ID: 1142578184

View in Genome Browser
Species Human (GRCh38)
Location 17:923132-923154
Sequence TTGCCTTAGGGACCACCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142578181_1142578184 -2 Left 1142578181 17:923111-923133 CCACGAGTTCAGGACTTCTCTTT 0: 1
1: 0
2: 1
3: 6
4: 160
Right 1142578184 17:923132-923154 TTGCCTTAGGGACCACCACCTGG 0: 1
1: 0
2: 0
3: 4
4: 104
1142578178_1142578184 26 Left 1142578178 17:923083-923105 CCTGTTTTACTTTCCTTGACAGC 0: 1
1: 0
2: 0
3: 22
4: 279
Right 1142578184 17:923132-923154 TTGCCTTAGGGACCACCACCTGG 0: 1
1: 0
2: 0
3: 4
4: 104
1142578179_1142578184 13 Left 1142578179 17:923096-923118 CCTTGACAGCATTATCCACGAGT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1142578184 17:923132-923154 TTGCCTTAGGGACCACCACCTGG 0: 1
1: 0
2: 0
3: 4
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142578184 Original CRISPR TTGCCTTAGGGACCACCACC TGG Intronic
900347553 1:2216841-2216863 CTGGCTCTGGGACCACCACCGGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904671890 1:32172215-32172237 TTGGATTCTGGACCACCACCTGG + Exonic
905866393 1:41379386-41379408 TTGCCTGAGTGACCTCCAGCTGG + Intronic
907756117 1:57312572-57312594 ATGCCATAGGGAACATCACCAGG + Intronic
910232158 1:84997676-84997698 TTGCCGCAGGGCCCACCGCCCGG - Intergenic
912693028 1:111818833-111818855 ATGCCTCAGGGACCAGCCCCAGG - Intronic
914459702 1:147872100-147872122 TTACCTTCAGGACCCCCACCAGG + Intergenic
915497992 1:156294794-156294816 TGTCCTTAGGGAGCACCATCAGG + Exonic
915902407 1:159856129-159856151 GTGCCTGAGGGAACAGCACCAGG + Intronic
919143463 1:193603013-193603035 TTGCCTTCAGGAACCCCACCGGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920258718 1:204674409-204674431 TTGCCATGGAGACCAACACCGGG + Intronic
924930944 1:248731900-248731922 TTGCCTTAGGGCTCACCTTCTGG - Intronic
1063472053 10:6295851-6295873 TTGCCTTGGGGAATTCCACCAGG - Intergenic
1067090532 10:43264019-43264041 TGGCCTCAGGGCTCACCACCTGG - Intronic
1075333671 10:121593769-121593791 TTGCCATGGTGACCACGACCAGG + Exonic
1078399047 11:11008203-11008225 TTCCCGTAGGGGCTACCACCAGG - Intergenic
1080232765 11:30036074-30036096 TTTCCTTTGGGGCTACCACCTGG - Intergenic
1080650042 11:34215028-34215050 GTGCCTGAGTCACCACCACCTGG - Intronic
1084178155 11:67434058-67434080 GTGGGTTTGGGACCACCACCAGG + Intronic
1089261870 11:117229255-117229277 TTGCCTGAGGGACCATTTCCCGG - Intronic
1091550566 12:1531981-1532003 TTGCCTTAGGGGCCAGCCACAGG - Intronic
1093079128 12:14789049-14789071 TTACCTCCAGGACCACCACCAGG - Exonic
1096745368 12:53723604-53723626 TTGCCTTGGGGACAACCAGCAGG + Exonic
1097144348 12:56929755-56929777 TTGCATTAGGCACAACCAGCGGG + Intronic
1106542455 13:30702199-30702221 CTGCCTTAGTGCCCACCACCAGG - Intergenic
1109533148 13:63679838-63679860 TTGCCTTAGTCATCACCACTTGG + Intergenic
1110623715 13:77627938-77627960 TTTCCTTAGAGACCAGAACCTGG + Exonic
1118770881 14:68941959-68941981 CTCCCTGAGGGACAACCACCCGG + Intronic
1121266171 14:92604009-92604031 TTGCCATGGGAACCACCACTTGG - Intronic
1121838235 14:97110790-97110812 TTGGATTAGGGACCACCCTCAGG + Intergenic
1122298345 14:100717972-100717994 TTCCCTGTGGGACGACCACCTGG - Intergenic
1124207530 15:27734480-27734502 TTGCCTTAGGCCCCAGCACTGGG + Intergenic
1125976617 15:43958839-43958861 TAGCCATAGAGACCACCACACGG - Intronic
1129389320 15:75212708-75212730 TGGGCTCAGTGACCACCACCAGG - Intergenic
1131777951 15:95822912-95822934 CTGTCTTAGGGTCCAACACCTGG + Intergenic
1132501613 16:286942-286964 CTGGCTTAGGGACACCCACCGGG - Exonic
1138919003 16:61503889-61503911 TTGCCTTAGGGCCCACAGGCAGG - Intergenic
1142186246 16:88696027-88696049 TTCTCTGAGGGGCCACCACCAGG - Intergenic
1142578184 17:923132-923154 TTGCCTTAGGGACCACCACCTGG + Intronic
1145957394 17:28863988-28864010 TTCCCTCAGGGACCCCCACAAGG + Intergenic
1151199761 17:72459094-72459116 CTGTCTCAGGGACCAGCACCAGG + Intergenic
1151411786 17:73935331-73935353 CTGCCTTAGAGTCCCCCACCTGG - Intergenic
1153915667 18:9742077-9742099 TTGTCTTGGGGAAGACCACCCGG + Intronic
1155873556 18:31056441-31056463 CTGCCTAAGGGACCAACCCCAGG - Intergenic
1158903791 18:61991359-61991381 CTGCCTTCTGGACCACCACGTGG + Intergenic
1160671231 19:364710-364732 GTGCCTGAGGGACAGCCACCAGG - Intronic
1164678494 19:30118817-30118839 CTGCCTCAGTGACCACCACATGG + Intergenic
925109120 2:1318759-1318781 TTGCCTTGGGCGCCATCACCGGG + Intronic
927496978 2:23557620-23557642 CTGCCTTGGGGACCACCTGCTGG - Intronic
931645781 2:64420478-64420500 TTGCCTTAGGGAACCCCATGTGG - Intergenic
935840404 2:107103014-107103036 TTGCTTTAGGGATAGCCACCTGG - Intergenic
938851109 2:135260316-135260338 TTGCCTTGGAGTCCATCACCAGG - Intronic
939522413 2:143247217-143247239 TCCCCTTAAGGACCTCCACCTGG - Intronic
941106897 2:161364459-161364481 CTGGCTAAGGCACCACCACCAGG - Intronic
941570913 2:167169287-167169309 TTGCCTTCAGGAGCACTACCTGG - Intronic
942519718 2:176790838-176790860 TTACCATAGGCACCACCAGCTGG - Intergenic
943342055 2:186693851-186693873 TTCCCCTAGGGCCCTCCACCCGG + Intergenic
946430009 2:219620852-219620874 CAGCCTTCGCGACCACCACCAGG - Intergenic
948065705 2:235077386-235077408 TTGCATTAGGGACACCCAGCTGG - Intergenic
1170591797 20:17777141-17777163 TTGCCTCAGGGACCACTTCTGGG + Intergenic
1172430060 20:34882672-34882694 TTGCCCTAGGACCCACCACCTGG - Intronic
1172436994 20:34936332-34936354 TTTCTCTAGGGGCCACCACCAGG - Intronic
1173233262 20:41219423-41219445 TTACCTTAAGTACCACTACCAGG + Intronic
1178302753 21:31466605-31466627 TTGCCTTGGGCACCACCTCGAGG - Intronic
1179814500 21:43896344-43896366 TTGCCTTATGGCCCAGCACACGG + Intronic
1183786346 22:40031186-40031208 TTTCCTTAGGCACCAAGACCAGG + Exonic
1184046907 22:41977469-41977491 TTCCCTTGGAGACCACCAGCTGG - Intronic
1185297814 22:50062819-50062841 TTGCCCAGGGGAGCACCACCAGG + Intronic
1185344112 22:50304018-50304040 TGGCCTTAGGGGCTACCCCCAGG + Intronic
955072556 3:55584144-55584166 TAGCCTCAGGGACCCCCACAGGG + Intronic
957343259 3:78928655-78928677 TTTCCTTTGGGACCACCCCTGGG - Intronic
967347519 3:188474551-188474573 TGGCCTTAATGACCACCACAGGG + Intronic
969038937 4:4278627-4278649 TTCCCTCATGCACCACCACCTGG + Intronic
970379168 4:15489342-15489364 TTACCTTAGTGCCCACCAGCTGG + Intronic
971475154 4:27065718-27065740 TTCACTTAGGAACCTCCACCTGG - Intergenic
972227182 4:37026691-37026713 ATTCCTGAGGGACCACCCCCAGG + Intergenic
975195542 4:71518928-71518950 TTGCCTTGGACACCAACACCAGG - Intronic
976600066 4:86929953-86929975 TTGCCTGTGGGACAACCACATGG + Intronic
983153876 4:164320294-164320316 TTACCTTGGGAACCATCACCTGG - Intronic
991501588 5:67282635-67282657 TAGCCTCAGGGATCTCCACCTGG + Intergenic
998947208 5:147352593-147352615 TTGCCTTAGGAGCAACCACAGGG - Intronic
999729028 5:154461798-154461820 TAGCCTCAGGGACCTCCACCAGG - Intergenic
1001551062 5:172602675-172602697 TTGCCCGAGGGAACACAACCAGG - Intergenic
1002318010 5:178356843-178356865 TTGCAGTGGGGACCAGCACCAGG - Intronic
1002666659 5:180830527-180830549 TTGCCTAAGCCACCACCATCAGG + Intergenic
1007935436 6:45728223-45728245 ATGGCTTGGGGATCACCACCTGG - Intergenic
1008687603 6:53942934-53942956 TTGCCTCAGCAACCCCCACCAGG + Intronic
1008752393 6:54751451-54751473 TTGACTTAGGTACAACCAGCTGG - Intergenic
1017760307 6:157563114-157563136 CTGCCTTAGTTACCACCTCCAGG - Intronic
1018964691 6:168475444-168475466 TTCCCTCAGGGATCACGACCTGG - Intronic
1040567725 8:48582343-48582365 CTGCCTTAGCCACCACCAGCGGG - Intergenic
1043219571 8:77642692-77642714 TTGCCTTCTGGAACACCTCCTGG - Intergenic
1043749487 8:83917556-83917578 TTTCCTTGGTGACCACTACCAGG + Intergenic
1051364151 9:16309242-16309264 TTTCGTTAGGGACCAGCAGCTGG - Intergenic
1051598714 9:18850683-18850705 TTCCCTTAGGGACCAGGTCCTGG + Intronic
1051599671 9:18860321-18860343 TTGCCTTCAGGACCAACCCCTGG - Intronic
1052385855 9:27823052-27823074 GTGCCTCAGGCACCACCACAAGG + Intergenic
1053753415 9:41278966-41278988 TTGTCTTAGGCCCCACCACTGGG + Intergenic
1054258941 9:62843329-62843351 TTGTCTTAGGCCCCACCACTGGG + Intergenic
1054332841 9:63776711-63776733 TTGTCTTAGGCCCCACCACTGGG - Intergenic
1055582918 9:77727035-77727057 CTCCCTTATGGCCCACCACCTGG - Intronic
1055607260 9:77983746-77983768 TTGCCTTTGGCATCACCAGCAGG + Intronic
1057968552 9:99530064-99530086 CTGCCTTGGGGACAGCCACCGGG - Intergenic
1061963924 9:134002863-134002885 TTCCCTCAGGGACCATCTCCTGG + Intergenic
1202799840 9_KI270719v1_random:165022-165044 TTGTCTTAGGCCCCACCACTGGG - Intergenic
1196988150 X:121297381-121297403 TTGCTTTAGAGAGCCCCACCTGG + Intergenic
1196993344 X:121352656-121352678 TTGCCTTATGGACCAGCATATGG - Intergenic