ID: 1142585279

View in Genome Browser
Species Human (GRCh38)
Location 17:968410-968432
Sequence AAAGATACACAGATGCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 552}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142585276_1142585279 19 Left 1142585276 17:968368-968390 CCTGATTAGTCAAAGAGATGATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 552
1142585275_1142585279 26 Left 1142585275 17:968361-968383 CCGAGCACCTGATTAGTCAAAGA 0: 1
1: 0
2: 0
3: 1
4: 84
Right 1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142585279 Original CRISPR AAAGATACACAGATGCAGCC CGG Intronic