ID: 1142585279

View in Genome Browser
Species Human (GRCh38)
Location 17:968410-968432
Sequence AAAGATACACAGATGCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 552}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142585276_1142585279 19 Left 1142585276 17:968368-968390 CCTGATTAGTCAAAGAGATGATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 552
1142585275_1142585279 26 Left 1142585275 17:968361-968383 CCGAGCACCTGATTAGTCAAAGA 0: 1
1: 0
2: 0
3: 1
4: 84
Right 1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142585279 Original CRISPR AAAGATACACAGATGCAGCC CGG Intronic
900098449 1:950415-950437 ACAGGTACACACATGCAGACAGG + Intronic
900409776 1:2507344-2507366 AAGGCTACAGAGATGCAGGCTGG + Intergenic
901096995 1:6689626-6689648 AAAGATACAAAAAAACAGCCAGG + Intronic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902320891 1:15664964-15664986 AAAGATAACCAGTTGCAGCTAGG + Exonic
902330778 1:15730279-15730301 AAAAATACAAAAATTCAGCCAGG + Intronic
902909009 1:19581309-19581331 AAAAATACAAAAAAGCAGCCAGG - Intergenic
903320035 1:22537559-22537581 AAAGTGCCACAGAGGCAGCCAGG + Intergenic
903504787 1:23825599-23825621 AAAGATGAACAGAATCAGCCTGG + Intronic
903964744 1:27080104-27080126 AAAAACACACATTTGCAGCCAGG - Intergenic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
904673471 1:32182904-32182926 AAAGATACAAAAAATCAGCCGGG + Intronic
905069114 1:35209902-35209924 AAAGATTCTAAAATGCAGCCAGG - Intergenic
905272540 1:36796325-36796347 AAAGGCAGACAGATGGAGCCTGG + Exonic
905467416 1:38165908-38165930 AAAAATACAAAAATGTAGCCAGG + Intergenic
906994466 1:50776962-50776984 AAAAATATACAGAATCAGCCAGG + Intronic
907258702 1:53199347-53199369 AAAGATACAAAAAATCAGCCAGG - Intronic
907895974 1:58691704-58691726 AAAGATACAAAAAATCAGCCAGG + Intronic
908100451 1:60785862-60785884 AATGAAACCCAGGTGCAGCCGGG + Intergenic
908532139 1:65044015-65044037 AAAAATACAAAAATTCAGCCAGG - Intergenic
908834172 1:68211882-68211904 AAAATTTCCCAGATGCAGCCAGG - Intronic
908901354 1:68959937-68959959 AAACATACACAGAGGGAGGCTGG - Intergenic
909563085 1:77026394-77026416 AAAGGCACACACATGCATCCTGG + Intronic
913014388 1:114717956-114717978 AATAATGCACAGTTGCAGCCTGG - Exonic
913027495 1:114859380-114859402 AAAGTTACACAGTTTCGGCCGGG - Intronic
913376044 1:118153686-118153708 AAAGATACAAAAATTTAGCCGGG + Intronic
913670874 1:121096505-121096527 AAAGAGACACACACACAGCCAGG + Intergenic
914216494 1:145635243-145635265 AAAGATACAAAAAAGTAGCCGGG + Intronic
914469063 1:147957901-147957923 AAAGATACAAAAAAGTAGCCGGG + Intronic
914661124 1:149791870-149791892 AAAGAGACACACACACAGCCAGG + Exonic
914895188 1:151664431-151664453 AAATATACAAAGATGAGGCCAGG - Intronic
916215962 1:162394907-162394929 AAAAATACAAAAATGTAGCCAGG - Intergenic
916822333 1:168411590-168411612 AAAGAAACAGTGATGCGGCCGGG + Intergenic
917177375 1:172251568-172251590 ATACACACACATATGCAGCCTGG - Intronic
917341756 1:173986721-173986743 AAAAATACACAGAATCAGCCAGG - Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917945640 1:179967903-179967925 ACAAATACACATATGAAGCCAGG - Intronic
919016486 1:192044012-192044034 AAAGATACAAAGAATTAGCCGGG - Intergenic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
919902365 1:202053650-202053672 AAAAAATAACAGATGCAGCCAGG + Intergenic
920895696 1:210047556-210047578 AAAGATACAAAAAATCAGCCGGG - Intronic
921425587 1:214997660-214997682 AAAGATAGAAAGCTGCATCCAGG - Intergenic
921510917 1:216028090-216028112 AAAGATTCACAGAAGTGGCCGGG + Intronic
922022541 1:221718974-221718996 AAAGTTACACAGGTGAAGCCTGG + Intronic
922098236 1:222460745-222460767 AGAGAGACACAGAAGCAGACGGG + Intergenic
922673194 1:227530633-227530655 AAAGATACAGAGCTGCAGCATGG - Intergenic
923284550 1:232480128-232480150 ACACACACACAGATGCGGCCAGG - Intronic
923396333 1:233568735-233568757 TAAAAGACAAAGATGCAGCCAGG - Intergenic
923477051 1:234344268-234344290 AAAGATACAAAAAAGTAGCCAGG - Intergenic
924103286 1:240625871-240625893 AAAAATACAAAGAAGTAGCCGGG + Intergenic
1064112799 10:12553036-12553058 AGAAATACACAGGGGCAGCCCGG - Intronic
1064762878 10:18639331-18639353 AAAAATACAAAAATGAAGCCAGG + Intronic
1065188278 10:23189897-23189919 AAAGATACCCATATATAGCCGGG + Intergenic
1065673267 10:28145206-28145228 AAAAAGACACAGATACGGCCAGG - Intronic
1065769859 10:29068262-29068284 AAATATACATTGATGCATCCTGG + Intergenic
1065922766 10:30407714-30407736 AAAGATACAAACAAGCAGGCCGG + Intergenic
1066063231 10:31742813-31742835 AAAGACACACAGCATCAGCCAGG + Intergenic
1066703677 10:38156474-38156496 AGAGATACCCACAGGCAGCCCGG + Intergenic
1066987053 10:42476478-42476500 AGAGATACCCACAGGCAGCCCGG - Intergenic
1067046226 10:42986609-42986631 ACAGGTGCACAGATGCTGCCAGG - Intergenic
1067115464 10:43432468-43432490 AAAGAACCACAGATGTAGCCAGG - Intergenic
1067124037 10:43500168-43500190 AAAAATATAAAGATGAAGCCAGG - Intergenic
1067436135 10:46280082-46280104 AAAGATACAGAGATGTGGCCGGG - Intergenic
1068211067 10:53921539-53921561 AAGGATACACAGCTCAAGCCAGG + Intronic
1068660214 10:59615652-59615674 AAAAATACAAAAATTCAGCCAGG + Intergenic
1068763861 10:60741534-60741556 AAAGATACTCATATGGAGCTGGG + Intergenic
1069296077 10:66845969-66845991 AAAAATACACAAATTTAGCCGGG + Intronic
1069444813 10:68463281-68463303 AAAAATACAAAAATTCAGCCGGG + Intronic
1069507927 10:69018505-69018527 AAAGATACAAAAAATCAGCCAGG - Intergenic
1069568998 10:69483147-69483169 AAAAATACAAAAAAGCAGCCGGG - Intronic
1069762872 10:70826351-70826373 AATGACAGACAGAAGCAGCCTGG - Intronic
1070298923 10:75188722-75188744 AAAAATACAAAAATTCAGCCAGG - Intergenic
1070549622 10:77480812-77480834 AAAGACACACACGTGCAGCCGGG + Intronic
1070919556 10:80175758-80175780 AAAAATACACAGATGTCGGCTGG + Intronic
1071016238 10:81000264-81000286 ATAGATATACAGATGTAGCCTGG - Intergenic
1071905788 10:90172175-90172197 AAAGGTAAAAAGAGGCAGCCTGG - Intergenic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1072930873 10:99660627-99660649 AAAGATACACAGCAACGGCCAGG + Intronic
1073056292 10:100705060-100705082 AAAGATACACACACGCAGCTGGG + Intergenic
1073356779 10:102861253-102861275 AAAGATACAAAAAAGTAGCCGGG + Intronic
1074100963 10:110354691-110354713 AAAGATACACAGAGGAGCCCTGG + Intergenic
1074195558 10:111181516-111181538 ACAGAATCACAGATGCAGCCTGG + Intergenic
1075000236 10:118791532-118791554 AAAAATTTACAAATGCAGCCGGG + Intergenic
1075906544 10:126086514-126086536 AAAAATACAAAGAATCAGCCAGG + Intronic
1076844893 10:133065288-133065310 AAACATACAGAGCTGCAGCTGGG - Intergenic
1076919424 10:133443947-133443969 AGATATACACAGGTGCACCCAGG + Intergenic
1079779617 11:24584214-24584236 AAAGATACAAAGAAGCTGGCAGG - Intronic
1079793994 11:24775728-24775750 AAAGTGACCCAGATGCAACCAGG - Intronic
1080380947 11:31771816-31771838 AAAGATACAAAAATTTAGCCGGG + Intronic
1080441237 11:32296635-32296657 AGAGAGACAGAGATGCAGCAAGG + Intergenic
1080653182 11:34238912-34238934 AAAAATACAAAAATTCAGCCAGG - Intronic
1080675525 11:34423369-34423391 AAAGATGGGCAGATTCAGCCTGG + Intergenic
1081616145 11:44592488-44592510 AAAGAAGAACAGATGCCGCCTGG + Intronic
1081732468 11:45381216-45381238 AAAAATACAAAAATGTAGCCGGG - Intergenic
1081964734 11:47162599-47162621 AAAGACAGACAGACACAGCCTGG + Intronic
1082258071 11:50054141-50054163 AAAAATACACAGGGGAAGCCAGG + Intergenic
1082820296 11:57540392-57540414 AGAGATATACAGTTTCAGCCAGG - Intergenic
1083254606 11:61488463-61488485 AAAAATACAAAAATGTAGCCGGG - Intronic
1083694111 11:64431188-64431210 GAAGATACAAAGGTGAAGCCAGG - Intergenic
1083750342 11:64757624-64757646 AAAGTCACACAGCTGAAGCCAGG - Intronic
1084298896 11:68232456-68232478 AAAGATACAAAAATTTAGCCAGG + Intergenic
1084718859 11:70891339-70891361 AAAGATACAAAAAAGTAGCCGGG + Intronic
1084733210 11:71087922-71087944 AAAAATAGTCAAATGCAGCCAGG - Intronic
1085168228 11:74424026-74424048 AAAAATACACAAAACCAGCCAGG - Intergenic
1086210872 11:84317106-84317128 CAAGCAACACAGCTGCAGCCGGG - Intronic
1086798924 11:91146186-91146208 AAAGTTACAAAGTTGCAACCAGG - Intergenic
1087812605 11:102624179-102624201 AGCGGTACACAGGTGCAGCCTGG + Intronic
1088126652 11:106434264-106434286 AAAGATACACAAAATTAGCCGGG - Intergenic
1088376900 11:109151246-109151268 CAAGATACAGAGATGCAGAGTGG - Intergenic
1089552537 11:119291545-119291567 AAAGATACAGAAATGTAGCTGGG + Intronic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1089677383 11:120098917-120098939 AAATGCACACAGATGCAGCTGGG - Intergenic
1090709201 11:129371108-129371130 ATAGATATTCAGAAGCAGCCAGG - Intergenic
1090784834 11:130040083-130040105 AAAAATACAAAAATGTAGCCGGG + Intergenic
1091451265 12:573408-573430 AAAGATAAACACGTGCAGTCTGG + Intronic
1092374159 12:7941501-7941523 AAAGATACAAAAATTTAGCCAGG + Intergenic
1092785682 12:12024464-12024486 AAAGATACACAAAATTAGCCAGG + Intergenic
1094304470 12:29002051-29002073 AAAGAAACACAGATGGAACTAGG + Intergenic
1094621128 12:32081578-32081600 AAAGATACACAAAAATAGCCAGG - Intergenic
1095058846 12:37657147-37657169 AAAACTACACAGATGCATTCTGG + Intergenic
1095063233 12:37729618-37729640 AAAAATACACAGAAGCATTCTGG + Intergenic
1095466063 12:42489216-42489238 ATAGATAGATAGATACAGCCAGG - Intronic
1095517290 12:43020816-43020838 AAAGCTCCACAAAGGCAGCCAGG + Intergenic
1095645629 12:44542647-44542669 AAAGAAACACAGAGAAAGCCTGG + Intronic
1095654766 12:44656079-44656101 AAATTCACACAGAAGCAGCCAGG + Intronic
1096348079 12:50868188-50868210 AAAGATACAGAACTGCAGACTGG + Intronic
1098192848 12:67968465-67968487 CAACATAGACAGAAGCAGCCAGG - Intergenic
1098575751 12:72040198-72040220 AAAGTTATACAGATCTAGCCAGG - Intronic
1099065071 12:77965801-77965823 AAAGATAGATAGATGGAGACAGG - Intronic
1099832012 12:87856298-87856320 AAAGATACAAAAAAGTAGCCGGG - Intergenic
1100359611 12:93863995-93864017 AATGATACACACATGAAGTCGGG + Intronic
1100858787 12:98782799-98782821 AAAGGAACACTGATGCATCCAGG - Intronic
1101621663 12:106395018-106395040 AAAGAAACACCGAATCAGCCTGG + Intronic
1102341269 12:112123500-112123522 AAAAATACAAAAATGTAGCCAGG - Intergenic
1102946254 12:116991260-116991282 AAAGTTACATAGATGAAGCTTGG - Intronic
1102975731 12:117205987-117206009 AAAAATACAAAAATACAGCCGGG - Intergenic
1103216728 12:119207423-119207445 AAAGACACATAAATGCTGCCAGG - Intronic
1103384239 12:120519397-120519419 AAAAATACACAAAATCAGCCAGG + Intronic
1104309485 12:127641772-127641794 AAAAATACAAAAATGTAGCCAGG - Intergenic
1104831997 12:131758784-131758806 AAAAATACAAAAATGTAGCCGGG + Intronic
1105202441 13:18191740-18191762 AAAGATAGAGAGAAGCAGGCAGG - Intergenic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1106501154 13:30330281-30330303 AAATATACAGAAATGCAGCCCGG - Intergenic
1106743577 13:32674823-32674845 AAAGATTCTAATATGCAGCCAGG - Intronic
1107190733 13:37581809-37581831 AAAGATATTCAGATGCTGACTGG + Intronic
1107437549 13:40393591-40393613 AAATATACACATATGCAAACCGG + Intergenic
1107463785 13:40630492-40630514 AAAAATACAAAAATGTAGCCAGG + Intronic
1107500761 13:40972742-40972764 AAAGTTACACAGCTAGAGCCAGG + Intronic
1108827706 13:54434998-54435020 AAAAATACACAAAAGTAGCCCGG - Intergenic
1110539789 13:76695259-76695281 AAAGAAATACAAATGCGGCCGGG + Intergenic
1110619797 13:77582385-77582407 AAAAATACAAAAATTCAGCCAGG - Intronic
1110784803 13:79511157-79511179 AAATCTACATTGATGCAGCCAGG - Intronic
1110855349 13:80291482-80291504 AAAGATATACAAATTCAGCCTGG + Intergenic
1112073433 13:95881011-95881033 AAAAATACAAAGAATCAGCCGGG + Intronic
1112670924 13:101637502-101637524 AAAAATACAAAAATTCAGCCAGG - Intronic
1112956597 13:105066796-105066818 AAAGAGACAGAGAAGCAGACAGG + Intergenic
1112999380 13:105615947-105615969 ACAGACACAGAGATGTAGCCAGG + Intergenic
1113066226 13:106376131-106376153 AAAGAAAAGCAAATGCAGCCGGG - Intergenic
1113278954 13:108767395-108767417 AAAAATACCCAGATACAGCCAGG - Intronic
1115406431 14:33022072-33022094 GAGGCTACAGAGATGCAGCCTGG - Intronic
1116242644 14:42365602-42365624 AAAGATAAACAAATGCATTCAGG - Intergenic
1116666782 14:47786774-47786796 AAAAATAGACAGTTTCAGCCAGG - Intergenic
1116839610 14:49806419-49806441 AAAGATACAAAAATTTAGCCGGG - Intronic
1116940162 14:50783423-50783445 TAAGAAACACAGATCCAGCCAGG + Intronic
1116991515 14:51281992-51282014 ATAGTTACAAAAATGCAGCCAGG - Intergenic
1117111849 14:52465429-52465451 AAAAATACAAAGAGTCAGCCGGG + Intronic
1117999344 14:61508630-61508652 AAAGATACCCAGATGGAAACTGG - Intronic
1118253815 14:64187523-64187545 AAAGATAAACAGATGCCCCGAGG + Intronic
1118360935 14:65055810-65055832 AAAGAAACAAAGATGGGGCCAGG - Intronic
1118508581 14:66444396-66444418 GAAGATACACAGTAGTAGCCAGG + Intergenic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119609753 14:76051840-76051862 AAAGAGACAAAACTGCAGCCAGG - Intronic
1120762357 14:88296531-88296553 AAAGAGAAACAGCTGCAGCATGG - Intronic
1121136756 14:91506104-91506126 AAACATACAAAAATGTAGCCAGG - Intronic
1122797749 14:104214815-104214837 ACAGAGACATAGATGCTGCCTGG + Intergenic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1123226112 15:17032910-17032932 AAAGCTACACATATGCATTCTGG + Intergenic
1124433584 15:29629048-29629070 AATGATAAAAAGATGCAACCTGG - Intergenic
1127115254 15:55720217-55720239 AAAAATACAAAGATTTAGCCGGG + Intronic
1127225694 15:56926150-56926172 AAAAATACACAGAATTAGCCAGG + Intronic
1127802113 15:62485750-62485772 ACAGACACACAGATTGAGCCAGG - Intronic
1127875286 15:63106608-63106630 AAAAATACAAAAATCCAGCCGGG - Intergenic
1128611997 15:69081531-69081553 CCAGCCACACAGATGCAGCCTGG - Intergenic
1129094867 15:73195400-73195422 AAAAACACACAGACGCAGCATGG - Intronic
1129512630 15:76136237-76136259 AATAATACACAGCTGCAGGCCGG - Intronic
1130232196 15:82105568-82105590 AAAGAAACACAGAGGTTGCCAGG + Intergenic
1130812399 15:87393699-87393721 AAAAATACACAAAAGTAGCCAGG + Intergenic
1131126356 15:89860843-89860865 ATAGAGAAACAGAGGCAGCCAGG + Intronic
1131732123 15:95293194-95293216 AAGGCTACTCAGATGTAGCCTGG - Intergenic
1132261873 15:100433073-100433095 AAAAATACAAAGAATCAGCCAGG + Intronic
1132516219 16:367379-367401 AAAGATACACACACACAGCCTGG + Exonic
1132812378 16:1807378-1807400 AAAAATACAAAAATGTAGCCGGG + Intronic
1132990894 16:2792786-2792808 AAAAATACAAAAATGTAGCCAGG + Intergenic
1133096340 16:3449212-3449234 AAAAATACAAAAATGTAGCCGGG + Intronic
1133947154 16:10358145-10358167 AAAGATAGAGGAATGCAGCCAGG - Intronic
1134309544 16:13063165-13063187 AAAAATACAAAAATGTAGCCGGG - Intronic
1135406927 16:22205422-22205444 AAAAATACAAAAAAGCAGCCGGG - Intergenic
1135587908 16:23684816-23684838 AAAGATACAAAAAAACAGCCGGG - Intronic
1135771163 16:25219629-25219651 TGAGATACACAGATGAAGTCAGG - Intronic
1136448901 16:30341142-30341164 AAAAATACACAAAAGTAGCCAGG + Intergenic
1137277686 16:46947360-46947382 AAAGATACAAAAATTTAGCCAGG - Intergenic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1138969847 16:62131241-62131263 AAAGATACAGACTTCCAGCCAGG - Intergenic
1139771891 16:69284410-69284432 TAAGACACACAAATGCAGCCTGG + Intronic
1140215855 16:73007605-73007627 AAAGATACAAAAAATCAGCCGGG - Intronic
1140434663 16:74936528-74936550 ACAGAAACCCAAATGCAGCCGGG + Intronic
1141169503 16:81682267-81682289 AAAGAAAAAAAGAAGCAGCCAGG + Intronic
1142407874 16:89901232-89901254 GAAGCTACCCAGATGCAGTCAGG - Intronic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1142835658 17:2584433-2584455 AAAGATACAAAAAAGTAGCCAGG - Intergenic
1142965864 17:3580719-3580741 AAAAATACACAGTGGAAGCCGGG + Intronic
1143082433 17:4391810-4391832 AAAAATACAATGCTGCAGCCGGG + Intergenic
1143318359 17:6050322-6050344 ATAAATATACATATGCAGCCGGG - Intronic
1143888999 17:10088009-10088031 AAAAATATATGGATGCAGCCTGG + Intronic
1143913487 17:10271718-10271740 AAAGGTAAAAAGATGCAGGCTGG + Intergenic
1143945604 17:10589349-10589371 AAAGATACACAAAATTAGCCGGG - Intergenic
1144544322 17:16178336-16178358 AAAAATACAAAGAATCAGCCGGG + Intronic
1145089354 17:19973906-19973928 AAAAATCCAAAAATGCAGCCGGG + Intronic
1145714836 17:27009524-27009546 CCAGACACACAGACGCAGCCTGG - Intergenic
1146086122 17:29831556-29831578 AAAGATAAACAGTTGCATTCTGG - Intronic
1147933891 17:44000361-44000383 AAAGGCACACAGATACACCCAGG - Intronic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1149716883 17:58799601-58799623 AAAAATACAAAAATGTAGCCAGG - Intronic
1149983939 17:61333045-61333067 AAACCTACACTGCTGCAGCCTGG + Intronic
1150195452 17:63293624-63293646 AAATATAAACAGCTGCAGCTAGG - Intronic
1150658840 17:67058288-67058310 AAAGACGCAAAGATCCAGCCAGG + Intergenic
1150921952 17:69493463-69493485 AAAAATACTCAGCTGCAGCTGGG + Intronic
1151275169 17:73028820-73028842 AAAAAAACACTGCTGCAGCCGGG + Intronic
1151563755 17:74885513-74885535 GAAGCTACGCAGATCCAGCCCGG + Intronic
1151924383 17:77183798-77183820 AAAGATAAACAGAAGCAGCAAGG - Intronic
1152063205 17:78094733-78094755 AAAGAACCACAGAAGCAGCCAGG - Intronic
1152367778 17:79866646-79866668 AAAAATACACAAATTAAGCCAGG - Intergenic
1153602531 18:6795427-6795449 GAAGGCACACAGCTGCAGCCTGG + Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154498207 18:14977983-14978005 ACAGATACAGAGATGATGCCAGG - Intergenic
1155917793 18:31573079-31573101 AAAGATACAGAAATGAAGCAGGG - Intergenic
1155951240 18:31915599-31915621 AAAAATACAAAAATGAAGCCGGG + Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1156507090 18:37604184-37604206 AAAGAAACACAGACTGAGCCTGG - Intergenic
1157576775 18:48748948-48748970 AGAGATGCAGAGATGCAGCCTGG - Intronic
1158599080 18:58841682-58841704 AAAAATACAAAAATGTAGCCAGG - Intergenic
1158629090 18:59096429-59096451 AAAGACAAACAGTTGCTGCCAGG + Intergenic
1159862694 18:73667970-73667992 AAAAATACAAAAATGCTGCCTGG + Intergenic
1160572561 18:79828082-79828104 AAAGATACAAAGAATTAGCCGGG - Intergenic
1160783307 19:888041-888063 AAAAATACAAAAAAGCAGCCGGG + Intronic
1161418396 19:4161070-4161092 AAAGATACAAAAAATCAGCCAGG - Intronic
1161738567 19:6006608-6006630 AAAAATACAAAGATTTAGCCGGG - Intronic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1161991783 19:7688514-7688536 AAAAATACAAAAATTCAGCCGGG - Intergenic
1162091404 19:8282475-8282497 AAAGATACAAAAAAGTAGCCAGG + Intronic
1162093640 19:8297328-8297350 AAAGATACAAAAAAGTAGCCAGG + Intronic
1162399035 19:10433546-10433568 AAAGACACAGAGATGCACACAGG + Intronic
1162510577 19:11115763-11115785 AAAAATACAAAAATGTAGCCAGG + Intronic
1162922040 19:13908914-13908936 AAAGAAAGAGAGATGGAGCCGGG - Intronic
1163470029 19:17490866-17490888 AAAAATACAGAAATGTAGCCTGG + Intronic
1163579494 19:18129952-18129974 AAAGAAATACACAAGCAGCCAGG + Intronic
1163591485 19:18196509-18196531 AAAGAAACACAGAGGCTGCCTGG - Exonic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1164341458 19:24405163-24405185 AAAAATACACAGAAGCATTCTGG + Intergenic
1164348697 19:27303315-27303337 AAAACTACACAGATGCATTCTGG + Intergenic
1164348707 19:27303485-27303507 AAAACTACACAGATGCATTCTGG + Intergenic
1165500824 19:36187796-36187818 AAAGATACAAAAAATCAGCCAGG - Intronic
1166058840 19:40311814-40311836 AAAAATACAAAAATGTAGCCAGG - Intergenic
1166723179 19:45009374-45009396 AAAGATACAAAGAGGTGGCCAGG - Intronic
1167382600 19:49147388-49147410 AAAAATAAACAAATACAGCCAGG + Intronic
1167865043 19:52318265-52318287 AAAGATACAAAAATTTAGCCAGG - Intronic
1168358610 19:55718975-55718997 AAAGATACAGATGTGCAGCTGGG - Intronic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
925995652 2:9290688-9290710 AAAGATACTGAGATCCTGCCAGG - Intronic
927179748 2:20436495-20436517 AAAGGCACACAGATGAAGTCTGG - Intergenic
927674692 2:25096644-25096666 AAAGACCCACAGAGCCAGCCAGG - Intronic
927802172 2:26111306-26111328 AAAGATACACAGATCTTGGCTGG + Intronic
928569393 2:32588192-32588214 AAAGATACAAAAATCTAGCCAGG + Intronic
929700016 2:44153957-44153979 AAATAAACACTGAAGCAGCCGGG + Intergenic
929869150 2:45743625-45743647 AAATGTACACAGATGTGGCCAGG - Intronic
929931849 2:46263416-46263438 AAACATACACAGATGCGGCCTGG + Intergenic
930759367 2:55016285-55016307 AAAAATACACATATGCGGCCAGG + Intronic
931122858 2:59239730-59239752 AAAGATAATCAGATGTTGCCAGG - Intergenic
931316782 2:61140491-61140513 AAAGAAACAGAGATGTAGCTGGG + Intergenic
931403518 2:61953663-61953685 AAAGAAAAATAAATGCAGCCAGG - Intronic
931744486 2:65280239-65280261 AAAGATACACAAAAATAGCCGGG + Intergenic
932247614 2:70208751-70208773 AAAGATACAAAAATTCAGCTGGG + Intronic
933239140 2:79899905-79899927 AAAGATAGAAAGATTCACCCTGG + Intronic
933267852 2:80201532-80201554 AAAAATACACAAATTTAGCCAGG - Intronic
933337860 2:80983276-80983298 AAAAAGACACAGATGGAACCTGG + Intergenic
933673184 2:85028648-85028670 AAAGATACAAAAAATCAGCCGGG - Intronic
933804405 2:85987683-85987705 AAAGTCACACAGCTGGAGCCAGG - Intergenic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
934726313 2:96622126-96622148 AAAATTAAACAAATGCAGCCAGG + Intronic
935088932 2:99875769-99875791 AGAGAAACCCACATGCAGCCTGG + Intronic
935116063 2:100137557-100137579 ACAGACACACAGAGGCATCCTGG + Intronic
936292542 2:111237475-111237497 AAAAATACAAAAATGTAGCCAGG - Intergenic
936929267 2:117770297-117770319 TATAATACACAGATGCAGGCAGG + Intergenic
937176017 2:119936161-119936183 AAAGATACACAAAATTAGCCGGG - Intronic
939612274 2:144326290-144326312 TAAAATACACAGACTCAGCCAGG + Intronic
939975713 2:148715192-148715214 AAAAATACAAAGAAGTAGCCGGG - Intronic
940494125 2:154403709-154403731 AAAGATACATAAAGGCAACCTGG - Intronic
942095990 2:172537074-172537096 AAAGTTACACAGATAGGGCCAGG - Intergenic
943952140 2:194144647-194144669 AAATCTACATTGATGCAGCCAGG + Intergenic
944205363 2:197152520-197152542 AAAGATACACACAGCCAGCAGGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945793396 2:214332717-214332739 AAAGATAAAAAGATGGAGCGTGG - Intronic
946649794 2:221879518-221879540 AAAGACACAGAGTGGCAGCCTGG + Intergenic
948055475 2:235006913-235006935 AAGGACACACAGATGCGGCGTGG - Intronic
948221750 2:236275425-236275447 AAAGATACAAAAATTTAGCCAGG + Intergenic
948494849 2:238341016-238341038 AAAAATACACATAAGAAGCCGGG - Intronic
1170559955 20:17548726-17548748 AAAAATACACAGTTGGAGACTGG - Intronic
1171032213 20:21687204-21687226 TAAAATACACAGATGAGGCCAGG - Intergenic
1171324133 20:24276088-24276110 TGAGAGACACAGAAGCAGCCTGG - Intergenic
1171736029 20:28786229-28786251 AAAAATACACAGAGGCATTCTGG - Intergenic
1173550510 20:43930001-43930023 AAAAATACTCAGAAGCAGCTGGG - Intronic
1173804649 20:45916284-45916306 AATGATACAAAGATGAAGCCTGG - Intergenic
1173874385 20:46360842-46360864 AAAAATCAACAAATGCAGCCGGG - Intronic
1173992296 20:47312805-47312827 AAAGAGAGAGAGGTGCAGCCCGG + Intronic
1174004488 20:47399711-47399733 ACAAATACACATATACAGCCAGG - Intergenic
1174842570 20:53914027-53914049 AAAGATAGATAGGTACAGCCAGG - Intergenic
1174849203 20:53975651-53975673 ATTAAAACACAGATGCAGCCAGG + Intronic
1174967446 20:55233743-55233765 AAATATAAAAAGATACAGCCGGG - Intergenic
1176217123 20:63953404-63953426 AGAAATACACACAGGCAGCCGGG + Intronic
1176700352 21:10040526-10040548 AAATATACACACATTCAGCCGGG + Intergenic
1176843188 21:13856700-13856722 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176844097 21:13863294-13863316 AAAGATGCACAGGTACAGCCTGG - Intergenic
1176845876 21:13876046-13876068 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176848611 21:13895601-13895623 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1177759252 21:25384171-25384193 AAAAATACAAAGAATCAGCCGGG - Intergenic
1178373398 21:32046720-32046742 AAAAATACACAAAATCAGCCGGG - Intergenic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1179462203 21:41544089-41544111 AGAAATACACAGTTTCAGCCAGG + Intergenic
1179781025 21:43701127-43701149 ACACACACACAGCTGCAGCCAGG + Intergenic
1180081872 21:45490841-45490863 AAAGGGAGACAGAGGCAGCCGGG + Exonic
1180126577 21:45794766-45794788 AAAAATACACAGAATGAGCCGGG + Intronic
1180399967 22:12406506-12406528 AAAGCTACACAGACGCATTCTGG + Intergenic
1180662622 22:17481953-17481975 AAAGATACAAAAAAGTAGCCGGG + Intronic
1180754915 22:18154734-18154756 AAAGATATAGAGATGAGGCCTGG - Intronic
1181123519 22:20688733-20688755 AAAAATACAAAAAAGCAGCCGGG + Intergenic
1181377295 22:22469690-22469712 AAAGATACACAGACACAGGTAGG - Intergenic
1181830043 22:25553302-25553324 AAAGATACAGATGAGCAGCCAGG + Intergenic
1182297617 22:29318883-29318905 AAAGAGACAGACATGCAGCTAGG + Intronic
1182558477 22:31141538-31141560 GAAGAGACTCAGATGGAGCCTGG - Intergenic
1184614827 22:45630916-45630938 AAAAATACAAAGAATCAGCCAGG + Intergenic
1184626265 22:45733437-45733459 AAAGTTACAAAGTTTCAGCCAGG + Intronic
1184714183 22:46271371-46271393 AAAGATACAAAAAATCAGCCGGG - Intronic
1185256469 22:49835870-49835892 AAAAATACACAAATATAGCCAGG + Intergenic
949277829 3:2307272-2307294 AAAAATACAAAAATGTAGCCGGG + Intronic
950287785 3:11758644-11758666 AAAAATACACAGATCTGGCCGGG - Intergenic
950673887 3:14543147-14543169 AAGGAAACAGAGATACAGCCAGG + Intergenic
950687676 3:14630204-14630226 AAAAATACAAAAATTCAGCCGGG + Intergenic
950894119 3:16432539-16432561 AAAGAAACCAATATGCAGCCAGG + Intronic
951874958 3:27413982-27414004 AAAAATACACAGTTGAGGCCAGG + Intronic
951965152 3:28373768-28373790 AAAGACATACAAATGGAGCCAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953514071 3:43572582-43572604 CCAGATACACAGAAGCAGGCTGG + Intronic
954271051 3:49509435-49509457 AAAGATACACACATCAAGTCTGG + Intronic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
958717584 3:97804189-97804211 AAATCTGCACTGATGCAGCCAGG + Intergenic
959307558 3:104688351-104688373 AAAGATAGACATATACGGCCAGG - Intergenic
959583414 3:108004325-108004347 AGACACACACAGATGCAGGCAGG + Intergenic
960093703 3:113667582-113667604 AAAAATACATACATGGAGCCGGG + Intronic
960678481 3:120221822-120221844 AAAAATACAAAAATACAGCCAGG - Intronic
960904278 3:122583958-122583980 AAAGAAACTCAGAAGAAGCCTGG - Intronic
962223605 3:133585653-133585675 AAAAATACAAAGATGTAGCGGGG - Intronic
964323323 3:155520353-155520375 AGAGATATACACATGCAGACTGG + Intronic
965231641 3:166061282-166061304 AAAAATAAACAGTGGCAGCCAGG + Intergenic
965600596 3:170450657-170450679 AGAAATACAAAAATGCAGCCGGG - Intronic
966465632 3:180228267-180228289 AAGGAGCCACAGATGCTGCCTGG + Intergenic
967554978 3:190846066-190846088 AAAAATACACAAATTTAGCCAGG + Intergenic
968410228 4:384143-384165 AAAAACACACAGTTCCAGCCTGG + Intronic
969458468 4:7314498-7314520 AAAAATACAAAAATGTAGCCGGG - Intronic
969547027 4:7836605-7836627 AAAGATACAGAAAATCAGCCAGG - Intronic
970362369 4:15322673-15322695 AAAGACACACAGAGGTAGCTGGG - Intergenic
971665803 4:29482800-29482822 AAAGATACAAAAAATCAGCCAGG + Intergenic
972162686 4:36244953-36244975 AAATTTACATAGAAGCAGCCTGG - Intergenic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
973623208 4:52747740-52747762 AAAGAAACTGAGATGCAGCCGGG + Intronic
974717641 4:65690704-65690726 AATCATACACAGATGCACACAGG + Intergenic
975114417 4:70663349-70663371 AAAAATACAAAGATCTAGCCAGG - Intronic
975194081 4:71502255-71502277 AAAGATAAACAAAATCAGCCGGG - Intronic
975989835 4:80247273-80247295 ACCAACACACAGATGCAGCCTGG + Intergenic
976592355 4:86861604-86861626 AAAGATACAAAAAAGTAGCCGGG + Intergenic
976947766 4:90791553-90791575 AAAGATACACACTTTTAGCCGGG + Intronic
977182726 4:93897650-93897672 AAAGAAACATAGATGCATACTGG - Intergenic
977254114 4:94721593-94721615 CCAGATACACAGATGCAAGCTGG + Intergenic
977825330 4:101524410-101524432 AAATCTGCACAGATGCATCCAGG - Intronic
977984893 4:103371609-103371631 GAAGATACAGAAATGCATCCAGG - Intergenic
978180983 4:105795551-105795573 ATAGATACACACATGCACACAGG - Intronic
978458996 4:108929543-108929565 AAATATAAAAAGATGCAGGCTGG + Intronic
978817210 4:112921318-112921340 AATAATACACAGAATCAGCCGGG - Intronic
979045223 4:115854028-115854050 AAAGGCACACAGTGGCAGCCTGG + Intergenic
979179147 4:117703794-117703816 AAATATACCCAGATGCAGGCTGG + Intergenic
979749043 4:124253402-124253424 AAAGATTCACAGATTTTGCCAGG - Intergenic
980372769 4:131899305-131899327 AAATATACACACATTCGGCCGGG + Intergenic
980451187 4:132974113-132974135 AGAGATAGAAAGAGGCAGCCAGG + Intergenic
981404627 4:144353796-144353818 AGAAATACACAGATGTAGACGGG + Intergenic
981427947 4:144625613-144625635 AAAGACACACAGAAGCTGGCAGG + Intergenic
981723410 4:147824021-147824043 AAAAAAACACAGATTCAGGCTGG + Intronic
981980647 4:150786934-150786956 AAAAATACTCAGATTCGGCCAGG + Intronic
984721916 4:182980441-182980463 AAAGATACACAACTGCAGAATGG + Intergenic
984996124 4:185432005-185432027 AAAAATAAACAGATGCTACCTGG + Exonic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
985483946 5:138490-138512 AAAGAGACACACATGCAGATGGG - Intergenic
986529397 5:8720095-8720117 TAAGATATAGAGAGGCAGCCGGG + Intergenic
987827639 5:23054354-23054376 GAAGGTATCCAGATGCAGCCTGG + Intergenic
990685965 5:58301226-58301248 AAAAATACACAGATCTGGCCGGG - Intergenic
992553330 5:77880153-77880175 GAGGATTCACTGATGCAGCCAGG + Intergenic
993206987 5:84894826-84894848 GAAGGTACAGAGATGCTGCCTGG + Intergenic
994761252 5:103856960-103856982 AAAAATACAAAAAAGCAGCCAGG - Intergenic
995589914 5:113688571-113688593 AAAAATACAAAAATTCAGCCAGG - Intergenic
995737129 5:115313298-115313320 AAAGTTACACAGATGGTTCCAGG - Intergenic
995997520 5:118319719-118319741 AAAGATCCACAGAAGTGGCCAGG + Intergenic
996489264 5:124073474-124073496 TAAAACACACAGATGCAGCCTGG - Intergenic
997230162 5:132236576-132236598 AAAAATAGAGAGAGGCAGCCTGG - Intronic
997324027 5:133004647-133004669 AAAGATACAAAAAATCAGCCGGG - Intronic
997737287 5:136222927-136222949 AAAGATACCTGGATGCAGGCTGG - Intronic
998457209 5:142282579-142282601 AAAAATACAAAAATTCAGCCAGG + Intergenic
1000292042 5:159879509-159879531 AATGAGTCACAGAGGCAGCCAGG - Intergenic
1000685039 5:164238111-164238133 AAAAATACAAAAATGTAGCCGGG + Intergenic
1000784976 5:165532029-165532051 GAACATATACAGATGCACCCAGG - Intergenic
1000925160 5:167185118-167185140 AAAGATAGATAGATGAGGCCAGG - Intergenic
1002076917 5:176713762-176713784 ACAGATAAACAGAAGGAGCCTGG - Intergenic
1003419157 6:5940194-5940216 AAAGATACAAAAAAGTAGCCGGG + Intergenic
1003658562 6:8038643-8038665 AAAAATACAAAGAAGTAGCCAGG - Intronic
1004367744 6:15026352-15026374 AAAGATAGACAGATAAGGCCGGG + Intergenic
1004470270 6:15922723-15922745 CAAGATACACAGAAGTTGCCCGG + Intergenic
1005223315 6:23613344-23613366 GAAGATATACAGAGGGAGCCAGG + Intergenic
1005903857 6:30243339-30243361 AAAAATACAAAAATGAAGCCGGG + Intergenic
1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG + Intronic
1006612382 6:35302020-35302042 TAAAAGACACAGATCCAGCCAGG - Intronic
1007964362 6:45989870-45989892 ATAGATACACAGAAACACCCAGG - Intronic
1009045998 6:58237921-58237943 AAAGAAACCCAGATGGTGCCTGG - Intergenic
1009221808 6:60992234-60992256 AAAGAAACCCAGATGGTGCCTGG - Intergenic
1009620460 6:66068781-66068803 AAAGACACACAGATTCATTCAGG - Intergenic
1010164905 6:72904301-72904323 AAAGATACAGAACTGCAGCATGG - Intronic
1011278635 6:85654717-85654739 AAAAATACACAGAATTAGCCGGG - Intergenic
1011841855 6:91510805-91510827 AAAAATACAAAAATGTAGCCAGG + Intergenic
1012626363 6:101408346-101408368 ACACATACACACATGCAGCAGGG + Intronic
1012781420 6:103563252-103563274 AAAAATACACATATATAGCCAGG - Intergenic
1013010539 6:106116036-106116058 AAAGATACCAAGATCCGGCCGGG - Intergenic
1013266665 6:108506366-108506388 AAAGATACACAAAGTTAGCCAGG - Intronic
1013643282 6:112109368-112109390 AAAGAAACACAAAGCCAGCCAGG - Exonic
1015123374 6:129725414-129725436 AAGGATAAACAGATGAATCCAGG - Intergenic
1015704777 6:136076173-136076195 CAAAATAAACTGATGCAGCCGGG + Intronic
1017165301 6:151402320-151402342 AAAGATTCAAAGATGGATCCTGG + Intergenic
1017179913 6:151541510-151541532 AAAGAGATACAAATCCAGCCAGG - Intronic
1017360061 6:153557897-153557919 AAAGATAAACATATACAGTCAGG + Intergenic
1018008570 6:159647312-159647334 AAAGAGAGAGAGATGAAGCCTGG + Intergenic
1018154987 6:160977404-160977426 GAAGAGACACAGCTGCAGACAGG + Intergenic
1018170456 6:161139706-161139728 AGAGATACACAGGTGCCACCGGG + Intronic
1019753899 7:2753715-2753737 AAACATACACTTATACAGCCCGG - Intronic
1020004901 7:4777546-4777568 AAAGATACAAAAAATCAGCCGGG - Intronic
1020864339 7:13538083-13538105 AAAGATAAGAAGTTGCAGCCAGG + Intergenic
1021570692 7:22062168-22062190 AAAGACATACAGGTGCAGCCAGG - Intergenic
1022723635 7:32962099-32962121 AAAGAATCACAGACTCAGCCAGG + Intronic
1024311652 7:47975016-47975038 AAAGATACAATGTTCCAGCCGGG + Intronic
1025061197 7:55809991-55810013 AAAAATACACAAAATCAGCCTGG - Intronic
1026100536 7:67380559-67380581 AAAGATAAACACATGCATGCAGG - Intergenic
1026172309 7:67964725-67964747 TAAGAAACACAGATTCAGCTGGG + Intergenic
1026664023 7:72326369-72326391 GAAGAAACAGAGATGTAGCCAGG - Intronic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027111857 7:75446342-75446364 AAAAATACAAAAATGTAGCCAGG - Intronic
1027284087 7:76630873-76630895 AAAAATACAAAAATGTAGCCAGG - Intergenic
1028756767 7:94444572-94444594 AAAGATGCAGAGATGCATTCAGG + Intergenic
1029018595 7:97340344-97340366 AAAGATACACAGAAGCCTCTGGG - Intergenic
1029794515 7:102879865-102879887 AAAAATACACAGAATTAGCCAGG - Intronic
1029951766 7:104593988-104594010 AAAGATACACAGTGGCAAACTGG - Intronic
1030051345 7:105540555-105540577 AAAAATACAAAAATTCAGCCGGG - Intronic
1030328624 7:108249027-108249049 AATGATTCATAGATGCAGCTGGG - Intronic
1032057603 7:128696312-128696334 GAAGTTCCACAGAAGCAGCCAGG - Intergenic
1032353167 7:131184840-131184862 AAAGATGCACACACCCAGCCAGG + Intronic
1032371829 7:131363190-131363212 AAAAATTCACAAATGCGGCCTGG - Intronic
1033028655 7:137803093-137803115 AAAGATCCATAAATGCATCCTGG + Intronic
1033094722 7:138420352-138420374 AAAGATACAAAAAAGTAGCCAGG - Intergenic
1033158577 7:138977575-138977597 AAAGATGCAGAAATCCAGCCTGG + Intronic
1033339824 7:140483311-140483333 AAATCTACACTGAGGCAGCCCGG + Intergenic
1033787177 7:144746742-144746764 AAAGAGAGACAGATGAAGACTGG + Intronic
1034076433 7:148235978-148236000 AAAGCTGCACAGCTGTAGCCAGG - Intronic
1034130696 7:148714013-148714035 AAATATACACACATGCAGCCAGG - Intronic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1035007062 7:155672593-155672615 AAAGATACACAAAATTAGCCGGG + Intronic
1035146584 7:156823793-156823815 TATAATACACACATGCAGCCGGG + Intronic
1039634287 8:39146025-39146047 AAAAATACTCTGAAGCAGCCAGG - Intronic
1040285847 8:46099998-46100020 CAAGAGACACAGAGGCACCCTGG - Intergenic
1040810075 8:51441904-51441926 AATAATACACACATGAAGCCTGG + Intronic
1041368422 8:57133323-57133345 AAAGATACAAAGATACTGGCCGG + Intergenic
1041653725 8:60327596-60327618 AAAGATACACAAATGAACACAGG - Intergenic
1042481542 8:69308988-69309010 AAACATACACAATTCCAGCCTGG - Intergenic
1042676611 8:71328532-71328554 AAAGATACACAGGAGAAGCGAGG - Intronic
1044516809 8:93148447-93148469 AAAGATTCAGAGATGTAGCTGGG - Intronic
1044907432 8:97019423-97019445 AAAGATACAGAAATGCAGAATGG + Intronic
1045065295 8:98438659-98438681 ATAGATACACACATGCACACCGG - Intronic
1045722120 8:105124901-105124923 AATGTTGCACAGATGCATCCAGG + Intronic
1046003602 8:108451040-108451062 AAAGATACAAAAAATCAGCCAGG + Intronic
1046909524 8:119610740-119610762 AAAGATACAAAAAACCAGCCAGG + Intronic
1047447718 8:124934383-124934405 AAAGATACAGAGATATGGCCGGG + Intergenic
1047948993 8:129912554-129912576 AAAGATGCACAGATGCACTCTGG + Intronic
1048172694 8:132122917-132122939 AAAGCTACAAAGAAGCAGACAGG - Exonic
1048288091 8:133158094-133158116 AAAGACACACAGCTTGAGCCTGG + Intergenic
1048374441 8:133810699-133810721 GAAGCTACACAGATTCAGCAAGG + Intergenic
1048774642 8:137932357-137932379 AAAAATACAAAAATTCAGCCTGG - Intergenic
1048856788 8:138693225-138693247 CCAAACACACAGATGCAGCCAGG - Intronic
1048921224 8:139231886-139231908 AAAAATACACTGATACGGCCGGG + Intergenic
1050102732 9:2135700-2135722 AAAAATACAAAGAAGTAGCCAGG - Intronic
1050163962 9:2745264-2745286 CTAGGTTCACAGATGCAGCCAGG - Intronic
1050170954 9:2816033-2816055 AAAGATACACACATGAAGTAGGG + Intronic
1050440228 9:5654211-5654233 AAAAATACACACTTGCAGCCTGG - Intronic
1051645353 9:19262725-19262747 AAAAATACAAAAATGTAGCCAGG - Intronic
1051702864 9:19843107-19843129 AAAAATAAAGATATGCAGCCAGG + Intergenic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053068806 9:35088561-35088583 AAAGGTTCTCAGGTGCAGCCAGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053637555 9:40027348-40027370 AAATATACACACATTCGGCCGGG + Intergenic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053768527 9:41437891-41437913 AAATATACACACATTCAGCCGGG - Intergenic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054318343 9:63623918-63623940 AAATATACACACATTCGGCCGGG + Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054547194 9:66349372-66349394 AAATATACACACATTCGGCCGGG - Intergenic
1055294900 9:74824309-74824331 AAAAATACAAAAAAGCAGCCGGG - Intronic
1055914948 9:81391483-81391505 AAACATACAAAGCTACAGCCCGG + Intergenic
1056225989 9:84495898-84495920 AAAAAAAGACAGACGCAGCCGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056995912 9:91459176-91459198 TAAGATACACAGAACCAGGCAGG - Intergenic
1057093162 9:92278942-92278964 AAGGGTACACAGATGCATCAAGG - Intronic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057858054 9:98617395-98617417 AAGGAGACGCAAATGCAGCCTGG + Intronic
1057873366 9:98734339-98734361 AATGATACACAGCTGCACCGGGG - Exonic
1058169130 9:101657871-101657893 AAAGAGACACAGATGCAGGCAGG - Intronic
1058308216 9:103469622-103469644 AAAGATACAGAATTGCAGACTGG - Intergenic
1058469398 9:105261746-105261768 AGAGAAACACAGATTCAGCTGGG - Intronic
1059517538 9:114909701-114909723 AAAGATAGACAGGTGCAGCTGGG - Intronic
1059926738 9:119217255-119217277 AAAGATATACAGCTGCCGGCTGG + Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061292325 9:129658072-129658094 AAGGATACAGAGAAGCTGCCAGG + Intergenic
1061424840 9:130492464-130492486 ACAGACACACAGATGCAGAGTGG - Intronic
1062164056 9:135096917-135096939 ATAGATACAGATGTGCAGCCAGG + Intronic
1062729881 9:138102936-138102958 AAAGACACAGTGAGGCAGCCGGG - Intronic
1202785363 9_KI270719v1_random:10591-10613 AAATATACACACATTCGGCCGGG + Intergenic
1203357188 Un_KI270442v1:166804-166826 AAAAATACACAGAAGCATTCTGG + Intergenic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1185495011 X:547893-547915 AAAAATACAAAAATTCAGCCGGG + Intergenic
1185729660 X:2451267-2451289 AAAGGTGCACAAAGGCAGCCAGG + Intronic
1185730361 X:2456649-2456671 AAAGGTGCACAAAGGCAGCCAGG + Intronic
1185731853 X:2467997-2468019 AAAGGTGCACAAATGCAGCCAGG + Intronic
1185732627 X:2473650-2473672 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1185733225 X:2477872-2477894 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1186830295 X:13383469-13383491 AAATCTGCACTGATGCAGCCAGG - Intergenic
1187316948 X:18205443-18205465 AAAAATACAAAAATGTAGCCAGG + Intronic
1188016722 X:25114481-25114503 ATAAATAAACAAATGCAGCCGGG - Intergenic
1190017004 X:46836012-46836034 AAGAAAACACAGAAGCAGCCTGG + Intergenic
1190515674 X:51221553-51221575 AAAGACATAGAGATCCAGCCAGG + Intergenic
1191629331 X:63304283-63304305 AAAAATAGGCAGATGCGGCCGGG - Intergenic
1193170468 X:78329843-78329865 AAAGATAAAGAGATGAAGCAAGG - Intergenic
1193430565 X:81398497-81398519 AAAGATAAAATGATACAGCCAGG + Intergenic
1193671104 X:84387766-84387788 AAAGATACAGAGTTGCACGCTGG - Intronic
1195492431 X:105486929-105486951 AAAAATACAAAAAAGCAGCCAGG + Intronic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1196675564 X:118417121-118417143 AAAGATACAGAGATGCAGAATGG - Intronic
1196917920 X:120557999-120558021 AAAACTACACAGATGAAACCTGG - Exonic
1197132638 X:123022194-123022216 AAAGATACAGAGCTGCAGAATGG + Intergenic
1198277498 X:135110291-135110313 AAAGATACAGAGTGGCAGGCTGG - Intergenic
1198433423 X:136590920-136590942 CAAGATACTCAACTGCAGCCTGG + Intergenic
1198638022 X:138721629-138721651 AAAGATACAGAGATGGAACTAGG - Intronic
1198892223 X:141410555-141410577 AAAAATACACAGAATTAGCCGGG + Intergenic
1200057160 X:153467710-153467732 AATGGCACACAGGTGCAGCCTGG + Intronic
1200271363 X:154687471-154687493 AAAGATACAAAAATTTAGCCAGG + Intronic
1201564778 Y:15354598-15354620 AAAAATACAAAAATCCAGCCAGG + Intergenic