ID: 1142588719

View in Genome Browser
Species Human (GRCh38)
Location 17:991088-991110
Sequence GATTTGATCTGAAAAGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142588719_1142588722 3 Left 1142588719 17:991088-991110 CCCAATACTTTTCAGATCAAATC No data
Right 1142588722 17:991114-991136 GGATTATAACTTGTACCCCTAGG No data
1142588719_1142588724 16 Left 1142588719 17:991088-991110 CCCAATACTTTTCAGATCAAATC No data
Right 1142588724 17:991127-991149 TACCCCTAGGCCAGGCACAGTGG No data
1142588719_1142588723 8 Left 1142588719 17:991088-991110 CCCAATACTTTTCAGATCAAATC No data
Right 1142588723 17:991119-991141 ATAACTTGTACCCCTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142588719 Original CRISPR GATTTGATCTGAAAAGTATT GGG (reversed) Intergenic
No off target data available for this crispr