ID: 1142589571

View in Genome Browser
Species Human (GRCh38)
Location 17:996637-996659
Sequence CACCTCGTGCTGTCATCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142589571_1142589577 14 Left 1142589571 17:996637-996659 CCGCCCGATGACAGCACGAGGTG No data
Right 1142589577 17:996674-996696 AATGCTCGCGCGTCCCCTCCCGG No data
1142589571_1142589578 22 Left 1142589571 17:996637-996659 CCGCCCGATGACAGCACGAGGTG No data
Right 1142589578 17:996682-996704 CGCGTCCCCTCCCGGCGATCCGG No data
1142589571_1142589582 29 Left 1142589571 17:996637-996659 CCGCCCGATGACAGCACGAGGTG No data
Right 1142589582 17:996689-996711 CCTCCCGGCGATCCGGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142589571 Original CRISPR CACCTCGTGCTGTCATCGGG CGG (reversed) Intergenic
No off target data available for this crispr