ID: 1142579111

View in Genome Browser
Species Human (GRCh38)
Location 17:929980-930002
Sequence CTTTGGAATCAATCAATGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142579108_1142579111 27 Left 1142579108 17:929930-929952 CCTTGGTAACACATCTAACTGGT 0: 1
1: 0
2: 0
3: 15
4: 107
Right 1142579111 17:929980-930002 CTTTGGAATCAATCAATGACGGG 0: 1
1: 0
2: 0
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142579111 Original CRISPR CTTTGGAATCAATCAATGAC GGG Intronic
902136568 1:14311342-14311364 CATTGGGATCATTCAATGAGAGG + Intergenic
908001753 1:59687356-59687378 CTTAGGAATCAAGGGATGACAGG - Intronic
910613855 1:89175468-89175490 CATAGGAATCAATCAGTCACCGG + Intronic
911679745 1:100701711-100701733 CTTTGGAATCAGATAATGAGTGG - Intergenic
914227034 1:145729151-145729173 TTTTGGAGTGAATCAATGGCTGG + Intronic
914375778 1:147072655-147072677 CTTTGGAATCACCCAATGCACGG - Intergenic
916923266 1:169490903-169490925 CTTTAGAATAAATTAATGAGAGG - Intergenic
918373191 1:183881988-183882010 TGTTGGAAACAATGAATGACTGG - Intronic
920174943 1:204094859-204094881 CTTTTCAATGAATGAATGACAGG - Intronic
921315558 1:213887186-213887208 GTTTGGAAACTATCAGTGACAGG + Intergenic
921410435 1:214830693-214830715 ATTTTGAATCAATGAATGAAAGG - Intergenic
921655949 1:217737587-217737609 GCCTGGATTCAATCAATGACGGG - Intronic
922863806 1:228841847-228841869 CTATTGAATAAATGAATGACAGG - Intergenic
923447776 1:234088516-234088538 GTTTTGAATCAATGAATGACTGG + Intronic
924924584 1:248666749-248666771 GTTTCCAATCAGTCAATGACAGG - Intergenic
1064634552 10:17350559-17350581 CTTTGGAATCCCTAAATCACTGG - Intronic
1064797194 10:19025844-19025866 CATTGGAGTCAATCATTGGCGGG + Intergenic
1067482352 10:46611172-46611194 TTTTGAAATAAATGAATGACAGG - Intergenic
1067612397 10:47730492-47730514 TTTTGAAATAAATGAATGACAGG + Intergenic
1071627818 10:87190739-87190761 TTTTGAAATAAATGAATGACAGG + Exonic
1071944161 10:90622616-90622638 CTTTAAAATCAATTAATTACTGG - Intergenic
1072212065 10:93255295-93255317 ATTTGGAATCATACAATGAGTGG - Intergenic
1073614487 10:104979400-104979422 TTGTGGAATCAATCAGTGAAAGG + Intronic
1074623806 10:115155624-115155646 TTATGGAATCAATCAATCAATGG - Intronic
1076124236 10:127961882-127961904 CTGTGGAATGAATGAATGAGTGG + Intronic
1077768316 11:5186595-5186617 CATTGGAAACAATATATGACAGG - Intergenic
1078586259 11:12592242-12592264 GTCCGGAATCAATCAATGTCTGG - Intergenic
1083471465 11:62887059-62887081 CTGTGGAATAAATGAATAACTGG - Intronic
1086020594 11:82224757-82224779 TTTTGAAATAAATCAATGAGAGG - Intergenic
1086123942 11:83330643-83330665 CTTTGGAATCAAACAAATATTGG + Intergenic
1089464974 11:118679169-118679191 TTTTGGTAAAAATCAATGACAGG + Intronic
1090023915 11:123151457-123151479 CTTTGGAATGAATGAATGAGTGG - Intronic
1090456866 11:126857720-126857742 CTTTGGAATCAGGCAAGGAAGGG - Intronic
1092356661 12:7801246-7801268 CTTTGGAGTCAAGCAATTAAGGG - Intergenic
1093212007 12:16319060-16319082 ATTTGGAAGAAATAAATGACAGG - Intergenic
1093292768 12:17348895-17348917 CTTTGGTAGCAATCACTAACTGG - Intergenic
1094205041 12:27830864-27830886 AATTGGAATCAGACAATGACAGG + Intergenic
1094581759 12:31739900-31739922 ATGTGGAATCAATTAATGAATGG + Intergenic
1095812732 12:46387641-46387663 CTTCGGAATAAATCAATGAGAGG - Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1098284835 12:68896346-68896368 CTTTGGTTTCAATAAATGATAGG - Intronic
1098617749 12:72551590-72551612 ATGTGGAATAAATGAATGACTGG - Intronic
1098716054 12:73829556-73829578 CTTTTGAGTCACTCAATGAATGG - Intergenic
1100796469 12:98186907-98186929 TTTTGGAATCAGTCACTGATTGG - Intergenic
1101192381 12:102348392-102348414 GTTTGGAATCAGTCAAGGACAGG - Intergenic
1101730656 12:107424506-107424528 CTTTGGAATCAGCCAAGGATGGG + Intronic
1101816522 12:108150226-108150248 CTTTGGCATCAGTCAAAGGCAGG - Intronic
1102174333 12:110865104-110865126 CTCTGGAATCAATACATCACAGG + Intronic
1102766435 12:115437515-115437537 CTTGGGAAGCAATCACTGGCTGG - Intergenic
1104205153 12:126631850-126631872 AATTGGAATTAATCAATGAACGG + Intergenic
1106567223 13:30896682-30896704 TTATGGAATGAATGAATGACTGG + Intergenic
1108068903 13:46607207-46607229 ATTTGGTATCCATCAATTACAGG - Intronic
1111909293 13:94292513-94292535 GGTTGGAAGCAATGAATGACAGG - Intronic
1112732084 13:102375425-102375447 CTTTGTAGTAAATTAATGACTGG + Intronic
1113274239 13:108710524-108710546 CTTAAGGATCAATAAATGACTGG - Intronic
1122337483 14:101003406-101003428 CTTTTGCATAAATGAATGACTGG - Intergenic
1124884954 15:33676861-33676883 CTGTTGAATCAATCATTGTCAGG + Intronic
1127602425 15:60551703-60551725 CTTTTAAATCATTCAATGCCAGG + Intronic
1129230809 15:74196274-74196296 CTATGGAATGAATGAATGAAGGG - Intronic
1130844599 15:87733178-87733200 CTTTGGAGTGTATCAATGACTGG + Intergenic
1132224224 15:100128083-100128105 CTTTGGACTCAAGCAATGCAAGG + Intronic
1133272930 16:4619466-4619488 CTGTGGAATAAATCAAAGAATGG - Intronic
1134241904 16:12512817-12512839 CCATGGACTCAATCAATGCCTGG + Intronic
1134796240 16:17039646-17039668 CTTTGGCTTCTAGCAATGACCGG - Intergenic
1137832584 16:51558107-51558129 CATTGGAATCAAGTAAGGACGGG + Intergenic
1140181666 16:72726046-72726068 CTTTGGAATCAGACAATGCTGGG + Intergenic
1141343668 16:83226533-83226555 CCATGGAATGAATAAATGACAGG + Intronic
1142579111 17:929980-930002 CTTTGGAATCAATCAATGACGGG + Intronic
1146393124 17:32441259-32441281 CTGTGGATGCAATCAATGACAGG + Intergenic
1147895349 17:43747350-43747372 CTTTGGAAACAATCCATGGAGGG + Intergenic
1148669244 17:49398039-49398061 CCTTGGACACAATCAAAGACTGG + Intronic
1150811844 17:68363029-68363051 CTTGGGAATCACTCAGAGACTGG - Intronic
1152461019 17:80442512-80442534 CTGTGGAATGAATGAATGAATGG - Intergenic
1153814152 18:8778729-8778751 TTTTGGAATCCATTAATAACAGG + Intronic
1154413699 18:14160242-14160264 TTTAGGAATTAATCAATGAGGGG + Intergenic
1155174824 18:23292769-23292791 CATTGGGAAGAATCAATGACAGG + Intronic
1155853366 18:30800534-30800556 ATTTGGAATAAAGCAATGATAGG + Intergenic
1159981973 18:74793286-74793308 GTTTGGCATAAATCAATGTCTGG + Intronic
1168247217 19:55118478-55118500 TTTTGGAATGAATGAATGAATGG + Intergenic
929055962 2:37875976-37875998 CTTTTGAATGAATGAATGATTGG - Intergenic
930306542 2:49681807-49681829 CTTTGGAATTAAGCAATGAGAGG - Intergenic
932429184 2:71663788-71663810 CTTTGGAATTTACCGATGACTGG - Intronic
939207950 2:139132274-139132296 ATATGGAATCAACCAATGAATGG - Intergenic
941603901 2:167571880-167571902 CTATGGAAACAATCAGTGAAAGG + Intergenic
942421480 2:175812768-175812790 TTTTGGAAACAATCAATGGAAGG - Intergenic
943157234 2:184198382-184198404 ATTTGCAATTAAACAATGACAGG + Intergenic
943864758 2:192915642-192915664 CTTTGGAATCTATTAGTGTCAGG + Intergenic
946351360 2:219156314-219156336 CTTTGGCATCAATAGATGACTGG - Intronic
946620040 2:221551754-221551776 ATTTGGAATCAACCACTGAATGG - Intronic
946973012 2:225116575-225116597 ATTTGGAATTAATTAAAGACTGG - Intergenic
947707337 2:232286943-232286965 CTATGAAAACAACCAATGACAGG - Intronic
1169076620 20:2763865-2763887 CTTTGGAATGAAGCAAGCACTGG + Intergenic
1170339167 20:15304169-15304191 TTTTGGAATAAATGCATGACTGG + Intronic
1170916601 20:20632324-20632346 CTTTGGAATCAATTAGGGGCCGG - Intronic
1178819005 21:35958270-35958292 CTTTGAAATCCATCACTGATCGG - Intronic
1180710877 22:17838640-17838662 CTTTGGAGTCAAACAAAGCCTGG - Intronic
1182436434 22:30333505-30333527 CTTTAGAATCAAGCTATCACAGG - Exonic
1182766265 22:32760255-32760277 CTTTAGACTCAATCAAGGAAGGG - Intronic
950321298 3:12056712-12056734 CTTTGGAATCAATCAAATTTGGG - Intronic
951104854 3:18730782-18730804 CTTTGGAATCAGCCATAGACAGG + Intergenic
958076378 3:88685326-88685348 GTTTGAAATCAATCAGTAACTGG - Intergenic
958133398 3:89458160-89458182 CTGTGGAGCCAATCAGTGACAGG + Intronic
958264488 3:91422212-91422234 CTTTGGAATCAAACGAAGAAGGG - Intergenic
962608743 3:137055136-137055158 CTTGGGAACCAATAAATGTCAGG - Intergenic
967834454 3:193949167-193949189 TTGTGGAATTAATCAATGAATGG + Intergenic
969090998 4:4693959-4693981 CTTTAGGAGCAATCAATGCCTGG - Intergenic
970386430 4:15561472-15561494 CTTTGAAAACATTCAATGACTGG - Intronic
970483669 4:16503287-16503309 CTTTGGAAACTAGCAGTGACCGG + Intronic
971703302 4:30007973-30007995 CTTTGGAAGCCATCTCTGACTGG - Intergenic
973261914 4:48173698-48173720 CTATGGAATAAATGAATGAGTGG - Intronic
975452673 4:74547824-74547846 GTTTGGAATCAATCAAACACAGG - Intergenic
975508984 4:75171456-75171478 CTCTGGAATTAATCAAACACAGG + Intergenic
978903015 4:113975508-113975530 CTTTGAAATAAATCAAACACAGG + Intronic
979714019 4:123814961-123814983 CTCTAGAATCAATGAATGTCAGG - Intergenic
979911727 4:126375605-126375627 TTTTGGAAGCAGTCAATGCCAGG + Intergenic
981264046 4:142759697-142759719 ATTTTGAATCAATAAATGAATGG + Intronic
982001795 4:151027486-151027508 CTTTTGTATAATTCAATGACTGG - Intergenic
982543349 4:156703665-156703687 CTTTGGCTACAAACAATGACAGG - Intergenic
984238198 4:177186773-177186795 TTATTGAATCAATCAATGAAGGG + Intergenic
984298586 4:177886024-177886046 CTTCTTAATCAATCAATGTCAGG + Intronic
986646248 5:9919352-9919374 CTTTGGAAGCAAAAAATGATAGG + Intergenic
987367916 5:17166287-17166309 CTTTGGGATCACTGAATCACAGG - Intronic
993984374 5:94580195-94580217 CTCTGGTTTTAATCAATGACTGG - Intronic
994102810 5:95912282-95912304 CTTTGGAATAAATCAAGGGGAGG + Intronic
994522653 5:100860704-100860726 GTTTGGAATCATTCCAGGACAGG + Intronic
996185503 5:120468970-120468992 CCTTAGAATCACTCAGTGACTGG + Intronic
1004358679 6:14951984-14952006 CTTAGGAATTAACCAACGACTGG - Intergenic
1006653629 6:35571409-35571431 CTTTGGAATAAATCTATGGTGGG - Intergenic
1007308338 6:40924557-40924579 CTGTGGAATAAATAAATGAGAGG + Intergenic
1008990954 6:57600770-57600792 CTTTGGAATCAAACGAAGAAGGG + Intronic
1009179476 6:60499011-60499033 CTTTGGAATCAAACGAAGAAGGG + Intergenic
1010053311 6:71533854-71533876 CTTTGGAAGAAATTAATCACAGG + Intergenic
1010095557 6:72039571-72039593 CTTTGGAAGCATTTAATGAAGGG - Intronic
1010624362 6:78118727-78118749 CCTTGGCATCCATGAATGACTGG - Intergenic
1014239665 6:119001371-119001393 CTTTGGAACCAATTAATTCCCGG + Intronic
1016687438 6:146897443-146897465 CTTTGGCATCAATCTGTGAGGGG - Intergenic
1016779983 6:147946397-147946419 CTCTGGAATAAATTAATGAATGG + Intergenic
1017093663 6:150784334-150784356 CATTGGAATCTATAAATCACAGG + Intronic
1022342392 7:29480823-29480845 CTGTGAAATCAAATAATGACAGG + Intronic
1026513723 7:71049230-71049252 TATTGGAATCAATCAGTGTCAGG - Intergenic
1027389303 7:77689634-77689656 CATTTGAATCAATCAATCACTGG - Intergenic
1027578696 7:79964601-79964623 CTTTTGAATAAATAAATGAATGG - Intergenic
1028488284 7:91383842-91383864 CTTTGGAGTCAAGCCATGCCTGG - Intergenic
1033376910 7:140770609-140770631 CCTTGGGATGAATCAATGACTGG + Intronic
1034148496 7:148893796-148893818 CTTTTGAATGAATAAATGAAGGG - Intergenic
1034726112 7:153336907-153336929 CTTTGCCATCAATCAAAGACAGG - Intergenic
1035038752 7:155912193-155912215 CTGTGGAATCCATGAATGATAGG - Intergenic
1037299115 8:17432855-17432877 ATTGGTAATCAATCAATGTCTGG - Intergenic
1041087172 8:54267637-54267659 CTAAGAAATCAATCTATGACAGG - Intergenic
1047651715 8:126930071-126930093 TTTTGGAATCAAGCAATAGCAGG + Intergenic
1051313906 9:15808451-15808473 CTTTTGAATGAATCAATCATTGG + Intronic
1053528783 9:38857024-38857046 CGTTGGACTCACTCACTGACAGG - Intergenic
1054201010 9:62081457-62081479 CGTTGGACTCACTCACTGACAGG - Intergenic
1054637349 9:67506906-67506928 CGTTGGACTCACTCACTGACAGG + Intergenic
1056229613 9:84529332-84529354 CAGTGGAATAAATCAATAACGGG - Intergenic
1056367777 9:85922934-85922956 CTTTGAAATCAACATATGACTGG + Intergenic
1061720084 9:132546093-132546115 CTGTGGAATGAATGAATGAGGGG + Intronic
1188216942 X:27490160-27490182 ATTTGGTATTAATTAATGACTGG + Intergenic
1202097175 Y:21263849-21263871 CTTTGGAAAGAGTCAATGACTGG + Intergenic