGG + Intronic
1111766135 13:92532027-92532049 CTTTAATTGGAAGTAGACCCAGG - Intronic
1113477705 13:110596759-110596781 CTTTAAATCCAAACTCAACCTGG + Intergenic
1114947016 14:27695473-27695495 GTTTAATACCAAACAGATCCTGG - Intergenic
1116822860 14:49642504-49642526 CTTTAATTTCAAGAATAACCTGG - Intergenic
1124849243 15:33319986-33320008 CTTTATTTGCAAATAGAGGCGGG + Intronic
1138048451 16:53750841-53750863 ATTGAATTGCACACAGAACATGG + Intronic
1138596674 16:58032870-58032892 CTCAGATTGCAGACAGAACCTGG + Intronic
1138855357 16:60684753-60684775 CATCAATTGCAAAAAGAATCTGG - Intergenic
1142576544 17:912549-912571 CTTTAATTGCAAACAGAACCAGG + Intronic
1149347060 17:55749884-55749906 CTATAAAGCCAAACAGAACCAGG + Intergenic
1149411223 17:56409318-56409340 CTGTAAGTGCAAACAGTCCCAGG - Intronic
1150931673 17:69591537-69591559 CTTTATTTACAAACATAACTGGG - Intergenic
1151081120 17:71329958-71329980 CTTCTACTGAAAACAGAACCTGG - Intergenic
1155655009 18:28182089-28182111 TTTTAATTGCAGACAGCAACTGG - Intergenic
1157192126 18:45590446-45590468 GTTTATTTTCAAACAGAACAGGG + Intronic
1157811061 18:50696324-50696346 CTTGAATTGCATACAGGACAGGG + Intronic
1158194945 18:54874309-54874331 TTTGAATTGAAAACACAACCAGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159393426 18:67825986-67826008 ATATAATTGAAAACAGAAACTGG + Intergenic
1159404497 18:67982599-67982621 CTTTCATTTCAAACACTACCAGG + Intergenic
1159837414 18:73355333-73355355 CTTTAATTGGAAACCTAAGCAGG + Intergenic
1160003404 18:75049156-75049178 ATATAATTGCACACAGAACTAGG + Intronic
1164165220 19:22667696-22667718 CTCTACTTGCAAACAGATACAGG + Intergenic
1165284309 19:34827211-34827233 CTTTAATTACAAAGAGAATGAGG - Intergenic
1166270235 19:41709057-41709079 CTTTAAATAAAAACATAACCAGG + Intronic
929559510 2:42946994-42947016 CTTGAATTGCAAGCACAAACTGG - Intergenic
931155092 2:59619128-59619150 CCTTAAGTGAAAACAGAAACTGG - Intergenic
935515272 2:104028687-104028709 CATAGATTGCAAACATAACCTGG - Intergenic
937191300 2:120102069-120102091 TTTTCCTTGCAAACAGAACTTGG - Intronic
939491193 2:142879094-142879116 CTTTATTTGCAAACTAAACATGG + Intronic
941021840 2:160415595-160415617 CTTTAACAGCAAACTGTACCCGG + Intronic
941281677 2:163559427-163559449 TTTTAGTTGCAAACTGATCCAGG - Intergenic
942041658 2:172071049-172071071 CTGTAATTGGAAACACAATCAGG + Exonic
944619161 2:201495719-201495741 CTCAACTTGGAAACAGAACCTGG - Intronic
945706267 2:213236763-213236785 CTTTATTTGAAAAAAGAACAGGG - Intergenic
947352004 2:229256033-229256055 CTTGTGTTGGAAACAGAACCAGG - Intronic
947429403 2:230012520-230012542 CTTTAATTGTCAAGAGACCCAGG + Exonic
948357193 2:237387963-237387985 CTTTCACTGCACCCAGAACCTGG + Exonic
948743167 2:240062009-240062031 CTTTAATTGACAACAGAAGCTGG - Intergenic
1170878030 20:20268671-20268693 TTTCAACTGCAAACAAAACCTGG + Intronic
1175136300 20:56826866-56826888 CTTTAATTCAAACCAGAACCGGG - Intergenic
1177434414 21:21032906-21032928 ATTTAATTGCTAACAGCACATGG + Intronic
1179382701 21:40914251-40914273 CCTTTATTTAAAACAGAACCCGG - Intergenic
1179892930 21:44346133-44346155 CTTTATTTGCAAACAGATGGCGG - Intergenic
1180038367 21:45262807-45262829 CATGAATTGCACTCAGAACCGGG - Intergenic
1180767691 22:18355919-18355941 CTTGATTTTCAAACAGGACCCGG - Intergenic
1180778617 22:18506471-18506493 CTTGATTTTCAAACAGGACCCGG + Intergenic
1180811342 22:18763779-18763801 CTTGATTTTCAAACAGGACCCGG + Intergenic
1181161903 22:20964666-20964688 ATATAATTGAAAACAGACCCTGG + Intergenic
1181188712 22:21123594-21123616 CTTGATTTTCAAACAGGACCCGG - Intergenic
1181197494 22:21198033-21198055 CTTGATTTTCAAACAGGACCCGG + Intergenic
1181210487 22:21286899-21286921 CTTGATTTTCAAACAGGACCCGG + Intergenic
1183773689 22:39948460-39948482 CTTCCATTACAAAGAGAACCTGG + Intronic
1183775256 22:39959906-39959928 GTTTGATTTCAAACAGCACCTGG + Intronic
1203229306 22_KI270731v1_random:96802-96824 CTTGATTTTCAAACAGGACCCGG - Intergenic
955176822 3:56623990-56624012 CTTTCATTTTACACAGAACCTGG + Intronic
955542686 3:59994658-59994680 TTTTACTTGCAAATAGAAACAGG - Intronic
956886373 3:73564330-73564352 CTTTTATTGAAACCAGCACCTGG + Intronic
957508646 3:81158065-81158087 CTTTAGTTGCATTCAAAACCTGG - Intergenic
959033920 3:101337366-101337388 CTCTCATGGCAAACAGACCCAGG + Intronic
959367540 3:105481318-105481340 CACTGATTGCAAGCAGAACCAGG + Intronic
961211929 3:125132070-125132092 CCTTATCTGTAAACAGAACCAGG - Intronic
964785949 3:160396732-160396754 GTTTAATTACAAAGAGAAGCTGG - Intronic
967668702 3:192206088-192206110 CTTTAGCAGCAGACAGAACCAGG + Intronic
968143165 3:196275235-196275257 TTTTAAGTACAAACTGAACCTGG + Intronic
971527303 4:27636781-27636803 TTTTAATTGCAGACAGAAAATGG - Intergenic
979284324 4:118904448-118904470 CTTTAATTGGAAACAGCATATGG + Intronic
979786379 4:124719949-124719971 CTTTAACTGCATTCACAACCTGG - Intergenic
982081837 4:151797870-151797892 CTGTAATAGCAAACAGCACTAGG + Intergenic
983695722 4:170527677-170527699 CTCTAATTAAAAACAGAAACTGG + Intergenic
983966893 4:173823573-173823595 CTTGAATGGCCCACAGAACCAGG - Intergenic
984095067 4:175424590-175424612 CTTTGATTACAAATAGAACTGGG - Intergenic
984355109 4:178647927-178647949 CTATAATTGGAAACACAACAAGG - Intergenic
984480731 4:180297835-180297857 CTCAAAGTGAAAACAGAACCAGG - Intergenic
985999998 5:3622926-3622948 CTTTATTTGCAATCAGGACCCGG + Intergenic
986647202 5:9929168-9929190 ATTTAAAAGAAAACAGAACCTGG - Intergenic
987739639 5:21889915-21889937 CTTTTATTGCTTACAGAATCAGG + Intronic
988974178 5:36499015-36499037 CTTTAATTGCTTACTTAACCAGG + Intergenic
993110864 5:83655999-83656021 CATTAATTTCAAACTGATCCAGG - Intronic
994593111 5:101796919-101796941 CTTTAATTACAAAAATAAGCAGG - Intergenic
994743924 5:103655459-103655481 CTTTATTTTCAAAGAGAACAAGG + Intergenic
999620864 5:153471865-153471887 TATTAATAGCAAACAGAAACAGG + Intergenic
999670365 5:153954302-153954324 CTGTGTTTGCAAACAGAACCAGG + Intergenic
1000537645 5:162499152-162499174 CTTTAATTAAAAAGAAAACCTGG + Intergenic
1000786724 5:165554032-165554054 CTTTAATAACAACCAGAACAAGG + Intergenic
1001404412 5:171465800-171465822 CTTTAACTGCAAAGAGAAAGAGG + Intergenic
1003666979 6:8120635-8120657 CTGTAGTGGCAAACAGAGCCAGG + Intergenic
1007708613 6:43806780-43806802 CTTTAATGGCTAACAGCACAGGG + Intergenic
1008381160 6:50841158-50841180 CTTTAATTGCTTACAGACCCTGG + Intronic
1009809156 6:68638723-68638745 CATTAAATCCAAACATAACCAGG - Exonic
1010641519 6:78334046-78334068 CTTTCATTGCAAACTGAAAGGGG - Intergenic
1011780295 6:90781384-90781406 CTCTAGTTGCAAACAGAATTGGG + Intergenic
1012193833 6:96315181-96315203 CATTAAATGAAAACAAAACCAGG - Intergenic
1013806741 6:114004742-114004764 CCTTCATTGCTAACAGAACCTGG + Intronic
1014986726 6:128020520-128020542 TTTTAATTACATACAGTACCTGG - Intronic
1015061343 6:128969960-128969982 CTATAATAGAAAACAGAATCTGG + Intronic
1015164601 6:130189524-130189546 CTTGAGTTGCTAACAGAAACGGG - Intronic
1015227386 6:130873181-130873203 CTTTTTTTGCAAAAAGAAACAGG + Intronic
1016694399 6:146975861-146975883 CTGTAATTTCAATCAGAACCTGG + Intergenic
1017750778 6:157488584-157488606 CTTTCATTGCAAAGTGTACCTGG + Intronic
1020579307 7:9974412-9974434 CTTTAATTGTCAACAGAATCAGG + Intergenic
1020591214 7:10139701-10139723 CTTGAACATCAAACAGAACCAGG + Intergenic
1027484569 7:78744933-78744955 CTATTATTACAAACAGGACCTGG - Intronic
1027788936 7:82615072-82615094 TTTTAATTGGAAAAATAACCAGG - Intergenic
1030407085 7:109128682-109128704 CTTAAAGTTAAAACAGAACCTGG + Intergenic
1030789913 7:113711484-113711506 CTTTGATTGCAAAAAGTATCTGG - Intergenic
1032192217 7:129771719-129771741 CTTAAGATGCAAACAGATCCAGG + Intergenic
1032735796 7:134691759-134691781 CTGCAATTGCAACCAGAAACGGG - Intergenic
1034860420 7:154590456-154590478 CTTCAAATGCAAACATAACACGG - Intronic
1035588947 8:798563-798585 CTTTCAGTGCCAACAGAAGCAGG - Intergenic
1035588980 8:798731-798753 CTTTCAGTGCCAACAGAAGCAGG - Intergenic
1038409688 8:27348586-27348608 CTCTAGCTGCAAAGAGAACCAGG - Intronic
1039673958 8:39638502-39638524 CTTTTATTGCATACAGTGCCAGG - Exonic
1040721183 8:50325495-50325517 CTTTAATTTCAAACTGCACTAGG + Intronic
1041822329 8:62051256-62051278 TTTAAATTCCAAATAGAACCTGG - Intergenic
1041857599 8:62476354-62476376 CTTTAACAGCAAACAAAACATGG - Intronic
1042117875 8:65452007-65452029 CTCTCATTGCCATCAGAACCAGG - Intergenic
1043122739 8:76349352-76349374 CTGTAATTTCATACAAAACCTGG + Intergenic
1045901046 8:107280373-107280395 CTTTAACTACAAACAGTGCCTGG + Intronic
1048855145 8:138680603-138680625 CCTTAATTTCAATCAGCACCTGG + Intronic
1060435908 9:123592889-123592911 ATTTAATTGCCAAAATAACCTGG - Intronic
1060798345 9:126527525-126527547 CTTTCATGGCAAACAGAGCAGGG - Intergenic
1193205618 X:78744454-78744476 CTTTAAGTGAACACAGTACCTGG - Intergenic
1194858509 X:98964289-98964311 TTTTAATTGCCAACAGAGGCCGG - Intergenic
1197332409 X:125170122-125170144 CTTAAAATGCAAACAGCACTGGG + Intergenic
1198376407 X:136044436-136044458 CTTTATTTGCATTTAGAACCAGG + Exonic
1199103279 X:143831957-143831979 CTTTAATGTCAAGCAGAACCTGG - Intergenic