ID: 1142580106

View in Genome Browser
Species Human (GRCh38)
Location 17:936663-936685
Sequence CTACGATGTCTGGCTAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142580098_1142580106 18 Left 1142580098 17:936622-936644 CCCAATTCTGGTTGTGCAAACAG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1142580106 17:936663-936685 CTACGATGTCTGGCTAAAACGGG 0: 1
1: 0
2: 0
3: 5
4: 44
1142580099_1142580106 17 Left 1142580099 17:936623-936645 CCAATTCTGGTTGTGCAAACAGT 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1142580106 17:936663-936685 CTACGATGTCTGGCTAAAACGGG 0: 1
1: 0
2: 0
3: 5
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142580106 Original CRISPR CTACGATGTCTGGCTAAAAC GGG Intronic
902822970 1:18954811-18954833 CCACAATCTCTGGCTAGAACTGG - Intronic
909753007 1:79187889-79187911 CTCCAATGTCTGGCTGAACCTGG + Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1078975151 11:16465652-16465674 CTACGATGTCAGGATAAAAAAGG + Intronic
1081616738 11:44595780-44595802 CTACCATGTCTGGCCAGAAGGGG - Intronic
1083137994 11:60697742-60697764 CTACAATATCTGGTTAAACCTGG + Intergenic
1099851481 12:88102528-88102550 CTTAGATGTCTGGTTAAAAGAGG + Intronic
1099856673 12:88177036-88177058 CTACTGTGTCTGGCCCAAACTGG - Intronic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1114178721 14:20346892-20346914 CTATGATGTCATGCTAAATCAGG + Exonic
1114300906 14:21376918-21376940 CTACCATGCCTGGCTAATCCAGG - Intronic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1125063410 15:35452284-35452306 GTACAATGCCTGGATAAAACAGG + Intronic
1129825366 15:78631287-78631309 CACCAATGTCTGGCTGAAACAGG - Exonic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1135230671 16:20703807-20703829 CCACAATGTCTGGCCAGAACTGG + Intronic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1142580106 17:936663-936685 CTACGATGTCTGGCTAAAACGGG + Intronic
1145907810 17:28525812-28525834 CTACCAGGTGTGGCCAAAACAGG + Intronic
1161965560 19:7546064-7546086 CTACAAAGTCTGGCTTAGACAGG + Intronic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
933391244 2:81670727-81670749 CTATGGTTTCTGACTAAAACTGG - Intergenic
935779236 2:106496985-106497007 CCACCACGTCTGGCCAAAACTGG - Intergenic
937960939 2:127458149-127458171 CCACCATGTCTGGCTAATATAGG - Intronic
938572410 2:132572446-132572468 CTGTGGTGTCTGGCTAGAACTGG - Intronic
949639495 3:6019216-6019238 CTATGAAGTCTTGCTAAAATGGG + Intergenic
955874782 3:63477338-63477360 ATACGATGTCTGTATAACACTGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
972745017 4:41924176-41924198 CTGTGATGTCTGGCTTAAACTGG + Intergenic
978172386 4:105688828-105688850 CTAAGATGGCTGGATAAAACAGG - Intronic
981697757 4:147575708-147575730 CCACCATGTCTGGCTGACACTGG + Intergenic
983744961 4:171186712-171186734 CTAACATGTCTAGTTAAAACTGG + Intergenic
1002066823 5:176656104-176656126 CTACGACGTCCGGCTCAAACTGG + Exonic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1020943093 7:14564696-14564718 CTAAGAAGTCTGGTAAAAACAGG - Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1038426839 8:27469334-27469356 CACCAACGTCTGGCTAAAACAGG - Exonic
1052251928 9:26408673-26408695 CTAAACTGTCTGGCTAAATCAGG - Intergenic
1058605249 9:106714670-106714692 CTACAATGTCTGGTTAATAGTGG - Intergenic
1187379257 X:18785593-18785615 CTACCATGCCTGGCTGCAACTGG - Intronic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1194978032 X:100412135-100412157 CAACGGTGTCTGGAGAAAACCGG - Intergenic
1199059010 X:143330972-143330994 ATAGTATGTCTGGCAAAAACTGG + Intergenic