ID: 1142583993

View in Genome Browser
Species Human (GRCh38)
Location 17:959360-959382
Sequence CGCGCAGAGGCTGCCTGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 208}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142583979_1142583993 25 Left 1142583979 17:959312-959334 CCCTCCCAGGCCCGCGACACTCC 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 208
1142583987_1142583993 14 Left 1142583987 17:959323-959345 CCGCGACACTCCAAGGAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 208
1142583978_1142583993 26 Left 1142583978 17:959311-959333 CCCCTCCCAGGCCCGCGACACTC 0: 1
1: 0
2: 3
3: 13
4: 205
Right 1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 208
1142583990_1142583993 4 Left 1142583990 17:959333-959355 CCAAGGAGGGCTGGGAGTACGTG 0: 1
1: 1
2: 1
3: 11
4: 169
Right 1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 208
1142583986_1142583993 15 Left 1142583986 17:959322-959344 CCCGCGACACTCCAAGGAGGGCT 0: 1
1: 0
2: 0
3: 10
4: 76
Right 1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 208
1142583981_1142583993 21 Left 1142583981 17:959316-959338 CCCAGGCCCGCGACACTCCAAGG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 208
1142583983_1142583993 20 Left 1142583983 17:959317-959339 CCAGGCCCGCGACACTCCAAGGA 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 208
1142583980_1142583993 24 Left 1142583980 17:959313-959335 CCTCCCAGGCCCGCGACACTCCA 0: 1
1: 0
2: 1
3: 12
4: 172
Right 1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142583993 Original CRISPR CGCGCAGAGGCTGCCTGCCC CGG Intronic
900657045 1:3763539-3763561 CGCCCAGACGCTGCCTGCTCTGG + Intronic
900720595 1:4173435-4173457 AGCACAGAGGCTGCCTGCATGGG - Intergenic
900786549 1:4653911-4653933 AGCGCAGCTGCTGCCTGGCCAGG - Intergenic
901065186 1:6490910-6490932 CGCGCGGAGGCTTCCTGTCGCGG - Intronic
902602677 1:17550851-17550873 AGCTCCCAGGCTGCCTGCCCTGG - Intronic
905283350 1:36863295-36863317 TGCCCAGAGGGTGACTGCCCTGG - Intronic
905769051 1:40625646-40625668 CCCTCTGTGGCTGCCTGCCCAGG + Exonic
907976527 1:59436266-59436288 AGGGCAGAGGGTGCCTGCCGTGG - Intronic
908401144 1:63774080-63774102 CGCCCAGGGGCTGCCGTCCCGGG - Exonic
913284042 1:117211036-117211058 GGCACAGTGGCTGCCTGCTCCGG + Intergenic
914050475 1:144126387-144126409 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
914128707 1:144839058-144839080 CGGGCAGAGGTTGGCTGCCTTGG - Intergenic
915309917 1:155001747-155001769 AGCACAGAGGCTGCTTGCCTGGG + Intergenic
919820432 1:201468869-201468891 CGCGCACGGCCTGCCAGCCCGGG - Exonic
919897456 1:202018235-202018257 CCTGCAGAGGCCACCTGCCCAGG - Intergenic
922502865 1:226110003-226110025 CGGGCAGGGGCTGGCTGGCCGGG + Intergenic
924511209 1:244730475-244730497 CGCGCGGGGGCGGCCTGCGCGGG + Intergenic
1063124800 10:3128673-3128695 GGCGCAGAGGCTGAAGGCCCTGG - Intronic
1063379387 10:5574933-5574955 CGCTCGGACGCTGCCTGCCCAGG + Intergenic
1064221045 10:13440415-13440437 CGCCCTGTGGCTCCCTGCCCAGG + Intronic
1065101183 10:22334763-22334785 CGCGAAGCCGCTGCCTCCCCGGG - Intergenic
1067044146 10:42975047-42975069 CCCGCTGGGGCTGCCTGCCAGGG + Intergenic
1067693537 10:48519698-48519720 CGGGCACAGGCCACCTGCCCAGG + Intronic
1067832032 10:49615898-49615920 GGCCCAGAGTCTCCCTGCCCTGG + Intronic
1072416265 10:95249240-95249262 CCCTCAGAGGCTGGCTGCCCTGG - Intronic
1072503711 10:96043796-96043818 GGCGCAGAGCCTGGCTGGCCCGG + Intronic
1073060367 10:100730104-100730126 CGCGCTGAGGCCGCAGGCCCAGG - Intergenic
1076208986 10:128625626-128625648 TGCACAGAGGCTGCCTGGCAGGG + Intergenic
1076394536 10:130129147-130129169 CGCGGGGAGGCTGTTTGCCCTGG + Intergenic
1076647402 10:131962695-131962717 CTGGCAGGGGCTGCCTGCACTGG + Intergenic
1076738091 10:132467647-132467669 CGGGCCGAGGCTGCCCTCCCAGG + Intergenic
1077052806 11:575444-575466 CGTGCAGGGGCTGCCTGGGCTGG - Intergenic
1077316698 11:1922530-1922552 CACGGAGAGGATGTCTGCCCTGG + Intronic
1078521425 11:12066924-12066946 AGCCACGAGGCTGCCTGCCCTGG + Intergenic
1079081895 11:17419366-17419388 GGTGCAGAGGCTGCCTTCCAGGG + Intronic
1080878824 11:36300771-36300793 GGTTCAGAGGCTGCCTGCCAAGG + Intronic
1081746032 11:45473171-45473193 TGCGCAGAGGCTTGCTTCCCTGG - Intergenic
1082020922 11:47532460-47532482 GAGGCAGACGCTGCCTGCCCAGG + Intronic
1083148494 11:60775650-60775672 GGCGCAGAGGCTGCCGGGCTGGG - Exonic
1083572379 11:63767672-63767694 CGGGCAGAGTCTCCCTGGCCTGG + Intronic
1083730193 11:64648644-64648666 AGAGCAAAGGCTACCTGCCCCGG + Intronic
1083772906 11:64878356-64878378 CGCGCAGAAGCTGCTACCCCTGG - Exonic
1083856615 11:65396240-65396262 AGTGCAGAGGCTGCCGGCTCAGG + Intronic
1085459168 11:76682823-76682845 CTCACTGAGGCTGCCTCCCCTGG + Intergenic
1090347438 11:126082779-126082801 CCGGCTGGGGCTGCCTGCCCTGG - Intergenic
1091550159 12:1530608-1530630 AGCGCCGGGGCTGCCTGGCCGGG + Intronic
1091602191 12:1924688-1924710 CTCCCAGCGGCTGCCTGCCTGGG - Intergenic
1091650342 12:2304589-2304611 GAGGCAGGGGCTGCCTGCCCTGG - Intronic
1091979866 12:4856093-4856115 CACGCAGAGGCTGGACGCCCTGG + Intergenic
1093583170 12:20807325-20807347 CACCCAGAGGCTGCCTCACCTGG + Intergenic
1100473426 12:94914219-94914241 CTCAGAGAGGCTGCCTTCCCTGG + Intronic
1102025795 12:109713873-109713895 CGCGGAGAGGCTGCGCGCGCCGG + Intergenic
1102039774 12:109793491-109793513 CACCCAGAAGCTGCCGGCCCAGG + Intronic
1102888479 12:116539360-116539382 TCCCCAGAGGCTGCCTGCCCTGG - Intergenic
1103324388 12:120110806-120110828 TGAGCAGCGTCTGCCTGCCCAGG - Intronic
1103949748 12:124544314-124544336 CCCAGAGAGGCTGCCTGGCCTGG + Intronic
1105705345 13:22964738-22964760 CCAGCACAAGCTGCCTGCCCGGG - Intergenic
1105821844 13:24087178-24087200 CTCCCAGAGCCTGCCAGCCCAGG + Intronic
1106902153 13:34364961-34364983 TGCCCAGAGTCTGACTGCCCAGG - Intergenic
1107731770 13:43356030-43356052 CAAGCAGAGGATGCGTGCCCGGG - Exonic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1113724328 13:112587488-112587510 CGCGCAGAGGCGCCCTCCCACGG + Intronic
1114669728 14:24402869-24402891 CACACAGAGGTTCCCTGCCCCGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1121465334 14:94111944-94111966 TGGCCAGAGTCTGCCTGCCCCGG - Intronic
1122094828 14:99363159-99363181 GGCACAGCGGCTGCCTCCCCAGG + Intergenic
1122694106 14:103544507-103544529 CGCCCAGAGGAAGCCTGCACGGG - Intergenic
1122808993 14:104278546-104278568 TGCCCAGGGGATGCCTGCCCGGG + Intergenic
1123019330 14:105390304-105390326 AGAGGAGAGACTGCCTGCCCGGG + Intronic
1123420346 15:20125696-20125718 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
1123445514 15:20327828-20327850 CGAGCAGAGGTTGGCTGCCTTGG - Intergenic
1123529570 15:21132232-21132254 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
1125716596 15:41823084-41823106 AGCACAGAGGCTGCCTGCTGGGG - Exonic
1126142307 15:45448491-45448513 AGCACACAAGCTGCCTGCCCAGG + Intronic
1127414906 15:58749094-58749116 CTCGCTGCGGCTGCCTGCACCGG + Intronic
1132568128 16:632455-632477 CGCTCTGTGGCTGCCTCCCCGGG - Intronic
1132603997 16:786067-786089 TGCGGAGGGGCTGCCTGGCCTGG + Exonic
1132626734 16:894945-894967 CGCCCCGGGGCTCCCTGCCCAGG - Intronic
1132804463 16:1769201-1769223 GCCGCCGAGGCTGCCTGCCCTGG + Exonic
1135404780 16:22190351-22190373 CGTGCAGAGGCTGCAGGCCTAGG - Exonic
1136074683 16:27808824-27808846 CCCGCAGAGGCTGCTCGCTCTGG - Intronic
1136721234 16:32320770-32320792 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
1136839617 16:33527056-33527078 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
1137580951 16:49633101-49633123 GGTGCAGATGCTGCCTGCCTGGG + Intronic
1139937388 16:70581303-70581325 CGGACAGAGGCTGCCCGTCCAGG - Intronic
1141753985 16:85979117-85979139 TGCGCACAGGCTGTGTGCCCTGG + Intergenic
1141952643 16:87348622-87348644 AGGGCAGAGGCAGCCGGCCCAGG + Intronic
1142107863 16:88315900-88315922 CCCGCCCAGGCTGCCTGCTCCGG + Intergenic
1142164856 16:88580788-88580810 CACGCAGAGGCTGCTTTCCAGGG - Intronic
1142371832 16:89686883-89686905 CGCGCCGAGGCTTCCGGCACGGG + Intronic
1203005198 16_KI270728v1_random:197000-197022 CGGGCAGAGGTTGGCTGCCTTGG - Intergenic
1203136748 16_KI270728v1_random:1733121-1733143 CGGGCAGAGGTTGGCTGCCTTGG - Intergenic
1203149783 16_KI270728v1_random:1827341-1827363 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
1142489711 17:270327-270349 TGAGCACAGGCCGCCTGCCCGGG + Intronic
1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG + Intronic
1143027780 17:3951284-3951306 CGTGCAGAGGATCCGTGCCCGGG - Exonic
1144514983 17:15911102-15911124 CTCCCACAGGCTGCCTGCCCTGG - Intergenic
1144717964 17:17447313-17447335 AGGGCAGGGGCTGCCGGCCCCGG + Intergenic
1144849254 17:18235772-18235794 CCCGCCCAGCCTGCCTGCCCTGG + Intronic
1146637347 17:34516404-34516426 GGAGCAGAGGCTGCCAGCCAGGG + Intergenic
1146891120 17:36507059-36507081 CAGGCAGGGGCTGCCTGCCAGGG + Exonic
1146952831 17:36918708-36918730 CGCTTTGAGACTGCCTGCCCTGG + Intergenic
1148220502 17:45858481-45858503 TGAGCAGAGGCAGCCAGCCCAGG - Intergenic
1152139046 17:78525687-78525709 CACGCAGGGACTGCCTGCTCTGG + Intronic
1152174866 17:78781410-78781432 CGCGTTGAGGCTGCTGGCCCAGG - Intronic
1152270260 17:79320335-79320357 CTGGCAGAGGCTGCCAGCACTGG - Intronic
1152290226 17:79436149-79436171 TGCCCAGCGGCTGCCTACCCGGG - Intronic
1152377894 17:79928128-79928150 GGCCCAGAGGCTGCCAGGCCTGG + Intergenic
1155036225 18:22026978-22027000 CACTCACAGTCTGCCTGCCCAGG - Intergenic
1156079508 18:33316359-33316381 AGCGCAGCAGCTGCCCGCCCAGG - Intronic
1160004916 18:75062547-75062569 GCCGCACAGGCTGCCTGCCCAGG + Intronic
1160653415 19:246536-246558 CGCGCCGCGCCTGCCTGCGCCGG - Intergenic
1161362356 19:3857866-3857888 CGCGCTGGTGCTGCCTGCCTGGG + Intronic
1161606126 19:5215822-5215844 CGTGCAGAGGCTGACACCCCTGG + Intronic
1161738863 19:6008070-6008092 CACGCAGGAGCTGCCTGCCTGGG + Intronic
1165754723 19:38286182-38286204 CCCACAGAGCCTGCCTGCCTGGG - Intronic
1166499679 19:43331363-43331385 CCCGCAGAGGATGCATCCCCTGG - Intergenic
1167240178 19:48338862-48338884 AGCTCAGAGGCTGCCTGCTCTGG - Intronic
1167299944 19:48672495-48672517 CATGCAGACGCTGCCTCCCCTGG + Intronic
1167367843 19:49064270-49064292 CCTGGAGTGGCTGCCTGCCCTGG + Intronic
1168628167 19:57935160-57935182 CGCGCTGAGGCTCCCGGCTCAGG - Exonic
1202689882 1_KI270712v1_random:79025-79047 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
925259465 2:2517232-2517254 AGGGCACAGGCTGCCTGTCCTGG + Intergenic
927946046 2:27135814-27135836 GGCGCAGAAGATACCTGCCCGGG - Intergenic
929484679 2:42342856-42342878 GGCCCAGATGCTGCTTGCCCAGG - Intronic
929936338 2:46297073-46297095 CGGGGAGAGGCAGCCTGCGCAGG - Intronic
929960227 2:46490677-46490699 GGCGCAGAGTCTGCCTGCAGAGG + Intergenic
930004108 2:46882445-46882467 CAGCCAGAGGCAGCCTGCCCTGG + Intergenic
931657684 2:64524696-64524718 CGGGCAGATGCTCCCGGCCCGGG - Intronic
932570129 2:72934161-72934183 CTCGGAGAGCCTGCCTGCCTGGG + Exonic
933956537 2:87376997-87377019 CGGGCAGAGGTTGGCTGCCTTGG - Intergenic
934240681 2:90269024-90269046 CGGGCAGAGGTTGGCTGCCTTGG - Intergenic
934272511 2:91547735-91547757 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
934569008 2:95356970-95356992 AGCCCAGAGGCTGCTGGCCCAGG + Intronic
935645423 2:105329939-105329961 GGCGCTGAGGCCGCCGGCCCCGG + Exonic
935692659 2:105745001-105745023 CGGGCGGACGCTGCCGGCCCGGG - Exonic
936089511 2:109491867-109491889 AGGGCAGAGGCTGCCTTCCCGGG - Intronic
936148554 2:109997646-109997668 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
937310521 2:120900022-120900044 CATGCAGAGGCTGCCGGCCGGGG + Intronic
938066166 2:128283107-128283129 CTCGCAGGGGTGGCCTGCCCAGG - Intronic
938206417 2:129428250-129428272 CATGCGGAGGCTGCCTTCCCTGG + Intergenic
938949298 2:136242519-136242541 TGCCCAGAGGCTTCCTGTCCTGG + Intergenic
940823653 2:158385903-158385925 AGTGCAGAGGCTTCCTTCCCAGG - Intronic
940919063 2:159287225-159287247 CCCGGGCAGGCTGCCTGCCCCGG + Intergenic
942068493 2:172294136-172294158 AGCGCAGTGGCTGACTGACCTGG + Intergenic
945119361 2:206442877-206442899 CGCGCAGGGGCGCTCTGCCCCGG - Intergenic
948298983 2:236887974-236887996 TGCGCATAGACTGCCTGTCCTGG + Intergenic
948928758 2:241116970-241116992 CGCTCAGAAGCTGCCTTCCCGGG - Intronic
948934858 2:241157102-241157124 CGCACAGAGGATGCCGGCTCCGG + Intronic
1171009124 20:21498384-21498406 GGCGGAGAGGCTGCCTGTGCAGG - Intergenic
1171453530 20:25252923-25252945 AGGGCAGAGGCTGGCTGCCAGGG - Intronic
1172098636 20:32472957-32472979 TGCCCAGAGGCTGGCTGGCCTGG - Intronic
1172118325 20:32584206-32584228 CGCCCCGGGGCTGCCTGTCCCGG - Intronic
1174113925 20:48214262-48214284 TGTGCAGAGGCGGCCTGCCTTGG - Intergenic
1174167919 20:48598271-48598293 TGTGCAGAGGCGGCCTGCCTTGG + Intergenic
1175215369 20:57389579-57389601 CGCGCAGTGGCCGCCTCCCCCGG + Intergenic
1175758129 20:61543022-61543044 CGAGCGGATGCTTCCTGCCCTGG - Intronic
1175782935 20:61695275-61695297 CCCGCAGAGGCGTCCTGCCCGGG + Intronic
1176379774 21:6106406-6106428 TGCCCAGCGCCTGCCTGCCCGGG - Intergenic
1178479057 21:32963459-32963481 TGCGCAAAGGCTTCCTGCCTGGG + Intergenic
1178917054 21:36710839-36710861 CGAGCAGAGGCCGCCTGGGCAGG - Intronic
1178972762 21:37195558-37195580 AGCGCAGAGGCTCCGTGCACAGG - Intronic
1178975926 21:37221118-37221140 CGCGCGGAGCCTGCGTGCGCGGG - Intergenic
1179743700 21:43431831-43431853 TGCCCAGCGCCTGCCTGCCCGGG + Intergenic
1180086709 21:45510847-45510869 TCTGCAGAGGCTGCCTGGCCAGG + Intronic
1180187267 21:46145892-46145914 CGCGCAGGGACTTGCTGCCCAGG + Exonic
1180551536 22:16545538-16545560 CGGGCAGAGGTTGGCTGCCTTGG - Intergenic
1180942081 22:19666097-19666119 CGCACAGAGGATGGCTGCCCGGG + Intergenic
1181352465 22:22268385-22268407 CGGGCAGAGGTTGGCTGCCTTGG + Intergenic
1181469386 22:23128410-23128432 CACACACAGGCTGCCAGCCCAGG - Intronic
1181802591 22:25357353-25357375 CGCGCAGCTCCTGCCTGTCCAGG + Exonic
1183213542 22:36465366-36465388 CGGGCAGAGGCTGCCAACCTGGG + Intergenic
1183742914 22:39678451-39678473 CCGGCAGAGGCTCCCTGGCCTGG + Intronic
1183966999 22:41447880-41447902 CGCGCTGAGGCCCCCTCCCCCGG + Intergenic
1185055125 22:48575437-48575459 GGCGCAGTCGCTGCCGGCCCAGG - Intronic
1185088128 22:48751731-48751753 CTGGCAGAGGCTGCCGGCCCGGG - Intronic
950653983 3:14425354-14425376 CCCGCAGGAGCTGCCTGCACTGG + Intronic
954414364 3:50385732-50385754 TGCTCCGAGGCTGCCTGCCCTGG - Intronic
962408056 3:135117095-135117117 AGAGCAGAGGCTGCCTGGCTAGG + Intronic
966878261 3:184335838-184335860 CACGCAGAGGCGGCCTGGACCGG - Intronic
968511216 4:996782-996804 GGCCCAGAGGCTGAGTGCCCAGG + Intronic
968866783 4:3218050-3218072 AGCCCAGAGGCTGCCTGCTGTGG + Intronic
973810684 4:54567024-54567046 CCCTCAGATGCTGCCTTCCCAGG - Intergenic
974074631 4:57157347-57157369 CTGTCAGAGGCTGCCTGCTCTGG + Intergenic
979309966 4:119191744-119191766 GGTGCAGAGGCTGCCTGCACAGG - Intergenic
982224528 4:153153569-153153591 CGGGACGGGGCTGCCTGCCCTGG - Intronic
982313656 4:154010237-154010259 AGGGCAGGGGCTCCCTGCCCAGG + Intergenic
984778470 4:183504527-183504549 GGCGCAGAGACTGGCTCCCCGGG + Intergenic
997120026 5:131164641-131164663 CGCGCACAGCCGGCCTGCCAGGG - Intronic
997470663 5:134115239-134115261 CGCGCAGAGCGTCCCTGCCCCGG + Intronic
998040810 5:138950035-138950057 TGCCCCGAGGCTGCCGGCCCCGG - Intronic
1002351665 5:178588283-178588305 CCAGCAGTGGCTGCCTGCCCAGG + Intronic
1002923987 6:1594524-1594546 CCCGCAGTCGCTCCCTGCCCAGG - Intergenic
1002926847 6:1609992-1610014 CGCGCGCCGGCCGCCTGCCCGGG - Exonic
1003179146 6:3777338-3777360 CGGGCAGAGGCTGTGTACCCAGG + Intergenic
1006116075 6:31776840-31776862 CCCGCAGAGCCGGCCTGCCCTGG - Intronic
1007777847 6:44233678-44233700 CGTCCAGAGGCTCCCTCCCCAGG - Exonic
1015994888 6:138987745-138987767 CGCGCAGCCCCTGCCGGCCCAGG - Exonic
1017773243 6:157659677-157659699 GGCGCAGAGGGTGGGTGCCCTGG - Intronic
1020000710 7:4754094-4754116 CCCGCGGAGGCTACCTGCTCCGG + Intronic
1020106980 7:5426741-5426763 CGCGGAGAGGCCACCTGCCCGGG + Intergenic
1024251918 7:47512061-47512083 AGAGCGGAAGCTGCCTGCCCTGG + Intronic
1026585826 7:71655461-71655483 ACCGCAGAGGCTGCCTACCCCGG - Intronic
1026737990 7:72960966-72960988 CGTGGAGAGGCTGGCAGCCCTGG - Intronic
1026789027 7:73319761-73319783 CGTGGAGAGGCTGGCAGCCCTGG - Intronic
1026944253 7:74306133-74306155 CCCGCAGGTGCTGCCTGCCCAGG + Intronic
1027105744 7:75404102-75404124 CGTGGAGAGGCTGGCAGCCCTGG + Intronic
1027361798 7:77416587-77416609 CGCGCGGAGGCCTCCCGCCCCGG - Intergenic
1032751172 7:134843188-134843210 CACACAGATGCTGGCTGCCCTGG - Intronic
1033009866 7:137609635-137609657 AGCTCAGAGGCAGCCAGCCCAGG + Intronic
1033032299 7:137838858-137838880 TTCGCAGATGCTACCTGCCCTGG - Intronic
1034275627 7:149822611-149822633 CGTGCAGGGGGCGCCTGCCCTGG - Intergenic
1034405739 7:150901411-150901433 CGGGCCGAGGCTGCCTGGGCCGG - Intergenic
1035076427 7:156180665-156180687 CCCGCAGAGGCAGCCTGCAGAGG + Intergenic
1035404428 7:158588239-158588261 CGGGTAGAGGCCGCCTGCCCAGG - Intergenic
1035703217 8:1653204-1653226 CACGCAGATGCTGCCAGGCCTGG + Intronic
1038038451 8:23705382-23705404 CTGGCAGAGGAGGCCTGCCCTGG + Intronic
1039451109 8:37675677-37675699 CGAGCAGGGGCTGCCTTCCTTGG - Intergenic
1039947177 8:42140218-42140240 CGCGGAGACGCTCCCAGCCCCGG + Intergenic
1042933444 8:74035366-74035388 GGCGGCGTGGCTGCCTGCCCTGG - Intergenic
1049192317 8:141295180-141295202 CCCACAGGGGCTGCCTTCCCTGG - Intronic
1056495121 9:87148578-87148600 AAAGCAGACGCTGCCTGCCCGGG + Intergenic
1060267672 9:122121779-122121801 CTTGCATAGGCTGCCTGTCCAGG + Intergenic
1060667166 9:125438835-125438857 AGCTCAGAGCCTGCCTGCCAGGG - Exonic
1060722563 9:125988710-125988732 CTCTCAGAGGAGGCCTGCCCGGG + Intergenic
1061056470 9:128225408-128225430 GGCGCAGAGGCTGCCTCCTAGGG - Intronic
1061628980 9:131859574-131859596 CGCCCAGAGCCAGCCTGGCCAGG - Intergenic
1062278892 9:135743311-135743333 TGCGCAGGGCCTGGCTGCCCTGG - Intronic
1062396388 9:136354561-136354583 CGGGCAGGGGCTGCCAGCGCCGG + Intronic
1062427341 9:136512044-136512066 GGCGCAGTTCCTGCCTGCCCGGG - Intronic
1062437948 9:136555078-136555100 ACAGCAGAGGCTGCCTGGCCTGG + Intergenic
1185643238 X:1599861-1599883 CGCACAGAGGGGGCCTGCCGTGG + Intronic