ID: 1142578813

View in Genome Browser
Species Human (GRCh38)
Location 17:927623-927645
Sequence CAGGAGGAGCAGAAGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2307
Summary {0: 1, 1: 0, 2: 15, 3: 245, 4: 2046}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142578804_1142578813 28 Left 1142578804 17:927572-927594 CCTTGTCTCAAAAAAAAAAAAAA 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502
Right 1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG 0: 1
1: 0
2: 15
3: 245
4: 2046
1142578809_1142578813 -10 Left 1142578809 17:927610-927632 CCAGGATGGTTTGCAGGAGGAGC 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG 0: 1
1: 0
2: 15
3: 245
4: 2046

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142578813 Original CRISPR CAGGAGGAGCAGAAGGAGGC GGG Intronic
Too many off-targets to display for this crispr