ID: 1142580081

View in Genome Browser
Species Human (GRCh38)
Location 17:936539-936561
Sequence GGATTCTGCTGCGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 116}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142580078_1142580081 -3 Left 1142580078 17:936519-936541 CCCAAAAGTGACTGAAAGCAGGA 0: 1
1: 0
2: 1
3: 25
4: 284
Right 1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG 0: 1
1: 0
2: 3
3: 5
4: 116
1142580079_1142580081 -4 Left 1142580079 17:936520-936542 CCAAAAGTGACTGAAAGCAGGAT 0: 1
1: 1
2: 4
3: 51
4: 444
Right 1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG 0: 1
1: 0
2: 3
3: 5
4: 116
1142580075_1142580081 3 Left 1142580075 17:936513-936535 CCGGTCCCCAAAAGTGACTGAAA 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG 0: 1
1: 0
2: 3
3: 5
4: 116
1142580072_1142580081 16 Left 1142580072 17:936500-936522 CCTTCCACACCTTCCGGTCCCCA 0: 1
1: 0
2: 1
3: 18
4: 327
Right 1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG 0: 1
1: 0
2: 3
3: 5
4: 116
1142580076_1142580081 -2 Left 1142580076 17:936518-936540 CCCCAAAAGTGACTGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 312
Right 1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG 0: 1
1: 0
2: 3
3: 5
4: 116
1142580074_1142580081 7 Left 1142580074 17:936509-936531 CCTTCCGGTCCCCAAAAGTGACT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG 0: 1
1: 0
2: 3
3: 5
4: 116
1142580073_1142580081 12 Left 1142580073 17:936504-936526 CCACACCTTCCGGTCCCCAAAAG 0: 1
1: 0
2: 1
3: 7
4: 171
Right 1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG 0: 1
1: 0
2: 3
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142580081 Original CRISPR GGATTCTGCTGCGGAAAAAC TGG Intronic
910402383 1:86850203-86850225 GGATTTTGCTGCAGATGAACTGG - Intergenic
914874466 1:151502403-151502425 GGACTCTGCTTGGGAAAACCTGG - Intergenic
915669801 1:157478929-157478951 TGATTCTGCAGGGGAAAACCTGG + Intergenic
915802055 1:158804188-158804210 GGATTGTGCTGCAACAAAACAGG + Intergenic
919112991 1:193242888-193242910 TCATTGTGCTGCGGTAAAACTGG + Intronic
922770807 1:228182125-228182147 GGGTCCTGCTGAAGAAAAACTGG + Exonic
923950488 1:238946151-238946173 TTATTCTGATGCTGAAAAACAGG + Intergenic
1065088867 10:22209178-22209200 GGTTTCTTCTGCTCAAAAACTGG + Exonic
1065928945 10:30462077-30462099 GGATGCTGAAGCGGGAAAACTGG + Intergenic
1065963485 10:30752895-30752917 GGCTTCTGCTAAGGAAAAAATGG + Intergenic
1066524933 10:36267215-36267237 GAATTCTACTGTGGAGAAACTGG + Intergenic
1072094576 10:92164811-92164833 GGATTGTGCTGCTGAAAAACAGG - Intronic
1074498370 10:113999881-113999903 TGATTCTGCTGTGGAAGAAAAGG - Intergenic
1076095141 10:127727708-127727730 GGATTCTGATTTGGAAAAAAAGG + Intergenic
1078247887 11:9592660-9592682 GGATGCTGCTGCTTAAGAACTGG - Intronic
1079176094 11:18142475-18142497 GGATTCTTCTGCTGGAACACAGG - Intronic
1079267842 11:18952078-18952100 GGCTTCTTCTGCTGAAACACAGG + Intergenic
1080953754 11:37067675-37067697 GGTATCTGCTGCTGAAAAACTGG - Intergenic
1081476346 11:43436039-43436061 GTGTTCTGCTGAAGAAAAACCGG + Intronic
1083826765 11:65208295-65208317 GGATTCTGATGTGGAAGAAATGG - Intronic
1084840364 11:71841256-71841278 AGATTTTGCTGGGGAAAGACAGG - Intergenic
1086964780 11:93016515-93016537 GTATGCTGCTGAGGGAAAACAGG + Intergenic
1087163288 11:94972893-94972915 GGATTCTGATGCCAAAAATCAGG + Intronic
1089785681 11:120905275-120905297 GGGTTCTCCTGCAGCAAAACTGG - Exonic
1090093682 11:123723328-123723350 GGATTCTGCTCCGGAATATGAGG + Intergenic
1094610839 12:31994327-31994349 GGATTCTCCTGCCGAATAGCTGG + Intergenic
1095559193 12:43545373-43545395 GGACTGTGCAGCTGAAAAACAGG - Intronic
1098058762 12:66537882-66537904 TGATTTTGCTTTGGAAAAACTGG + Intronic
1098263668 12:68697116-68697138 GGATTCTGCTGCTTTAAAAAAGG + Intronic
1099578193 12:84406328-84406350 GGCTTCTGCTGCTGGAAAATTGG - Intergenic
1106526508 13:30545524-30545546 GGATTCTTTTGCAGAAAAACAGG - Intronic
1106642036 13:31594632-31594654 TCATTCTGCTGCAGAAACACAGG + Intergenic
1110504644 13:76271469-76271491 GGATTCTGCTGCAGGTAAAGAGG + Intergenic
1110607164 13:77446321-77446343 TGATTCAGCTGTGGAAAAACAGG - Intergenic
1118724401 14:68618598-68618620 GAATTCTGGTGGGGAAAAAGAGG - Intronic
1119738074 14:76996638-76996660 GGATTCTGCTGGGGTCAAAAAGG - Intergenic
1119815782 14:77565734-77565756 GGATCCTGAAGCGGAAAAACTGG + Intronic
1122058613 14:99121864-99121886 GGATTCTAGTGAGGAAAAAAAGG - Intergenic
1125627583 15:41121286-41121308 GCATTCAGCTGGGGATAAACGGG + Intergenic
1128916146 15:71564358-71564380 TGATTCTGCTGAGGAAAGTCAGG + Intronic
1135288486 16:21214300-21214322 GGATTCTGCTCCGGAAAAGCAGG + Exonic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136366500 16:29811562-29811584 GGATGCGGCTGCGGAAAGGCTGG + Intronic
1138248136 16:55482115-55482137 TGCTACTGCTGAGGAAAAACAGG - Intronic
1139169829 16:64616342-64616364 GGATCCAGCTGGGGAAAAAGTGG + Intergenic
1141907940 16:87040115-87040137 GGATGCTGCTCCGGAAAGCCAGG - Intergenic
1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG + Intronic
1151691796 17:75691087-75691109 GGATTCTGCTGCTGGGAAGCTGG + Intronic
1156553590 18:38043383-38043405 GGAATTTGCTGCGAAAAGACTGG + Intergenic
1156575578 18:38311702-38311724 GGATTAAGCTGTGGAACAACAGG - Intergenic
1157750183 18:50171524-50171546 TGATTCTGCTGGGGAAACAGTGG + Intronic
1158482848 18:57837021-57837043 TGATTATGCTCAGGAAAAACTGG - Intergenic
1161945008 19:7430120-7430142 GGATTCTGGAGCAGAAAAATAGG - Intronic
1164509427 19:28885413-28885435 GGTTTCTGCTGGAGAATAACTGG + Intergenic
926821929 2:16861328-16861350 GGATTTTGCTACCAAAAAACAGG + Intergenic
928402958 2:30992495-30992517 GGAATCTGCCAGGGAAAAACAGG + Intronic
929956144 2:46460188-46460210 GGTTTCTGCTTCTGTAAAACGGG - Intronic
931664151 2:64598306-64598328 GGATTCTGTAGCGGAAACACTGG - Intergenic
931751487 2:65334358-65334380 AGACTCTGCTGTGAAAAAACAGG - Intronic
932633409 2:73366804-73366826 GGATTTTGCTGCTGAAAGATTGG - Intergenic
937674673 2:124577167-124577189 TGATAGTGCTGCGGAAAAAATGG - Intronic
942542273 2:177026774-177026796 GGATTCTACTGCTAAAAAGCAGG - Intergenic
944276377 2:197843170-197843192 GGATTCTGATGCTCAAAACCAGG + Intronic
945172559 2:207012212-207012234 GGTTTCTGTTGCGGAAAGAAGGG - Intergenic
945680872 2:212912661-212912683 AGTTTCTGCAGCTGAAAAACAGG + Intergenic
948716751 2:239870164-239870186 GGATTCTCCTTCGGAATGACAGG - Intergenic
1170030685 20:11940758-11940780 GGATTGTTCTGCAGAAACACAGG + Intergenic
1179168844 21:38957281-38957303 GTATTTTACTGGGGAAAAACAGG - Intergenic
1179621406 21:42618560-42618582 GGATTCTGTTGTGGGAGAACTGG - Intergenic
1181383040 22:22522121-22522143 GGATTCTGCTTCTGGAAAAGAGG - Intergenic
1183487822 22:38098831-38098853 GGATTCTGCTTGGGAAAGTCAGG - Intronic
1183668473 22:39258221-39258243 GGTTTCTGCTTCTGAACAACGGG + Intergenic
955003592 3:54949339-54949361 GGTCTCTGCTGCTGAAAAAAGGG + Intronic
955025274 3:55161473-55161495 TGTTTCTGCTGCTGAATAACTGG + Intergenic
956785332 3:72637510-72637532 GGATTCAGCTGCAGAGATACAGG - Intergenic
960573642 3:119208585-119208607 GGAGCCTGCTTCAGAAAAACTGG + Intergenic
962644152 3:137419667-137419689 GAATTATGCTGCCAAAAAACAGG - Intergenic
966645901 3:182246124-182246146 GGATTCTGCTGCAGAAACTTGGG - Intergenic
968244194 3:197125397-197125419 GGATTCTGCTGCGAAGAAGAAGG + Intronic
969781454 4:9407255-9407277 AGATTTTGCTGGGGAAAGACAGG - Intergenic
975996603 4:80322351-80322373 TGATTCTGCTGCCTAAAACCTGG - Intronic
977271948 4:94927783-94927805 GGACTCTGCTTAGGAAGAACTGG + Intronic
979767137 4:124475522-124475544 GGTTTCTGCTGCTGAAAAACAGG - Intergenic
980820107 4:138004121-138004143 GCATTGTGCTTTGGAAAAACAGG + Intergenic
981016678 4:139980767-139980789 GTATTCTGCTGCAGGAAGACAGG + Intronic
986938211 5:12917825-12917847 GGTCTCTGCTGCTGACAAACTGG + Intergenic
987204410 5:15610243-15610265 GGATTCTTCTGAGAAAAAAGAGG - Intronic
993791908 5:92219834-92219856 GGTTTCTGCTGCTGACAAATTGG - Intergenic
996285083 5:121780505-121780527 TTATTTTGTTGCGGAAAAACAGG - Intergenic
996395886 5:123013442-123013464 GAATTCAGCAGCGGAAACACAGG + Intronic
996614140 5:125419411-125419433 GGATTCTGAAGCAGAAAAATAGG - Intergenic
996869987 5:128179882-128179904 GGATTCTGCTGGCGAAATATAGG - Intronic
999298413 5:150475040-150475062 GGATTCTGCTGTGCAGACACTGG + Intergenic
1000671663 5:164070873-164070895 GGATTTTGCTGTAGTAAAACTGG + Intergenic
1007308493 6:40925978-40926000 GCATTCTGGTGGGGAAAAAAAGG - Intergenic
1007949847 6:45861488-45861510 GGTTTCTGCAGCTGTAAAACAGG - Intergenic
1012716616 6:102681168-102681190 GGATTCTGCAGAGGAAAACAGGG + Intergenic
1015475882 6:133658409-133658431 GGTTTCTGCTGCTGGCAAACTGG - Intergenic
1019565702 7:1678070-1678092 GGATTCGGGTGCGGGAACACTGG - Intergenic
1021595479 7:22312166-22312188 AGATTCTGATGCGGTAAGACTGG + Intronic
1031162358 7:118183684-118183706 GGCTTCTGCTGCAGAAAACTAGG + Intergenic
1035140238 7:156752395-156752417 GGATACAGTTGGGGAAAAACTGG + Intronic
1036837979 8:12091477-12091499 AGATTTTGCTGGGGAAAGACAGG + Intergenic
1036859769 8:12337724-12337746 AGATTTTGCTGGGGAAAGACAGG + Intergenic
1037963988 8:23119217-23119239 GGACTCTGCTGAGGAACACCAGG - Intergenic
1038715618 8:29988141-29988163 GGATTCTGCTGCTGGAAATGGGG - Intergenic
1042567663 8:70128892-70128914 GCATACTGCTGTGGGAAAACGGG + Exonic
1046545548 8:115645342-115645364 TTATTCTCCTGCCGAAAAACTGG + Intronic
1047341593 8:123985752-123985774 GGATGCTGCTGGTGAAACACGGG - Intronic
1047738656 8:127789258-127789280 GGATTCTGCAGCAGCACAACTGG - Intergenic
1050744614 9:8860527-8860549 GGGTGATGCTGCTGAAAAACGGG + Intronic
1052069428 9:24064095-24064117 TGATATTGCTGCAGAAAAACAGG + Intergenic
1053430194 9:38037138-38037160 GGATTCTTCTCCGGGAAAAGAGG - Intronic
1053819663 9:41953379-41953401 GGAGTCTGCTGAGCAGAAACGGG + Exonic
1054109930 9:61097032-61097054 GGAGTCTGCTGAGCAGAAACGGG + Intergenic
1054610927 9:67234093-67234115 GGAGTCTGCTGAGCAGAAACGGG - Intergenic
1186508979 X:10116417-10116439 GGATTCTGCTTCAGGAAAAAAGG + Exonic
1187830535 X:23376710-23376732 GGATTCTACTGTGGAATAAGAGG - Intronic
1192577725 X:72256125-72256147 GTATTGTGTTGAGGAAAAACCGG + Intronic
1194174750 X:90631753-90631775 GGTGTCTGCTGCTGACAAACTGG - Intergenic
1194579430 X:95653623-95653645 GGCTTGTGCTGAGGAAAAAGAGG + Intergenic
1194584241 X:95713984-95714006 GGTCTCTGCTGCTGGAAAACTGG - Intergenic
1200521396 Y:4212942-4212964 GGTGTCTGCTGCTGACAAACTGG - Intergenic
1200971471 Y:9157062-9157084 TGCTGCTGCTGCTGAAAAACAGG + Intergenic
1202139551 Y:21707232-21707254 TGCTGCTGCTGCTGAAAAACAGG - Intergenic