ID: 1142586717

View in Genome Browser
Species Human (GRCh38)
Location 17:979038-979060
Sequence GTGCTGCGCTGCGCCCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 202}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142586717_1142586727 13 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586727 17:979074-979096 GGGTCCTGGGATGAGGGTGCGGG 0: 1
1: 0
2: 18
3: 85
4: 599
1142586717_1142586726 12 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586726 17:979073-979095 GGGGTCCTGGGATGAGGGTGCGG 0: 1
1: 0
2: 7
3: 120
4: 875
1142586717_1142586725 7 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586725 17:979068-979090 AAAGAGGGGTCCTGGGATGAGGG 0: 1
1: 0
2: 0
3: 27
4: 342
1142586717_1142586719 -8 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586719 17:979053-979075 CGCAGCACTCGAACCAAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 36
1142586717_1142586724 6 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586724 17:979067-979089 CAAAGAGGGGTCCTGGGATGAGG 0: 1
1: 0
2: 1
3: 16
4: 320
1142586717_1142586730 27 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586730 17:979088-979110 GGGTGCGGGCACAGCGCGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 191
1142586717_1142586729 23 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586729 17:979084-979106 ATGAGGGTGCGGGCACAGCGCGG 0: 1
1: 0
2: 0
3: 13
4: 203
1142586717_1142586732 29 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586732 17:979090-979112 GTGCGGGCACAGCGCGGAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 105
1142586717_1142586720 -7 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586720 17:979054-979076 GCAGCACTCGAACCAAAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 110
1142586717_1142586721 -1 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586721 17:979060-979082 CTCGAACCAAAGAGGGGTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 91
1142586717_1142586733 30 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586733 17:979091-979113 TGCGGGCACAGCGCGGAAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 127
1142586717_1142586718 -9 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586718 17:979052-979074 GCGCAGCACTCGAACCAAAGAGG 0: 1
1: 0
2: 1
3: 3
4: 60
1142586717_1142586731 28 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586731 17:979089-979111 GGTGCGGGCACAGCGCGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
1142586717_1142586722 0 Left 1142586717 17:979038-979060 CCAGGGCGGGCGCAGCGCAGCAC 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1142586722 17:979061-979083 TCGAACCAAAGAGGGGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142586717 Original CRISPR GTGCTGCGCTGCGCCCGCCC TGG (reversed) Intronic
901236683 1:7671016-7671038 GTGCTGCGCTGCTACTGCCCAGG + Exonic
901629807 1:10642592-10642614 GGGCTGCGCTGCTCCCGCTGTGG + Intronic
903153412 1:21428807-21428829 CCGCCGCGCTGCGCACGCCCAGG + Intergenic
903211904 1:21823392-21823414 GTGCTGCACTCGGCCCGACCCGG - Exonic
904908611 1:33917108-33917130 GTGCGGGGCTGGGCCCGGCCAGG - Intronic
905182653 1:36176483-36176505 GTGCACCGCTGCGCCCCCGCCGG + Exonic
906650405 1:47508637-47508659 GGGCTGCGCTGGGCACGCCGAGG + Intergenic
907223892 1:52927356-52927378 GTCGTCCGCGGCGCCCGCCCCGG + Exonic
907267636 1:53272480-53272502 GTGCTGAGCTGAGCCAGCCATGG + Intronic
910371721 1:86523797-86523819 GTCCTGTGCTGCGCCTGCACAGG + Intergenic
911508533 1:98784064-98784086 TTGCTGCCCTTCCCCCGCCCAGG - Intergenic
913541191 1:119822507-119822529 GTGCTGCCCTTCCCCTGCCCAGG + Intergenic
915740937 1:158117977-158117999 GGGCTGCGCTGCCCCGGCACGGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922526642 1:226309250-226309272 GCGCTGCGCTGCTCCCGCCGCGG + Exonic
924090109 1:240492943-240492965 GGGCTGAGCTGCGTCCGGCCCGG + Exonic
924775198 1:247111436-247111458 GCCCGGCCCTGCGCCCGCCCGGG - Exonic
1063087925 10:2836350-2836372 CTCCTGCCCTTCGCCCGCCCTGG + Intergenic
1063180841 10:3598364-3598386 GTGAGCCGCTGCGCCCGGCCAGG + Intergenic
1064478794 10:15719690-15719712 CTGCTGCGCCGCGGCCGCGCTGG - Exonic
1067207689 10:44233709-44233731 GTGCTGCCCTTCCCCCGCCCAGG + Intergenic
1067830863 10:49610422-49610444 GGGCTGCTCTGGGCGCGCCCCGG + Exonic
1070257638 10:74825542-74825564 GCGCCGCGCTCCCCCCGCCCGGG - Intergenic
1070798364 10:79230352-79230374 CTGCTGCCCTGCTCCAGCCCTGG + Intronic
1071134594 10:82438440-82438462 GTGCTGCCCTTCCCCCACCCAGG + Intronic
1073706504 10:105989953-105989975 GTGCTGCACTGCTCACTCCCAGG - Intergenic
1074987237 10:118669176-118669198 CTGCTGCTCTGCGGCCACCCTGG - Intergenic
1075648660 10:124113083-124113105 GTGCTCCCCTGCCCCCGCCCGGG - Intergenic
1076234993 10:128856595-128856617 ATGCTGCCCTGCTCCTGCCCAGG + Intergenic
1076849997 10:133088061-133088083 GCGCTGCGCTCCCCCCGCCGGGG - Exonic
1077011168 11:380039-380061 AAGCTGCGCTGGGTCCGCCCAGG - Intronic
1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG + Exonic
1077891266 11:6419427-6419449 GTGCGGCGCCGCGGCCGCGCGGG + Intergenic
1077962546 11:7089982-7090004 GAGCTGCGCGGCGCCGCCCCAGG + Exonic
1078246125 11:9574213-9574235 TTGCTGCCCGGCGCCTGCCCGGG + Exonic
1078987194 11:16607567-16607589 GCTCTGCGCTGCCCCCACCCGGG - Intronic
1081860920 11:46333009-46333031 GTGCTGCGCTCTGCGCGCCGCGG - Intronic
1083669746 11:64293007-64293029 GTGCTGCGCATGGCGCGCCCAGG - Exonic
1083716616 11:64581210-64581232 ATGCTGCCCTGCGCCCTCCTTGG + Intergenic
1083940080 11:65891047-65891069 GTGCGGCGCGCCGCCCGCGCTGG - Exonic
1084226043 11:67715438-67715460 ATGCGGCCCTGTGCCCGCCCTGG + Intergenic
1088084474 11:105960530-105960552 GTGCTGCCCTTCCCCCACCCAGG + Intronic
1089700234 11:120240171-120240193 GCGCTCCGCTGCTCCGGCCCGGG - Intronic
1090657492 11:128857107-128857129 GTGCGGCGCAGCTCCTGCCCTGG + Intronic
1091178081 11:133579539-133579561 CTGCTGCGCAGCCCCCACCCTGG - Intergenic
1091407978 12:220847-220869 GTGCTTCCCTGCCCCCGACCTGG - Exonic
1092155363 12:6278697-6278719 GCGCCGCCCTGCGCCCTCCCGGG - Intergenic
1094054540 12:26255951-26255973 GTGCTGCCCTTCACCTGCCCAGG - Intronic
1094564923 12:31590802-31590824 GAGCTGCGCGGCGCCCGGCCCGG - Exonic
1097981563 12:65741873-65741895 GTCCCGCGCAGCGCCCGTCCCGG - Intergenic
1099350919 12:81567329-81567351 GTGATCCACTGCGCCCGGCCAGG + Intronic
1100435393 12:94566496-94566518 CTGCTGCCCTGTGCCCCCCCCGG + Intergenic
1101593032 12:106139619-106139641 GGGCAGAGCTGCGCCCGCCTGGG + Exonic
1101667931 12:106837079-106837101 GTGCGCCACTGCGCCCGGCCGGG - Intronic
1103721800 12:122979250-122979272 GTGCTGCCGTGAGCCCGACCTGG + Exonic
1104560622 12:129840614-129840636 AGGCTGCGCAGCCCCCGCCCTGG - Intronic
1105243593 13:18628633-18628655 GCGCTGCCCTGCTCCGGCCCTGG + Intergenic
1108160376 13:47632570-47632592 GTGCTGCCCTTCCCCCACCCAGG - Intergenic
1108596714 13:51955872-51955894 GTGCTGCGCTGCCCCCAAACAGG - Intronic
1113655794 13:112067279-112067301 GCGGTGCGCTGGGCCCGGCCCGG - Intergenic
1113676785 13:112213241-112213263 CTGCTGCCCTGCTCCCACCCTGG - Intergenic
1113820549 13:113209558-113209580 GAGCTCCGCTCCGCCCGCCCCGG - Exonic
1113910393 13:113838700-113838722 GTGCTGGGCTGTGCACCCCCGGG - Intronic
1119835755 14:77747704-77747726 GTGCGGGGCAGCCCCCGCCCCGG + Intronic
1120765532 14:88323965-88323987 CTGCTGCGCTCTCCCCGCCCGGG + Intronic
1122232716 14:100314860-100314882 GTGCTGTGCTGCTCCAGCCTGGG + Intergenic
1122889007 14:104724129-104724151 GGGCGTCACTGCGCCCGCCCTGG + Intergenic
1123450809 15:20357971-20357993 GTGCTGCGCAGCCCCTTCCCTGG - Intergenic
1128075689 15:64824027-64824049 CAGCTGCACTGCGCCGGCCCCGG + Exonic
1132716317 16:1291874-1291896 GGGCTGAGCGGCGCCCACCCAGG - Intergenic
1132887057 16:2186911-2186933 GTTCTGGGGTGCGCACGCCCAGG + Intronic
1134125360 16:11612557-11612579 GTCCTGAGCTGGGCCGGCCCTGG - Intronic
1138116190 16:54362475-54362497 TTGCTGCGGTGGGGCCGCCCTGG - Intergenic
1138261639 16:55627636-55627658 GTGCTGAGCTGGGCCAGCCCTGG + Intergenic
1140454984 16:75099762-75099784 GTGCTGCGAGGCCCCCGCCATGG + Intronic
1142586717 17:979038-979060 GTGCTGCGCTGCGCCCGCCCTGG - Intronic
1143750088 17:9021602-9021624 GTGCTGCCCTGCCCGCGCCCGGG - Intronic
1146283640 17:31560184-31560206 GTGGTGAGGTGCGCTCGCCCCGG + Intergenic
1147325054 17:39666125-39666147 GGGCTCCGCTGTGCCCGCCCTGG + Exonic
1147655482 17:42088370-42088392 GTGGGGCACTGCGCCCACCCGGG - Intergenic
1148090266 17:45019112-45019134 ATGCCACGCTGCCCCCGCCCGGG - Intergenic
1149658877 17:58324367-58324389 GGGCGGCGGTGCGTCCGCCCCGG - Intronic
1150488282 17:65559068-65559090 GAGCTGCCCTGCGTGCGCCCTGG - Intronic
1151696689 17:75721570-75721592 CTGCTGCTGTGCGCCCGTCCTGG - Exonic
1152082907 17:78199653-78199675 GTGCGCCGCCGCGCCCGGCCAGG + Intronic
1152337633 17:79707364-79707386 GTGCTGCGCAGCCCCTTCCCTGG + Intergenic
1152565851 17:81100094-81100116 GGGCTGCGCTGTGCCGGCGCTGG + Intronic
1153515392 18:5896138-5896160 GTCCCGCGGTGCGCCCGTCCCGG - Intergenic
1154445349 18:14431252-14431274 GCGCTGCACTGCGCCGGCCCTGG - Intergenic
1155284209 18:24271881-24271903 CTCCCGCGCCGCGCCCGCCCGGG + Intronic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1160835369 19:1122360-1122382 GTGCTGGGCAGAGCCTGCCCTGG + Intronic
1161006796 19:1941201-1941223 GCGCTCCGCCGCGCCCGCTCCGG - Exonic
1161065532 19:2235700-2235722 GTGCGGCGCTGCGGGTGCCCCGG + Intronic
1161069098 19:2251610-2251632 GCGCTGCGCTGTGCCCGACCCGG - Exonic
1161310310 19:3590196-3590218 GGGCTGTGCTGGGCCCCCCCAGG - Exonic
1161801352 19:6418178-6418200 GTGCTGTGCTGGGCTCACCCAGG - Intronic
1162182484 19:8879687-8879709 GTGCCGCCCTTCCCCCGCCCAGG - Intronic
1163113822 19:15177796-15177818 GCGCTGCGAGGCGCCCGCCGCGG - Exonic
1163607134 19:18281559-18281581 GCTCGGCCCTGCGCCCGCCCCGG + Exonic
1167151802 19:47714269-47714291 GTTCTTCCCTGCCCCCGCCCTGG + Intronic
925447515 2:3940765-3940787 GTGCTGCTCTTCCCCCGCCCAGG + Intergenic
926090084 2:10043866-10043888 GGGCTTCGCTGCGGCCGCGCCGG + Intronic
927865501 2:26584979-26585001 GTGCTGCCCTGAGCCTGGCCAGG + Intronic
929777402 2:44937839-44937861 GCGCTCCCCTGCGCCCTCCCTGG + Intergenic
929808405 2:45168995-45169017 GGGCTGGGCTGCCCCCGGCCGGG + Intergenic
930545752 2:52765750-52765772 GTGCTGCCCTCCCCCTGCCCAGG - Intergenic
933829418 2:86195057-86195079 GGGCCGCGCTGCCCCCGTCCAGG - Intronic
935349991 2:102144394-102144416 GTGCTGCTCTGGGCCTGCCAAGG - Intronic
935692679 2:105745062-105745084 TGGCCGCGCTGCGCCCGCCCAGG - Exonic
936075473 2:109398922-109398944 GTCGTGCGCTGCTCCCACCCAGG + Exonic
938072970 2:128318036-128318058 CCGCCGCGCTGCGCACGCCCAGG - Exonic
938100386 2:128493993-128494015 AGGCTTCGCTGCGCCCACCCTGG + Intergenic
940273408 2:151915366-151915388 GTGCCGCCCTTCCCCCGCCCAGG + Intronic
947399027 2:229714268-229714290 GGGCTGCGCGGCGCACGGCCCGG + Exonic
947641041 2:231708058-231708080 GTGCTGGGCCGCGCTCGCCCCGG - Intronic
948836642 2:240629190-240629212 GTGCTGCTCAGGGGCCGCCCAGG - Intronic
1169276274 20:4235625-4235647 GTGCTGCTCTGCTCACACCCAGG - Intronic
1170562610 20:17570059-17570081 GTCCTGAGGCGCGCCCGCCCCGG + Exonic
1173331366 20:42078694-42078716 GTGTTGTGCTGTGCCCGCACTGG + Exonic
1175776892 20:61659412-61659434 GGGCTGCGCTGCCCCCCACCTGG + Intronic
1176450635 21:6858610-6858632 GCGCTGCCCTGCGCCGGCCCTGG + Intergenic
1176828805 21:13723628-13723650 GCGCTGCCCTGCGCCGGCCCTGG + Intergenic
1178485871 21:33020004-33020026 GGGCTGCGCAGCGCGCGCCCGGG - Intergenic
1178523354 21:33304164-33304186 GTGCTGTGCTGTCCCCGCCGTGG - Intergenic
1178551297 21:33542125-33542147 GTGCCGCGCTGGTCCCGCGCCGG - Intronic
1179988864 21:44935452-44935474 GTGCTGCTCTGCTCCAGCCATGG - Intronic
1179997090 21:44978952-44978974 GTGCGCCACTGCGCCCGGCCAGG - Intergenic
1180960607 22:19760750-19760772 GCGCCGCGCTGCGTGCGCCCCGG - Intronic
1181028665 22:20139698-20139720 CTGATGCACTGCTCCCGCCCAGG + Exonic
1182380424 22:29883268-29883290 GCGCTGCCCAGCGCCGGCCCTGG + Exonic
1182429027 22:30289442-30289464 GTGCTGAGCGTCGCCCGTCCCGG - Exonic
1183591839 22:38783561-38783583 GTGCTGCTCTGTGCCCTCCCTGG + Intronic
1184121348 22:42452600-42452622 GGGCTCAGCTGCACCCGCCCGGG + Intergenic
1184617100 22:45645707-45645729 CTGCTGCGTGGCGCCTGCCCTGG + Intergenic
1184645215 22:45891573-45891595 GCCCTGCCCTGCGCCAGCCCAGG + Intergenic
1184756499 22:46519076-46519098 GTGCTGCGCTGTGCACGACCCGG + Intronic
1184759682 22:46537420-46537442 TTGATGCGCGGCGCCCTCCCGGG - Intergenic
1185138917 22:49089450-49089472 GGGCTGTGCTGGGCCCACCCTGG - Intergenic
1185398502 22:50604420-50604442 CTCCTGCGCCGCGCCCGCCCGGG + Exonic
949848752 3:8399581-8399603 GTGCTCCCTTGCCCCCGCCCAGG + Intergenic
950013924 3:9743137-9743159 GTGCTGTGCTCCGCCAGGCCCGG + Exonic
950460188 3:13116616-13116638 GTGAGGCACTGCGCCCGGCCGGG - Intergenic
950682384 3:14594142-14594164 GTACTGCTCTGAGCCCTCCCAGG + Intergenic
950726624 3:14921240-14921262 CTGCAGCACTGCTCCCGCCCAGG + Intronic
952334355 3:32391965-32391987 GGGCTGGGCCGCGCCGGCCCCGG - Exonic
953099212 3:39809352-39809374 GGGCAGGGCTGCGCGCGCCCGGG - Intronic
954735924 3:52706362-52706384 GTGCTGCGCTGTTCCGGGCCCGG + Intronic
967849502 3:194071218-194071240 CAGCTGCCCCGCGCCCGCCCGGG - Intergenic
967930304 3:194686155-194686177 CTGCTGCGCGGGGCCCGCCGCGG + Intergenic
970397329 4:15681859-15681881 TTGCAGCGCTGGGCCCGGCCGGG + Exonic
973018733 4:45172859-45172881 TTGCTGCCCTTCCCCCGCCCTGG + Intergenic
974213867 4:58818755-58818777 GTGCGCCACTGCGCCCGGCCCGG - Intergenic
974716139 4:65670372-65670394 GAGCTGCGCTGCGGCGGCCCAGG + Intronic
975132987 4:70846773-70846795 GTGAGGCACTGCGCCCGGCCAGG - Intergenic
980392945 4:132169776-132169798 GTGCTGCCCTTCCCCCACCCAGG + Intergenic
980744683 4:136999375-136999397 GTGCTGCCCTTCCCCAGCCCAGG + Intergenic
985532580 5:442920-442942 GTCCAGGACTGCGCCCGCCCTGG + Exonic
985549015 5:523995-524017 GAGCCGCGCGGCGGCCGCCCGGG - Intronic
986492410 5:8306565-8306587 GTGCTGCCCTGCCCCTGCCCTGG - Intergenic
989209501 5:38845702-38845724 GCGCAGCGCTGCTCCTGCCCCGG - Intergenic
990982522 5:61614922-61614944 CTGCTGTGCTGTGCCCTCCCAGG + Intergenic
991972172 5:72151728-72151750 GTGCTGAGCTGGGCTCACCCAGG + Intronic
992820184 5:80488253-80488275 GTTCTGCGCGGCGCGCTCCCAGG - Intronic
993253408 5:85556636-85556658 GTGCCGCCCTTCCCCCGCCCAGG - Intergenic
995594233 5:113731124-113731146 ATGCTGCCCTTCCCCCGCCCAGG + Intergenic
997470566 5:134114886-134114908 ATGGTGCGCTCCGCCCGCCGGGG - Exonic
998157620 5:139795645-139795667 TTGCAGCGCAGCGCTCGCCCCGG - Intergenic
1002191649 5:177481323-177481345 GTGAACCGCTGCGCCCGGCCTGG - Intergenic
1002305174 5:178278889-178278911 GTGACGCGCTGGGCCAGCCCTGG + Intronic
1002540690 5:179904656-179904678 GTGCTGGGCAGGGCCTGCCCTGG - Intronic
1002594653 5:180313987-180314009 GTGCCGCGCTCCGCCAGCCTCGG + Intronic
1004184142 6:13407477-13407499 GTGCTGCTCTGTGCCAGCCTGGG - Intronic
1013538904 6:111088096-111088118 GTGAGGCGCGGCGCCCGCCGAGG + Intronic
1015149246 6:130019924-130019946 GTGCCGCGCCGCGCCGGCCCGGG + Intronic
1017073756 6:150599936-150599958 GGGCTGCGCTGCGCCGGCTCGGG - Exonic
1017146503 6:151240219-151240241 GCGCTGCGACGCGCCAGCCCAGG - Intronic
1019343601 7:519564-519586 GGGCCGCGCTGTGCCCGGCCGGG - Intronic
1019416890 7:931974-931996 GAGCTGCACTGGGCCCCCCCTGG - Intronic
1019933876 7:4241925-4241947 GTGCTGTGCTGCGCCCACCTGGG + Intronic
1020621767 7:10527840-10527862 GTGCTGCCCTTCCTCCGCCCAGG - Intergenic
1022121698 7:27314634-27314656 GTGAGGAGCTGCGCCCGCCTGGG - Intergenic
1028242727 7:88440452-88440474 GTCCTGCTCTGTTCCCGCCCTGG - Intergenic
1028561280 7:92179087-92179109 GTGCTGGGCTGCGCCTGCGGAGG - Exonic
1029177479 7:98675090-98675112 GGGCTGAGCTGCGCCTGCACAGG - Intergenic
1029540849 7:101181025-101181047 GGGCAGCGCTGCACCCACCCGGG - Intergenic
1031804561 7:126292602-126292624 GTGCTGCCCTTCCCCCACCCAGG - Intergenic
1034349124 7:150405165-150405187 TGCCAGCGCTGCGCCCGCCCGGG - Intronic
1034455428 7:151167552-151167574 GTTCGGAGCTGCGGCCGCCCCGG + Intronic
1034478630 7:151303270-151303292 GTGAGCCGCTGCGCCCGGCCGGG + Intergenic
1034991111 7:155548695-155548717 ATGCTGGGCTGGGCCCACCCCGG - Intergenic
1036032671 8:4991544-4991566 CAGCTGCGCCGCGCGCGCCCGGG - Intronic
1036754280 8:11462035-11462057 GTGCAGCGCTGTGCCTGCACTGG + Intronic
1037336937 8:17801181-17801203 GTGCCGCGCCGCGCGCCCCCAGG - Intergenic
1037997152 8:23361179-23361201 GTGAGGCACTGCGCCCGGCCTGG + Intronic
1039685948 8:39801906-39801928 GTGCCGCCCTTCCCCCGCCCAGG + Intronic
1041303560 8:56437746-56437768 GTGCTGCTGTGCGCTGGCCCTGG + Intronic
1044153868 8:88818200-88818222 TTGCTGCGATGCGCCCGCCTCGG + Intergenic
1045823684 8:106371924-106371946 GTGCTGCCCTTCCCCTGCCCAGG + Intronic
1047732088 8:127736308-127736330 GAGCTGCGCTGCGGGCGTCCTGG + Exonic
1048862917 8:138737080-138737102 GCGCTGCGCTGCGGCCCACCAGG + Intronic
1049097749 8:140558816-140558838 GTGCTGTTCTGCGCCCCCCATGG + Intronic
1049103576 8:140597315-140597337 GTGCTGCGCTGCGTTGGCACTGG - Intronic
1049607345 8:143535907-143535929 GTGCTGCGCTGGGCACCCCCAGG - Intronic
1056796965 9:89665219-89665241 GTGCTGGGCAGGGCCCTCCCAGG - Intergenic
1057426073 9:94950813-94950835 CTGCTGCTCTGCCCCCACCCAGG - Intronic
1057773086 9:97984207-97984229 GCGCCGGGCCGCGCCCGCCCAGG - Intronic
1058374284 9:104305151-104305173 GTGCTGCCCTTCCCCCGCCCAGG - Intergenic
1061635548 9:131906379-131906401 GTGCTGCTCTGCTCCGGCACTGG - Intronic
1061801118 9:133113917-133113939 GTGCTGTGCTGGGCTCCCCCAGG - Intronic
1061947216 9:133915003-133915025 GTGCTTCCCTGCTCCCTCCCAGG - Intronic
1062039457 9:134397381-134397403 GAGCTGCTCTGTGCCTGCCCTGG + Intronic
1062049725 9:134441033-134441055 GGGCTGGGCTGCTCCCGGCCTGG + Intergenic
1062421360 9:136484102-136484124 TTGCTGCGCCGGGCCCTCCCAGG + Exonic
1203518547 Un_GL000213v1:25907-25929 GCGCTGCCCTGCGCCGGCCCTGG - Intergenic
1186820781 X:13285528-13285550 GTGCGGCGCTGCCCCCCCACTGG - Intergenic
1189335732 X:40169819-40169841 GTGCAGCGCCGTCCCCGCCCTGG - Intronic
1190172658 X:48123921-48123943 GTGGGTCACTGCGCCCGCCCAGG - Intergenic
1190529582 X:51361533-51361555 GTGCTGCCCTTCCCCTGCCCAGG - Intergenic
1190758638 X:53422267-53422289 TTCCTGCGCGGCCCCCGCCCCGG - Intronic
1194445863 X:93986644-93986666 CTGCTGCCCTGCCCCTGCCCTGG - Intergenic
1197627911 X:128823744-128823766 GTGAGCCGCTGCGCCCGGCCCGG - Intergenic
1200154612 X:153968922-153968944 GTGGTGCCCCGCGCCAGCCCAGG - Intronic
1200686808 Y:6265566-6265588 GGGCTGGGCTGCGCAGGCCCAGG - Intergenic
1200989686 Y:9336482-9336504 GGGCTGGGCTGCGCAGGCCCAGG - Intergenic
1200992355 Y:9356815-9356837 GGGCTGGGCTGCGCAGGCCCAGG - Intergenic
1200995006 Y:9377093-9377115 GGGCTGGGCTGCGCAGGCCCAGG - Intronic
1200997671 Y:9397439-9397461 GGGCTGGGCTGCGCAGGCCCAGG - Intergenic
1201000183 Y:9465975-9465997 GGGCTGGGCTGCGCAGGCCCAGG - Intergenic
1201002842 Y:9486285-9486307 GGGCTGGGCTGCGCAGGCCCAGG - Intronic
1201005498 Y:9506568-9506590 GGGCTGGGCTGCGCAGGCCCAGG - Intergenic
1201008161 Y:9526898-9526920 GGGCTGGGCTGCGCAGGCCCAGG - Intergenic