ID: 1142586662

View in Genome Browser
Species Human (GRCh38)
Location 17:978869-978891
Sequence TCCGCGGGGGTCGGCGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 493}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142586647_1142586662 0 Left 1142586647 17:978846-978868 CCCTCCCCTCCCCACTGTGGGAA 0: 1
1: 0
2: 6
3: 56
4: 495
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586650_1142586662 -5 Left 1142586650 17:978851-978873 CCCTCCCCACTGTGGGAATCCGC 0: 1
1: 0
2: 2
3: 18
4: 184
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586643_1142586662 4 Left 1142586643 17:978842-978864 CCTCCCCTCCCCTCCCCACTGTG 0: 2
1: 2
2: 36
3: 356
4: 2711
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586654_1142586662 -9 Left 1142586654 17:978855-978877 CCCCACTGTGGGAATCCGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586649_1142586662 -4 Left 1142586649 17:978850-978872 CCCCTCCCCACTGTGGGAATCCG 0: 1
1: 0
2: 0
3: 17
4: 158
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586638_1142586662 30 Left 1142586638 17:978816-978838 CCACGGGCGGGGGGCGTGCGCCC 0: 1
1: 0
2: 1
3: 35
4: 208
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586641_1142586662 6 Left 1142586641 17:978840-978862 CCCCTCCCCTCCCCTCCCCACTG 0: 2
1: 20
2: 465
3: 3480
4: 8496
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586642_1142586662 5 Left 1142586642 17:978841-978863 CCCTCCCCTCCCCTCCCCACTGT 0: 1
1: 6
2: 127
3: 1327
4: 6664
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586651_1142586662 -6 Left 1142586651 17:978852-978874 CCTCCCCACTGTGGGAATCCGCG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586656_1142586662 -10 Left 1142586656 17:978856-978878 CCCACTGTGGGAATCCGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586640_1142586662 9 Left 1142586640 17:978837-978859 CCTCCCCTCCCCTCCCCTCCCCA 0: 28
1: 1826
2: 3558
3: 7077
4: 15007
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586646_1142586662 1 Left 1142586646 17:978845-978867 CCCCTCCCCTCCCCACTGTGGGA 0: 1
1: 0
2: 17
3: 67
4: 686
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586648_1142586662 -1 Left 1142586648 17:978847-978869 CCTCCCCTCCCCACTGTGGGAAT 0: 1
1: 0
2: 5
3: 58
4: 417
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493
1142586639_1142586662 10 Left 1142586639 17:978836-978858 CCCTCCCCTCCCCTCCCCTCCCC 0: 1709
1: 3385
2: 5750
3: 8327
4: 22416
Right 1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG 0: 1
1: 0
2: 3
3: 71
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142586662 Original CRISPR TCCGCGGGGGTCGGCGGCGG AGG Intronic
900349747 1:2228689-2228711 GGCGCGCGGGGCGGCGGCGGGGG + Exonic
901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG + Exonic
901056030 1:6448977-6448999 TCCGGCAGGGGCGGCGGCGGCGG - Exonic
901059638 1:6466074-6466096 GCCGCGGGGCTGCGCGGCGGTGG - Exonic
901086216 1:6613800-6613822 GCTGCAGGGGGCGGCGGCGGCGG - Exonic
901455321 1:9359845-9359867 GCCGGGGGGGTGGGTGGCGGGGG + Intronic
903115689 1:21176736-21176758 TCCTCATGGGCCGGCGGCGGGGG + Exonic
903226905 1:21898930-21898952 TCAGCGGGTGGCGGCGGGGGTGG + Intronic
903324738 1:22563446-22563468 CCCGCCCGGGGCGGCGGCGGCGG + Intergenic
903767940 1:25746799-25746821 TCGGCGGGGGAGGGGGGCGGGGG + Intronic
903907390 1:26696449-26696471 TCCGAGGGCGGCGGCGGCGGCGG - Exonic
903925137 1:26826634-26826656 GCCGCGGCGGGCGGTGGCGGCGG + Intergenic
905151456 1:35931098-35931120 CCCGGGCAGGTCGGCGGCGGCGG + Exonic
905414386 1:37794396-37794418 TCCGCGGTGCGGGGCGGCGGCGG - Exonic
905449166 1:38046232-38046254 TACCCGGGGGGCGGCGGCGGCGG - Exonic
905584339 1:39105323-39105345 GCAGCGGCGGGCGGCGGCGGCGG - Intronic
908131762 1:61082049-61082071 TCCGCGGAGGTCTGCAGCGGGGG + Intronic
908242413 1:62198521-62198543 TCGGCGGGGTGGGGCGGCGGCGG - Intronic
908473923 1:64470529-64470551 ATCGCGGGGCTCCGCGGCGGTGG - Intergenic
910163395 1:84298424-84298446 TCGGCGGGGGTCGGAGGGGCGGG - Exonic
910237550 1:85050222-85050244 TTTGCGGGGGTGGGGGGCGGGGG + Intronic
910758862 1:90716816-90716838 TGCTGGGGGGGCGGCGGCGGCGG + Exonic
911618377 1:100038681-100038703 TCCGCGGGGCCTGGCGGCGAAGG - Intronic
914730393 1:150364665-150364687 TCCTCTGGCGGCGGCGGCGGCGG - Intronic
914889769 1:151612289-151612311 TGCGCCGGGAACGGCGGCGGGGG + Exonic
915070516 1:153261775-153261797 TCCTCTGGAGGCGGCGGCGGCGG + Exonic
915325321 1:155078911-155078933 TCGGGGGGCGGCGGCGGCGGCGG + Exonic
915616898 1:157045945-157045967 GCCGCGGCGGCCGGGGGCGGGGG + Intergenic
916922680 1:169485721-169485743 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
919916971 1:202144776-202144798 GCCGCGAGGGAGGGCGGCGGCGG - Intergenic
919917020 1:202144916-202144938 TCCGCAGGCTTCAGCGGCGGGGG + Intergenic
920135988 1:203769771-203769793 TGCGGGGGGGGGGGCGGCGGGGG + Intronic
922526676 1:226309348-226309370 TCGGCCGGAGGCGGCGGCGGAGG - Exonic
922749614 1:228064414-228064436 TCCGGGGGGGTTGGGGGCTGGGG - Intergenic
923141457 1:231163732-231163754 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
923141459 1:231163735-231163757 GCCTCGGCGGGCGGCGGCGGCGG - Exonic
923783010 1:237042463-237042485 CCCGCGGAGCTCGGCGGCGGCGG - Exonic
924289721 1:242524713-242524735 TCCCGGGGCGGCGGCGGCGGCGG + Intergenic
1063115063 10:3067344-3067366 TACGCGGGGGTCGTCGTAGGTGG - Intronic
1064028803 10:11869990-11870012 GCCGCGGGGGACGCCGGCGAGGG + Exonic
1064254042 10:13729088-13729110 GCCGCGGGGGCGGGCGGGGGCGG - Intronic
1064981871 10:21173844-21173866 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1065024207 10:21526069-21526091 TCCCCCGGGGCTGGCGGCGGGGG - Intergenic
1065214945 10:23439726-23439748 GCCGGGCGGGCCGGCGGCGGCGG - Exonic
1065520531 10:26567159-26567181 TCATCGAGGGGCGGCGGCGGTGG - Exonic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065712871 10:28533651-28533673 GCGGCGGGGGGCGGCGGCGGGGG + Intronic
1065712949 10:28533902-28533924 CCCGCGGGGAGGGGCGGCGGGGG + Intronic
1067972722 10:50991327-50991349 TTCTCGGGCGGCGGCGGCGGCGG - Intergenic
1069486553 10:68827511-68827533 TGCGCGCGGGTCCGCGGCGCTGG - Intergenic
1070032612 10:72692191-72692213 TCCTCTCGGGGCGGCGGCGGCGG + Exonic
1072710791 10:97714469-97714491 CCCGCGCGGGGCGGCGGCGGGGG - Exonic
1072915539 10:99535509-99535531 TACCCGGCGGGCGGCGGCGGCGG + Exonic
1072915542 10:99535512-99535534 CCGGCGGGCGGCGGCGGCGGCGG + Exonic
1073147811 10:101292057-101292079 CCCGCGGGGGCGGGAGGCGGTGG - Intergenic
1073196440 10:101695150-101695172 TCCTCCCGGGGCGGCGGCGGTGG - Exonic
1073268068 10:102240494-102240516 TGCGATGGGGTCGGCTGCGGTGG - Intronic
1073363297 10:102917695-102917717 TCCGCCGGGGTAAGCGGCGTCGG - Intergenic
1073392782 10:103193104-103193126 TCCCTGGGGGCCGGGGGCGGGGG + Intronic
1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG + Intergenic
1073812289 10:107164423-107164445 GCCCCGGGCGTCTGCGGCGGCGG - Exonic
1074618592 10:115093820-115093842 CCGGCGGGCGGCGGCGGCGGGGG + Exonic
1075697484 10:124447622-124447644 GCGGCGGGGGGCGGCGGCGGCGG - Exonic
1075816707 10:125270291-125270313 TGGGCAGGGGACGGCGGCGGGGG + Intergenic
1076372517 10:129964472-129964494 TCGGTGGCGCTCGGCGGCGGCGG - Intergenic
1076554276 10:131311788-131311810 TCCGGGGGCGGCGGCGGCGCGGG - Intergenic
1076877763 10:133224991-133225013 TCCCCAGGGTTCGGGGGCGGAGG - Exonic
1077103847 11:833447-833469 CCGGGCGGGGTCGGCGGCGGCGG + Intronic
1077124226 11:925374-925396 TCCGCGGGGGCCGGGGCGGGAGG - Intronic
1077214543 11:1389990-1390012 GGCGCGGGCCTCGGCGGCGGCGG + Intronic
1077214582 11:1390113-1390135 GACGCGGGGGGCGGCGGCGCGGG + Intronic
1078057408 11:8019255-8019277 TCCGCGGGCGGCGGCGGCGCTGG - Intronic
1079450448 11:20596735-20596757 TCCGCGGAGGGCGGGGGCGGAGG + Intergenic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1081699967 11:45146776-45146798 TCCGCGGGGGCCGCCAGCCGAGG + Intronic
1081807901 11:45900159-45900181 TCTGCGGGCGGCGGCGGCGCGGG + Exonic
1081831512 11:46119973-46119995 CCCGCGGCCGCCGGCGGCGGGGG + Intronic
1081969147 11:47186309-47186331 GACGCGCGGGTAGGCGGCGGCGG - Intronic
1082022470 11:47546253-47546275 TGGGCGGGGGCCGGGGGCGGGGG + Intronic
1083272923 11:61581021-61581043 TCGGCGCTGTTCGGCGGCGGCGG - Intronic
1083644748 11:64165787-64165809 GGCGTGGGGGGCGGCGGCGGTGG - Exonic
1083659800 11:64246771-64246793 TCCGCGCGGCTCCGCGGCGAGGG + Exonic
1083672188 11:64305760-64305782 GCCGCGGGGGTGGGCGGGCGGGG + Intronic
1083945164 11:65919365-65919387 TCCGCGGGAAACGGCGGGGGCGG + Exonic
1084021346 11:66420070-66420092 TCCCCGCGGGCCGGGGGCGGGGG - Intergenic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084275633 11:68049746-68049768 TCCGCAGGCGGCGGCGGTGGCGG - Exonic
1084284083 11:68120722-68120744 GCCGGGGGGGTCGGGGGCCGGGG - Intronic
1084284162 11:68120939-68120961 TCTGCGGGCGGCTGCGGCGGCGG + Exonic
1084284260 11:68121304-68121326 GGCGCGCGGGGCGGCGGCGGCGG + Intronic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1085011107 11:73142251-73142273 TCCGCCGGGAGCGGCGGCGCAGG - Exonic
1085050502 11:73377684-73377706 TGCGCGGGGGAGGGGGGCGGGGG - Intronic
1086322722 11:85667199-85667221 TGGGTGGGGGTTGGCGGCGGGGG - Intronic
1088406042 11:109480269-109480291 TGAGCGGGGGGCGGGGGCGGGGG - Intergenic
1089432648 11:118436555-118436577 ACCACCGGGGGCGGCGGCGGCGG + Exonic
1089432652 11:118436558-118436580 ACCGGGGGCGGCGGCGGCGGGGG + Exonic
1091286822 11:134412441-134412463 TCCGCGGGGGACGGTGCCGGGGG - Intergenic
1091434231 12:460572-460594 GGCGCGGGGGTGGGCGGCGGCGG + Intronic
1091759457 12:3077382-3077404 TCCGCTGGCGGCGGCGGCGGCGG + Exonic
1091915659 12:4270658-4270680 GGCGCGGGGGTGGGGGGCGGCGG - Intergenic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1095917616 12:47495986-47496008 TCTTGGGGGGTGGGCGGCGGAGG - Intergenic
1096774399 12:53955350-53955372 TACGCGGCGGGCGGCGGCGGTGG + Exonic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096848168 12:54419123-54419145 GCAGCGGGGGTCGGCGCCGGGGG + Exonic
1097107673 12:56634960-56634982 GCCGCAGGCGGCGGCGGCGGCGG + Intronic
1097264418 12:57737512-57737534 TCCCCCGGCGGCGGCGGCGGTGG + Exonic
1097664803 12:62466739-62466761 GCCGCCGGGGTTGGCCGCGGCGG + Intergenic
1097902163 12:64883882-64883904 TCACGGGGGGTCGGGGGCGGGGG + Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100423410 12:94459802-94459824 TCCGAGGGCGGCGGCGGCGGCGG + Exonic
1100632203 12:96400227-96400249 TCCGCGCGGCTCGTCGGCGCGGG - Exonic
1102521269 12:113478726-113478748 TCCGCGGCGGTGGGCGCCTGGGG - Intergenic
1103764592 12:123271456-123271478 CCCGCGGAGGCCGGGGGCGGGGG - Intronic
1104373913 12:128247521-128247543 CCCACGGGGGTCGGGGGTGGGGG - Intergenic
1104376169 12:128267073-128267095 GTCGCGGGGCTCGGCGGGGGCGG + Intergenic
1104983385 12:132583612-132583634 TGCGCCGAGGGCGGCGGCGGCGG - Exonic
1106242876 13:27924564-27924586 CCTCCGGGGGGCGGCGGCGGCGG - Exonic
1106478028 13:30114800-30114822 GCTGCGGGAGGCGGCGGCGGCGG + Intergenic
1106517161 13:30465389-30465411 CCGGCGCGGCTCGGCGGCGGCGG - Intronic
1107467642 13:40665137-40665159 TCCGCCGGGCGCGGCGGGGGAGG - Intronic
1108227468 13:48303979-48304001 TCAGGAGGGGGCGGCGGCGGCGG - Exonic
1108292705 13:48976572-48976594 TCCGGAGGGCTCGGGGGCGGGGG + Intronic
1109284853 13:60397592-60397614 TCCCCTGGAGGCGGCGGCGGCGG + Intronic
1110219550 13:73059038-73059060 CTCGCGGAGGTCGGCGGTGGCGG + Exonic
1110318511 13:74135308-74135330 CCCGCGGGGCCCGGGGGCGGCGG + Intergenic
1110596569 13:77326714-77326736 TCCTCGGGGCTCGGCGGGGACGG - Intronic
1110630151 13:77698100-77698122 GGCGCGGCGGGCGGCGGCGGCGG - Intronic
1110705922 13:78602145-78602167 GGCCCGGGGGGCGGCGGCGGCGG - Exonic
1110705971 13:78602250-78602272 GGCGCGGCGGCCGGCGGCGGCGG - Exonic
1110712511 13:78665300-78665322 TGCGCGGGGGGTGGGGGCGGGGG - Intergenic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112290893 13:98143362-98143384 CCCGCGGGCGGCGGCGGCGCGGG - Intronic
1112494762 13:99896033-99896055 TCCGCAGGGCTCGGCGTCTGCGG - Exonic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1113201064 13:107867592-107867614 CGCGCGGGGGCGGGCGGCGGCGG + Intergenic
1113378125 13:109782935-109782957 TCCCCCGGGGCCGGCGGCGGTGG + Exonic
1113655910 13:112067731-112067753 CCCGCCGGGGCGGGCGGCGGCGG + Exonic
1113655914 13:112067734-112067756 GCCGGGGCGGGCGGCGGCGGGGG + Exonic
1113830549 13:113292216-113292238 TCCGTGGGCGTGGGCGGCAGCGG - Intergenic
1113914872 13:113864094-113864116 TGCGCGCGGGGAGGCGGCGGGGG + Intergenic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1115235792 14:31207665-31207687 GCTGCGGGCGACGGCGGCGGCGG + Intronic
1115474485 14:33800384-33800406 TCCCCGCAGGGCGGCGGCGGTGG + Exonic
1118339098 14:64879825-64879847 CCCGGGGGTGGCGGCGGCGGCGG + Exonic
1118601385 14:67473254-67473276 TCCGCGGGGGCCGGTGTTGGGGG - Exonic
1119382828 14:74239769-74239791 CCCGCGGGGGTGGGCGGCATGGG + Exonic
1121453726 14:94025608-94025630 GGCGCGGGGGGCGGGGGCGGGGG + Intergenic
1122445012 14:101761776-101761798 TCCCCGGGCGGCGGCGGCGGCGG + Exonic
1122688929 14:103522575-103522597 GCCGGGGGGCCCGGCGGCGGGGG - Intronic
1122690324 14:103529203-103529225 TCCGCGACGCGCGGCGGCGGCGG - Exonic
1202906118 14_GL000194v1_random:73292-73314 TCGGCCGGGGTCGGGGGAGGGGG + Intergenic
1202906137 14_GL000194v1_random:73338-73360 TCGGCCGGGGTCGGGGGAGGGGG + Intergenic
1124022724 15:25939032-25939054 TCGGGGGGGGGGGGCGGCGGGGG - Intergenic
1124497693 15:30196345-30196367 ACCTCGGGGGGCGGCGACGGGGG - Intergenic
1124745893 15:32342346-32342368 ACCTCGGGGGGCGGCGACGGGGG + Intergenic
1125684988 15:41558867-41558889 GCCGCGGGGGTTTGCGGCGCTGG + Intronic
1126113287 15:45187758-45187780 CGCGGGGGGGGCGGCGGCGGAGG - Intronic
1126134677 15:45378585-45378607 GCCGCGGGGGGCGGCCGGGGCGG - Exonic
1126592560 15:50354800-50354822 TCCGCGGGGGTCGGCGGGGTCGG - Intronic
1127103204 15:55588101-55588123 CCGGCGGGGCTCAGCGGCGGTGG + Intronic
1128374791 15:67066738-67066760 GCCGCGGGGGCGGGAGGCGGCGG - Intronic
1128907252 15:71478118-71478140 TCCCCTGGGGTCGGCTGCGTAGG + Intronic
1129189177 15:73927564-73927586 TCGGGGGGCGGCGGCGGCGGCGG - Exonic
1129189178 15:73927567-73927589 CCGTCGGGGGGCGGCGGCGGCGG - Exonic
1129220477 15:74129085-74129107 TCCCCATGGGTCGGCGGGGGGGG + Exonic
1132519786 16:381858-381880 GCGGCGGGGGCCGGCGGCGCGGG - Exonic
1132522205 16:397091-397113 GCCACGGGGGTCCGGGGCGGCGG + Intronic
1132719709 16:1309707-1309729 ACCGAGCGGGGCGGCGGCGGCGG - Intronic
1132877961 16:2148666-2148688 TCCCCTGGCGGCGGCGGCGGCGG - Exonic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1133784383 16:8963443-8963465 CCCGCGGCGGGCGGCGGCGGCGG + Exonic
1136226503 16:28863898-28863920 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1136261766 16:29082215-29082237 TCCGCGGGGCGCGGCGGCTGCGG - Intergenic
1136365278 16:29806650-29806672 TCAGCGGGGGCCGGGGGCGCGGG - Exonic
1136383086 16:29905980-29906002 ACTGCGGGGGTGGGCGGGGGCGG + Exonic
1136519498 16:30786826-30786848 AGCGCGGGGGTCGGTGGCGGGGG - Intronic
1136540226 16:30924386-30924408 TCGGCGGCCATCGGCGGCGGGGG - Intronic
1138179793 16:54933382-54933404 ACCGCAGGAGGCGGCGGCGGAGG - Exonic
1139435472 16:66934348-66934370 TCCGCGATGGTAGGCGGCGGCGG - Exonic
1140223107 16:73058184-73058206 TCGCCGGCGGCCGGCGGCGGCGG + Intronic
1140223242 16:73058661-73058683 CTGGCGGGGGTCGGCGGCGGCGG + Intronic
1140409831 16:74734795-74734817 TGAGCGGGGGCAGGCGGCGGGGG + Intronic
1140628989 16:76829346-76829368 TCTGCGGGGGTCGGGGGTGCTGG - Intergenic
1140927588 16:79599214-79599236 AGCGCTGGGGGCGGCGGCGGCGG - Exonic
1141054642 16:80804087-80804109 GCGGCGGCGGGCGGCGGCGGCGG - Intronic
1141608500 16:85169022-85169044 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1141683453 16:85556885-85556907 TCCGCCGAGGTCGGAGGAGGGGG + Intergenic
1142009451 16:87706424-87706446 TCCAGGGGGGTCGGCGGAGGGGG + Intronic
1142175562 16:88643456-88643478 TCGGCCGGGGGCCGCGGCGGGGG + Exonic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1143181690 17:4987603-4987625 CCCGCGGGTGACGGCGGCAGCGG + Intronic
1143548493 17:7614540-7614562 GCCGGGGGAGTCGGAGGCGGTGG - Exonic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1144608332 17:16687349-16687371 CCTGCGGGGGGCGGCGGGGGAGG - Intergenic
1144910060 17:18673040-18673062 TCCCCAGGCGGCGGCGGCGGCGG - Exonic
1145214708 17:21042855-21042877 CGCGCGGGGGGCGGCGGCGAGGG + Exonic
1146058655 17:29593411-29593433 TCCTCGCGAGGCGGCGGCGGCGG - Intronic
1146371135 17:32266154-32266176 TCCGGGGGCGGCGGCGGCTGCGG - Exonic
1147168558 17:38605579-38605601 TCGGCCGGGGGCGGGGGCGGCGG - Intronic
1147214929 17:38893535-38893557 TCCTCGGGGGTTGGGGGCTGAGG + Intronic
1147369371 17:39981049-39981071 TCCTGGGGGGCCGGCGGCGGTGG - Exonic
1147564495 17:41528057-41528079 TCCTCGGGGGCCTACGGCGGCGG - Exonic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1148180663 17:45602318-45602340 TCTGCGGGTGGCGGCGGCGCGGG - Intergenic
1148268240 17:46243606-46243628 TCTGCGGGCGGCGGCGGCGCGGG + Intergenic
1148284086 17:46372762-46372784 TGCGCGAGGGCGGGCGGCGGGGG + Intergenic
1148306307 17:46590683-46590705 TGCGCGAGGGCGGGCGGCGGGGG + Exonic
1148440412 17:47709015-47709037 CCCGGCGGGGGCGGCGGCGGTGG - Exonic
1148782551 17:50129977-50129999 TCCGCGGGGGTCTCCGGGGAAGG + Intergenic
1148899804 17:50866845-50866867 TCCGCGGGGGTCTGCGGCCAAGG + Intronic
1150168443 17:62966494-62966516 TCGGCTCGGCTCGGCGGCGGCGG - Intergenic
1150376136 17:64683360-64683382 ACCCCGGGGGGCGGGGGCGGAGG - Intergenic
1151370871 17:73645325-73645347 GCCGGGAGGGGCGGCGGCGGCGG + Intergenic
1151667500 17:75553696-75553718 TCCCCCGGGGTGGGAGGCGGGGG + Intronic
1151783844 17:76265653-76265675 GCCGCGGGGGTCGGGGACGCCGG + Intronic
1152629467 17:81403823-81403845 GCCGCGTGGACCGGCGGCGGTGG + Intronic
1152921377 17:83068186-83068208 ACAGCGGGGGGCGGCAGCGGGGG + Intergenic
1152921624 17:83068836-83068858 ACAGCGGGGGGCGGCAGCGGGGG + Intergenic
1153900493 18:9614171-9614193 TCCGCGGGGAGCGGCCGGGGAGG - Intronic
1155257759 18:24014128-24014150 CCCGAGGAGGTGGGCGGCGGGGG - Intronic
1156036624 18:32772137-32772159 TCCGAGCCGGGCGGCGGCGGCGG - Exonic
1156099745 18:33578740-33578762 CCCGCGCCGGTCCGCGGCGGCGG + Intronic
1157162259 18:45324747-45324769 TGTGCGGGGGTGGGGGGCGGTGG - Intronic
1157279121 18:46334246-46334268 TCCTCGCGCGGCGGCGGCGGCGG - Exonic
1157384311 18:47248360-47248382 GCCGCGGTGGCCGGAGGCGGGGG - Intronic
1157464291 18:47930764-47930786 GCCGCGGCGGCCGGCGGCCGAGG - Intronic
1157706651 18:49813386-49813408 TCCGCGGCGGCCGGAAGCGGAGG + Intronic
1157706799 18:49813960-49813982 TGGGCGGGGCGCGGCGGCGGCGG + Exonic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1159670147 18:71212522-71212544 GCGGCGGGGGGCGGGGGCGGCGG + Intergenic
1159670188 18:71212591-71212613 GCGGCGGGGGGCGGGGGCGGTGG + Intergenic
1160163707 18:76493319-76493341 TCCGCGGGGGGCGGGGGGGGGGG + Intronic
1160715007 19:572578-572600 GCCGCGGGCGGCGGCGGCAGCGG + Exonic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160853551 19:1206055-1206077 TCCGCGGGGCGGCGCGGCGGCGG - Intronic
1160875763 19:1295555-1295577 GGCGCGGGGGACGACGGCGGGGG + Exonic
1160882055 19:1325366-1325388 GCGGCGGGGGGCGGCGGCCGGGG + Intergenic
1160887053 19:1354975-1354997 CCCGCGGGGAGCGGCGGCGGCGG + Intronic
1160903099 19:1438902-1438924 GCCGCGGGGGTCGCGGGCAGGGG + Intronic
1160909002 19:1466249-1466271 CACGCGGGCGTCGGCGGAGGTGG - Exonic
1160913147 19:1483941-1483963 GCTGCGGGGGGCGGGGGCGGGGG + Exonic
1160991835 19:1863304-1863326 GCGGCGGGGGGCGGCGGGGGTGG + Exonic
1161215796 19:3094554-3094576 GCCGCGGCGGGCGGCGGCCGAGG + Exonic
1161439050 19:4280112-4280134 TCCGGGGTGGGCGGCTGCGGAGG - Exonic
1161779201 19:6279899-6279921 GCGGCCGGGATCGGCGGCGGCGG - Exonic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162031140 19:7917742-7917764 GCCGCGGGGGCCGGCGCGGGAGG - Exonic
1162381235 19:10333181-10333203 TGCGCGGGGGTCGTTGGCGGGGG - Intronic
1162901093 19:13795805-13795827 ACCGCGGGGGAAGGGGGCGGGGG + Intronic
1163138815 19:15332515-15332537 TGCGCTGGCGGCGGCGGCGGCGG - Intronic
1163146152 19:15380234-15380256 TCCTCTGGGGGCGGCGGCGGTGG + Exonic
1163773256 19:19203327-19203349 CCCGCGGGTTTCGGGGGCGGTGG + Exonic
1163807085 19:19405932-19405954 CCCGCGGGGCCGGGCGGCGGAGG - Intronic
1165080046 19:33301843-33301865 TGCGAGGGCGGCGGCGGCGGCGG + Exonic
1165080114 19:33302104-33302126 CCCACGGGCGGCGGCGGCGGCGG - Exonic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1165696917 19:37907466-37907488 GCCGTGGGGGGCGGCGGCGCCGG + Intronic
1165850859 19:38849701-38849723 GCGGCGGGCGGCGGCGGCGGTGG - Exonic
1165943139 19:39425161-39425183 TGGGCGGGGGTGGGCGGCTGCGG + Exonic
1166358630 19:42242380-42242402 TTCGCGGAGCCCGGCGGCGGAGG - Exonic
1166361255 19:42253870-42253892 TCCCCCGGCGGCGGCGGCGGCGG - Intronic
1166853134 19:45769741-45769763 TTCGCGAGGGTCGGGGGTGGGGG + Exonic
1167072766 19:47230525-47230547 CCCGCTGGGGGCGGCGACGGGGG - Intronic
1167104035 19:47419973-47419995 TGCGCTGGGGGCGGCGGGGGTGG + Intergenic
1167134537 19:47609002-47609024 TGGGCGCGGGGCGGCGGCGGGGG + Intronic
1167162790 19:47778835-47778857 CCGGCGGGGGTCGGGGACGGGGG - Intronic
1167269315 19:48498775-48498797 TCCGCGGGGGCCCGAGGAGGTGG + Exonic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167638583 19:50668379-50668401 CCCACGGGAGGCGGCGGCGGCGG - Exonic
1167648962 19:50719462-50719484 TCCGGGGGGGTGGGGGGTGGGGG - Intergenic
1167862542 19:52297128-52297150 TCCGAGCGGGGCGGGGGCGGGGG - Intergenic
1168076322 19:53982535-53982557 CTGGCGGGGGCCGGCGGCGGCGG + Exonic
1168076346 19:53982595-53982617 GGCGCCGGGGGCGGCGGCGGAGG + Exonic
1168276076 19:55279520-55279542 TCTTCAGGGGGCGGCGGCGGCGG - Exonic
1168354765 19:55694397-55694419 CCCGCGGGGGAAGGCAGCGGGGG - Intronic
925927807 2:8682540-8682562 ACCGCGGGAGTGTGCGGCGGCGG - Intronic
926090027 2:10043623-10043645 GCTGCGGGCGGCGGCGGCGGCGG - Exonic
926154899 2:10448288-10448310 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
926268258 2:11344933-11344955 TCCGCGGGGTCCGGCGGGAGGGG - Intronic
926284972 2:11481922-11481944 TCCTGAGCGGTCGGCGGCGGTGG + Intergenic
927472121 2:23384930-23384952 ACCGCGGGGGGCGGGGGCGGCGG + Intergenic
927904520 2:26847638-26847660 TCGGCGGGGTCCTGCGGCGGAGG + Intergenic
928606358 2:32947622-32947644 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
929174234 2:38960557-38960579 GCCGCGGGCGGCGACGGCGGCGG - Exonic
930358224 2:50346885-50346907 CCCGGGGGCGGCGGCGGCGGCGG - Intronic
930358226 2:50346888-50346910 TCGCCCGGGGGCGGCGGCGGCGG - Intronic
931253668 2:60553278-60553300 TGCGGGGCGGGCGGCGGCGGCGG + Exonic
932565694 2:72906929-72906951 TTGGCGGGGGTGGGGGGCGGGGG + Intergenic
933157467 2:78992045-78992067 ACTGCGGGCGTCGGGGGCGGGGG + Intergenic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
934079050 2:88452276-88452298 GCCCCGGGGGGCGGCGGCGGCGG + Exonic
934500488 2:94857243-94857265 TCGGCCGGGGTCGGGGGAGGGGG - Intergenic
934566850 2:95346235-95346257 TCCGCGCGGGCCAGCGGCGCGGG + Intronic
934567042 2:95346837-95346859 CCCGTGGAGGGCGGCGGCGGCGG - Intronic
934746149 2:96760962-96760984 GGCGCGGGGAGCGGCGGCGGCGG + Exonic
934993288 2:98936219-98936241 TCCGCTCGGCTCGGCGGGGGCGG + Exonic
935592062 2:104853477-104853499 TCGGCGGGGGTGGGAAGCGGGGG - Intergenic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936126711 2:109794606-109794628 GGCGGGGGGGGCGGCGGCGGCGG + Intronic
938451544 2:131425332-131425354 TCGGCAGGCGGCGGCGGCGGCGG - Intergenic
941666427 2:168247551-168247573 TTCGGCGGGGACGGCGGCGGCGG - Exonic
941951321 2:171160226-171160248 GGCGCGGGGGTCCGCGGCGCGGG + Intronic
942046517 2:172102300-172102322 CCGGCGGGCGGCGGCGGCGGCGG - Exonic
942061896 2:172234958-172234980 TCGGCGGTGGGCGGCGCCGGGGG + Intergenic
942448392 2:176093049-176093071 TTCGGGGCGGGCGGCGGCGGCGG + Exonic
942463839 2:176188488-176188510 TCCTCGGGGCTCGGGGGCGCTGG + Intergenic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
944221809 2:197310746-197310768 TCGGCGGGAGGAGGCGGCGGCGG - Exonic
944675848 2:202033873-202033895 CCGGCGGGCGGCGGCGGCGGCGG + Intergenic
944743684 2:202635413-202635435 CCCGCAGGCGGCGGCGGCGGCGG + Exonic
945064771 2:205939562-205939584 TCAGCGGGGTTCTGCGGTGGTGG - Intergenic
945241560 2:207681470-207681492 TCCGCGCGGCTCCGCGGCGAGGG - Intergenic
946248569 2:218400236-218400258 GCCGCCCGGGGCGGCGGCGGCGG - Intronic
946692291 2:222319083-222319105 TCGACGGGGGGCAGCGGCGGCGG - Intergenic
946692397 2:222319458-222319480 TCCTCGGCAGGCGGCGGCGGCGG + Intergenic
946692399 2:222319461-222319483 TCGGCAGGCGGCGGCGGCGGCGG + Intergenic
946865609 2:224039112-224039134 TCCCCAGGGGGCGGCCGCGGAGG + Intronic
947635980 2:231680993-231681015 GCGGCGGGGGCAGGCGGCGGAGG + Intergenic
947860530 2:233354564-233354586 TCCTCGGGCGGCGGCGGCGGAGG - Exonic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
1168804355 20:663684-663706 CCGGCGGGGGTCGGCGGGGGTGG + Exonic
1169065559 20:2692795-2692817 TCCCCCGGGAGCGGCGGCGGCGG + Intergenic
1169065661 20:2693104-2693126 GGCGCGGAGCTCGGCGGCGGCGG - Exonic
1170150506 20:13221726-13221748 GGCGCGGCGGCCGGCGGCGGCGG - Intergenic
1170756917 20:19212878-19212900 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1170890091 20:20368871-20368893 TCCGCGGCGGTAGGGGGCGGGGG - Exonic
1171891704 20:30723926-30723948 TCGGCCGGGGTCGGGGGAGGGGG - Exonic
1171971544 20:31568189-31568211 TCTGCGGGCGCCGGCGGCGAGGG - Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1172951201 20:38724436-38724458 GCTGCGGAGGGCGGCGGCGGCGG - Intergenic
1173838402 20:46140296-46140318 TCTGCAGGGGGCGGGGGCGGTGG + Intergenic
1174386666 20:50191526-50191548 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
1174804344 20:53593426-53593448 TCTGCGGGGGTGGGCGGTGGGGG - Intronic
1175911416 20:62407044-62407066 GCCTCGGCGGGCGGCGGCGGGGG + Exonic
1176033331 20:63024355-63024377 TCCGTGGCGGTGGGGGGCGGTGG + Intergenic
1176145038 20:63561799-63561821 TGCGCCGGGGTCGGCGGTGGGGG - Intronic
1176157018 20:63627015-63627037 GCGGCGGCGGGCGGCGGCGGCGG + Intronic
1176173683 20:63707890-63707912 TCAGCGGGGGTCAGCAGCAGCGG - Exonic
1176207111 20:63895199-63895221 ACCCCGGGCGGCGGCGGCGGCGG - Exonic
1176380851 21:6111468-6111490 TCCGCGGGGCTCAGGGGCTGGGG + Intronic
1176549732 21:8216028-8216050 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176550057 21:8217090-8217112 ACCCGGGGGGCCGGCGGCGGCGG + Intergenic
1176550162 21:8217354-8217376 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176550164 21:8217357-8217379 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176557623 21:8260257-8260279 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176568657 21:8399062-8399084 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176568984 21:8400125-8400147 ACCCGGGGGGCCGGCGGCGGCGG + Intergenic
1176569090 21:8400389-8400411 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176569092 21:8400392-8400414 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176576568 21:8443291-8443313 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176576898 21:8444360-8444382 ACCCGGGGGGCCGGCGGCGGCGG + Intergenic
1176577004 21:8444624-8444646 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176577006 21:8444627-8444649 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176625475 21:9088048-9088070 TCGGCCGGGGTCGGCGGAGGAGG + Intergenic
1176625494 21:9088094-9088116 TCGGCCGGGGTCGGGGGAGGGGG + Intergenic
1177157477 21:17513407-17513429 TCGGCGGGGGGTGGAGGCGGAGG + Intronic
1177834085 21:26170695-26170717 GCCCCGGGAGACGGCGGCGGTGG - Intronic
1179411989 21:41168829-41168851 TCCGCGGGGCTGGGCGGGAGAGG + Intronic
1179561593 21:42219238-42219260 CCCGGGGGCGGCGGCGGCGGCGG - Exonic
1179561596 21:42219241-42219263 TGCCCCGGGGGCGGCGGCGGCGG - Exonic
1179742621 21:43426772-43426794 TCCGCGGGGCTCAGGGGCTGGGG - Intronic
1180008185 21:45032979-45033001 TGGGCGGGGGTGGGCGGTGGGGG - Intergenic
1180042859 21:45288712-45288734 GCTGCGGGGAGCGGCGGCGGCGG - Intergenic
1180095939 21:45555321-45555343 GCGGCGGGGGGCGGCGGGGGCGG + Intergenic
1180560262 22:16609849-16609871 TCTGCAGGGGTGGGCGGTGGGGG - Intergenic
1180958225 22:19750684-19750706 TCCTGGGGGGTGGGCGGGGGAGG - Intergenic
1180961936 22:19766182-19766204 TCTGCGGGCGGCGGCGGCGGCGG - Intronic
1181793072 22:25282860-25282882 TCAGCTGGCGGCGGCGGCGGCGG + Intergenic
1181813766 22:25421361-25421383 GCCGCAGGGGGCGGCGGCGTCGG - Intergenic
1181831671 22:25564960-25564982 GGCGCGGCGGGCGGCGGCGGCGG + Exonic
1183334057 22:37236697-37236719 TCCGTGGGGGTGGGCTTCGGTGG - Intronic
1183427204 22:37746304-37746326 GCCGAGAGGGGCGGCGGCGGCGG + Intronic
1183535367 22:38398100-38398122 TCTGCGGGGGTGGGCGGTGGGGG - Intronic
1183831114 22:40418722-40418744 GCCGAGGGGGGCGGGGGCGGGGG + Exonic
1184236737 22:43187101-43187123 ACGGCGGGCGGCGGCGGCGGTGG - Exonic
1184362017 22:44024464-44024486 TCCCCGGGGGTCGGCGGGCGCGG - Intronic
1185037223 22:48485809-48485831 TCTGCTGTGGTCGGCGGGGGTGG - Intergenic
1185413378 22:50697398-50697420 CTCCCGGGGGTCGGCGGCGAGGG + Intergenic
1203254618 22_KI270733v1_random:132349-132371 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203254947 22_KI270733v1_random:133416-133438 ACCCGGGGGGCCGGCGGCGGCGG + Intergenic
1203255055 22_KI270733v1_random:133686-133708 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203255057 22_KI270733v1_random:133689-133711 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203262674 22_KI270733v1_random:177428-177450 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203263003 22_KI270733v1_random:178495-178517 ACCCGGGGGGCCGGCGGCGGCGG + Intergenic
1203263111 22_KI270733v1_random:178765-178787 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203263113 22_KI270733v1_random:178768-178790 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
950004483 3:9682939-9682961 TACTCGGGGGGCGGGGGCGGGGG - Intronic
950487755 3:13282956-13282978 GCCGGGGGGCTCGGCGGCGCTGG + Intergenic
950650242 3:14402682-14402704 TCCTCGGGGCTCGGCGTTGGCGG - Exonic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
952287234 3:31981022-31981044 GCGGCCGGGCTCGGCGGCGGGGG - Exonic
952382892 3:32818201-32818223 TCGTCGGGGGGCGGCGGCGGGGG + Exonic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
954004206 3:47578825-47578847 ACAGCGGCGGACGGCGGCGGCGG - Exonic
954265932 3:49470357-49470379 TCCCCGGGGAGCGGCGGTGGCGG + Exonic
958814582 3:98901581-98901603 GCCGCGGAGGACGGCCGCGGCGG + Exonic
961000961 3:123373761-123373783 TGCGGGGGGGTCGGGGGGGGGGG - Intronic
961182379 3:124887040-124887062 TCCGCGGGGGCCGGCGGCCGGGG + Exonic
961635295 3:128329410-128329432 TCAGCGGGGGTGGGGGGGGGTGG - Intronic
961698822 3:128726139-128726161 TCCGCTCGGGGCGGCGGCGGTGG + Exonic
961792286 3:129384891-129384913 TCGGCGGGGGGCGGGGGGGGCGG - Intergenic
963236738 3:142963696-142963718 TCCGGGGGCGGCGGCGGCGGAGG - Intergenic
964219124 3:154324289-154324311 TCCGGAGGAGGCGGCGGCGGCGG - Exonic
968051405 3:195657718-195657740 TCCGCGGAGGTGGGCGGGAGCGG - Intergenic
968104414 3:195990615-195990637 TCCGCGGAGGTGGGCGGGAGCGG + Intergenic
968288090 3:197519831-197519853 CCTGCGGGGGTCGGGGCCGGTGG + Intronic
968302710 3:197628205-197628227 TCCGCGGAGGTGGGCGGGAGCGG + Intergenic
969676491 4:8617168-8617190 ACGGCGGGGGTCAGCCGCGGTGG + Intronic
970202878 4:13627487-13627509 GCCCCGGGGCCCGGCGGCGGCGG + Exonic
970333199 4:15004381-15004403 TGGGCGGGGGACGGAGGCGGGGG + Intronic
970456225 4:16226561-16226583 GCCGCGGATGGCGGCGGCGGCGG - Intronic
973820551 4:54658400-54658422 TGCGCGGGGGGCGGAGGCGGGGG + Intronic
974047137 4:56907864-56907886 CCCGCGGGCGGTGGCGGCGGCGG + Intronic
977536531 4:98261297-98261319 TCCGAGCGGGCGGGCGGCGGAGG - Intergenic
977536579 4:98261433-98261455 CCCGCGGGGGGCGGCCGCCGGGG - Intronic
977809714 4:101346099-101346121 TCCGCGCGGGGCGGGGGCGGGGG - Intronic
978795755 4:112706021-112706043 TCCGCGGGGCGCGGCGGCTGCGG + Intergenic
979455477 4:120922343-120922365 ACCGCGGGGCACGGCGGGGGTGG - Intronic
979785577 4:124712434-124712456 TAACCGGGGGGCGGCGGCGGCGG - Intronic
980053798 4:128061543-128061565 TCGGCGGGCGGCGGCAGCGGCGG + Intronic
981093425 4:140756152-140756174 TCCGCTAGGTGCGGCGGCGGCGG + Intergenic
983941620 4:173538842-173538864 CGCGCGGGGGGAGGCGGCGGAGG + Intergenic
985497460 5:217935-217957 TCCGCGGAGGTGGGCGGGAGCGG - Intronic
985791696 5:1931584-1931606 CCCGCGGGTGGCGGCGGCTGTGG - Intergenic
985894266 5:2739621-2739643 TCCGGCGGCGACGGCGGCGGGGG - Intergenic
986330558 5:6713773-6713795 CCGGCGTGGGGCGGCGGCGGCGG - Intergenic
986988446 5:13524818-13524840 TCCAGGGGGGGTGGCGGCGGTGG + Intergenic
987050403 5:14143567-14143589 GCGGCGGGGGGCGGCGGCGGCGG - Intergenic
988547652 5:32173770-32173792 TGGGCGGGGGGCGGCGGCGCGGG - Intronic
990607128 5:57422532-57422554 TCCGGGGGGGTCGGCTGCTGCGG - Intergenic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
992105726 5:73448043-73448065 GCCGGTGGGGGCGGCGGCGGCGG - Exonic
992468535 5:77030800-77030822 TCGGGGGAGGTGGGCGGCGGCGG - Exonic
993069665 5:83144554-83144576 TCCGTGGGGGTGGGGGGGGGGGG - Intronic
996404175 5:123090171-123090193 TCCGGGGGCGGGGGCGGCGGCGG - Exonic
997822313 5:137077209-137077231 TCTGCGGGGGCCGGGCGCGGTGG - Intronic
998143449 5:139712268-139712290 TTGGCGGGGGTCGGGGGAGGCGG + Intergenic
999300068 5:150485728-150485750 TCCGAGCGGGTAGGGGGCGGGGG - Intergenic
999696233 5:154190631-154190653 TCGGCGGGGCCCGGGGGCGGTGG + Intronic
1001263394 5:170253126-170253148 TCCGCGGGGGATGGGGGCCGAGG + Exonic
1002184227 5:177446862-177446884 CCTGCGGGGGGAGGCGGCGGCGG - Exonic
1002352039 5:178590124-178590146 GCGGCGGGCGGCGGCGGCGGAGG - Exonic
1002455891 5:179345188-179345210 ACCTGGGGGGTCGGCGGCGGCGG + Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002632445 5:180590767-180590789 TGCGCTGGAGTCGGCGGCGGAGG - Exonic
1002898158 6:1390842-1390864 GCGGCCGGGGGCGGCGGCGGCGG + Exonic
1004216787 6:13711264-13711286 GCCGCGGTGGCCGGGGGCGGCGG + Exonic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1006725493 6:36196784-36196806 TCCCCCGGGAGCGGCGGCGGCGG + Exonic
1007673482 6:43575957-43575979 GCCGCGGCGGGCGGCGGGGGTGG + Exonic
1007739708 6:44003085-44003107 TCCGCGGCGCTCCGCGGCGCTGG + Exonic
1007784200 6:44270776-44270798 GCCGCCGGCGGCGGCGGCGGCGG + Exonic
1010703129 6:79077106-79077128 CGCGCGAGAGTCGGCGGCGGCGG - Intronic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1014137622 6:117907476-117907498 GCCGGGGCGGGCGGCGGCGGCGG + Intergenic
1014246819 6:119078528-119078550 TGCCCGGGGTTGGGCGGCGGCGG + Exonic
1014272315 6:119348989-119349011 GGCGGGGGGCTCGGCGGCGGCGG - Exonic
1014802381 6:125791091-125791113 TCAGCGGCGGGCGGCGGCGAGGG - Intronic
1017671866 6:156777263-156777285 TGCGCCGGGGCGGGCGGCGGCGG + Intergenic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017793624 6:157823033-157823055 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1017842350 6:158232209-158232231 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1018400493 6:163415142-163415164 TCCGGCGGCGGCGGCGGCGGCGG + Exonic
1018830911 6:167442821-167442843 TCAGCCGGGGTCGGGGGAGGGGG + Intergenic
1019531270 7:1504553-1504575 TCCAGGTGGGTCGGCGGCGCGGG + Intergenic
1019681919 7:2355171-2355193 TCCTCGGCGGCCGGCGGCGAGGG - Exonic
1019731508 7:2631928-2631950 TGCGGAGGGGGCGGCGGCGGCGG + Intergenic
1021451255 7:20785341-20785363 TCCGGGGGCAGCGGCGGCGGCGG - Exonic
1021633030 7:22665261-22665283 TTCCCGGGGGTGGGGGGCGGAGG - Intergenic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1022739725 7:33109416-33109438 TCCGGCGGCGGCGGCGGCGGCGG + Intergenic
1023417892 7:39949852-39949874 TCTGCTGGCGGCGGCGGCGGCGG + Intergenic
1025069777 7:55887834-55887856 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069786 7:55887857-55887879 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069794 7:55887879-55887901 GCGGCGGCGGGCGGCGGCGGCGG + Intronic
1025069795 7:55887882-55887904 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1027177789 7:75915501-75915523 CCCGTGGGGGGCGGCGGCGCGGG - Intronic
1028621487 7:92833567-92833589 TCCTCCGGCGGCGGCGGCGGCGG - Exonic
1029281560 7:99438948-99438970 CCCTCGGGCGGCGGCGGCGGCGG + Intronic
1029461139 7:100694373-100694395 GCCGCGGAGGGAGGCGGCGGCGG - Intergenic
1029640626 7:101817023-101817045 CCCGCGGGGGTCCGCCACGGAGG - Intronic
1030176499 7:106660421-106660443 TCCTCGGGGGGCGGCGGCGGTGG + Exonic
1030348379 7:108456988-108457010 TCTGCGGTGGTGGGGGGCGGCGG - Intergenic
1031401564 7:121330100-121330122 TCCGAGGGGGTCGGCGGGGTAGG - Intronic
1032215280 7:129952690-129952712 CGTGCGGGGGGCGGCGGCGGCGG - Exonic
1032369156 7:131328387-131328409 TCCGAGGTGGTCGGCGTCGGGGG + Intronic
1032680038 7:134172869-134172891 TACTCGGGGGTCGGGGGCTGAGG + Intronic
1033361335 7:140640714-140640736 GCCGCTGGGGCCGGGGGCGGCGG - Exonic
1033654026 7:143361792-143361814 TCAGCGGGGGCCGGCGGGGCGGG - Intronic
1034264060 7:149772946-149772968 TCCGGGGAGGTCGGGGGCTGGGG - Intronic
1034306252 7:150047572-150047594 GGGGCGGGGGACGGCGGCGGGGG - Intergenic
1034617992 7:152435725-152435747 TCCTCGGGGGGTGGTGGCGGCGG + Exonic
1034618150 7:152436202-152436224 GCCGCGGGGCCCGGCGGGGGCGG + Intergenic
1034911664 7:155002978-155003000 GCCGCGGGGGCCGGGGGCGGGGG - Exonic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1035284061 7:157795150-157795172 TTCGGCGGGGTCGGGGGCGGGGG + Intronic
1041280950 8:56211092-56211114 TCTCCGGGGGTCCGGGGCGGCGG - Intronic
1041690003 8:60679109-60679131 CCCGGGAGGGGCGGCGGCGGCGG + Intronic
1042155692 8:65841974-65841996 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1046547420 8:115669079-115669101 GCCGGGCGGGGCGGCGGCGGCGG - Intronic
1046871320 8:119208497-119208519 ACGGCGGGGTTCGGGGGCGGCGG - Exonic
1047274717 8:123396732-123396754 TTGGCGCGGGACGGCGGCGGGGG + Intronic
1049419527 8:142510702-142510724 TCCGCGGCTCTCGGCGGCGGCGG + Intronic
1049419545 8:142510757-142510779 GCCGCGGGGCCTGGCGGCGGCGG + Intronic
1049585629 8:143431175-143431197 TCCGCTAGCGGCGGCGGCGGCGG + Intergenic
1049659997 8:143815608-143815630 AGCGCGGGGAGCGGCGGCGGCGG + Intergenic
1049670045 8:143865349-143865371 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
1049762457 8:144337397-144337419 TCTGCGGGGGCGGGCGGGGGAGG + Intergenic
1053239939 9:36487403-36487425 TCCGGCCGGGGCGGCGGCGGTGG + Intronic
1054260922 9:62864473-62864495 CCGGCGGGGGTTGGGGGCGGTGG - Intergenic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1056799530 9:89681465-89681487 GCGGCGGGGGGCGGCGGCGGTGG - Intergenic
1057773351 9:97985072-97985094 CCCGCGCCGGTCCGCGGCGGGGG - Intronic
1059123372 9:111661828-111661850 TCGGCGGGGCGCGGGGGCGGTGG + Intronic
1059189898 9:112315116-112315138 TCAGTGGGGGCCGGGGGCGGTGG - Intronic
1059470934 9:114504716-114504738 GCCGGGGCGGGCGGCGGCGGGGG - Exonic
1059483710 9:114611525-114611547 TCCCGGGGTGGCGGCGGCGGCGG + Exonic
1059769885 9:117414957-117414979 GCTGCGGGCGGCGGCGGCGGTGG + Exonic
1060240025 9:121894987-121895009 TCAGCGGGGGTCAGGGGAGGTGG + Intronic
1060283491 9:122228884-122228906 TGCGCGCGGGCCGGGGGCGGGGG - Intronic
1060700602 9:125746941-125746963 GCGGCGGCGGGCGGCGGCGGAGG - Intergenic
1060811204 9:126612505-126612527 TCCGCGGGGCCCCGCGGCGCAGG + Intergenic
1060978402 9:127778795-127778817 TCCGCAGGGGGCGGGGGCTGGGG + Intergenic
1061015946 9:127980840-127980862 TCCGCCGGGGCCCGCGGCGCGGG - Intergenic
1061084919 9:128393114-128393136 TGCGCGGGGCTGGGCGGGGGCGG - Intergenic
1061144119 9:128787268-128787290 TCCCTGGGGGGCGGCGGCGGCGG + Exonic
1061149150 9:128819112-128819134 CCAGCGGTGGTTGGCGGCGGCGG - Exonic
1061207746 9:129174407-129174429 TCCGCGGAGGTCCGCGTTGGGGG - Intergenic
1061541079 9:131278037-131278059 TCCGCAGGCGGCGGCGGCGGCGG + Intergenic
1062162468 9:135087826-135087848 GGCGCGCGGGGCGGCGGCGGCGG + Exonic
1062425588 9:136504702-136504724 GCAGCGAGGGTGGGCGGCGGCGG - Exonic
1062567531 9:137169954-137169976 ACCGCGGGTGCCGGGGGCGGGGG - Exonic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1203748640 Un_GL000218v1:58509-58531 TCGGCCGGGGTCGGCAGAGGAGG + Intergenic
1203748659 Un_GL000218v1:58555-58577 TCGGCCGGGGTCGGGGGAGGGGG + Intergenic
1203471019 Un_GL000220v1:115493-115515 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203471349 Un_GL000220v1:116562-116584 ACCCGGGGGGCCGGCGGCGGCGG + Intergenic
1203471455 Un_GL000220v1:116826-116848 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203471457 Un_GL000220v1:116829-116851 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203478840 Un_GL000220v1:159465-159487 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203479170 Un_GL000220v1:160534-160556 ACCCGGGGGGCCGGCGGCGGCGG + Intergenic
1203479276 Un_GL000220v1:160798-160820 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203479278 Un_GL000220v1:160801-160823 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1185778818 X:2828868-2828890 CCCGCGGGGGCTGGCGGAGGCGG + Exonic
1186426113 X:9465270-9465292 TCTCCGGGACTCGGCGGCGGCGG + Exonic
1188242675 X:27809525-27809547 GGGGCGGGGGCCGGCGGCGGGGG - Intronic
1189137120 X:38561514-38561536 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1189323075 X:40097813-40097835 TAGGCGGGCGGCGGCGGCGGAGG - Intronic
1189473629 X:41333199-41333221 ACCGCGGGGGGCGGGGGCGGAGG + Intergenic
1190066266 X:47243616-47243638 TCCCCGGGGGTGGGGGGCGGAGG + Intronic
1190885788 X:54530150-54530172 TCCGCGGGGGGGGGGGGGGGGGG - Intergenic
1191184306 X:57592806-57592828 TCCGCGGGGGCCCAGGGCGGCGG - Exonic
1191213085 X:57909653-57909675 TCCGCGGGGGCCCAGGGCGGCGG + Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1199612733 X:149631765-149631787 TCTCCGGGCGGCGGCGGCGGCGG - Exonic
1200173763 X:154097633-154097655 TCCGCTCGGCGCGGCGGCGGCGG + Exonic
1200229422 X:154436810-154436832 CCCGGGGGGGTGGGCGGGGGTGG + Intergenic
1200231022 X:154443978-154444000 TCCACAGGAGCCGGCGGCGGGGG + Intergenic
1200231075 X:154444191-154444213 GCGGCGGCGGGCGGCGGCGGCGG - Exonic
1200277855 X:154751153-154751175 GCCGCGGCGGCCGGAGGCGGGGG - Intronic
1201161996 Y:11173479-11173501 TCGGCCGGGGTCGGGGGAGGGGG + Intergenic