ID: 1142589913

View in Genome Browser
Species Human (GRCh38)
Location 17:998858-998880
Sequence CTTCTTTTGCAGTCGGTGTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142589913_1142589917 -6 Left 1142589913 17:998858-998880 CCGTACACCGACTGCAAAAGAAG 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1142589917 17:998875-998897 AAGAAGTGCTGAAAGACATGGGG 0: 1
1: 0
2: 2
3: 22
4: 381
1142589913_1142589918 2 Left 1142589913 17:998858-998880 CCGTACACCGACTGCAAAAGAAG 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1142589918 17:998883-998905 CTGAAAGACATGGGGCAGAGAGG 0: 1
1: 1
2: 5
3: 35
4: 348
1142589913_1142589915 -8 Left 1142589913 17:998858-998880 CCGTACACCGACTGCAAAAGAAG 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1142589915 17:998873-998895 AAAAGAAGTGCTGAAAGACATGG 0: 1
1: 0
2: 0
3: 58
4: 574
1142589913_1142589916 -7 Left 1142589913 17:998858-998880 CCGTACACCGACTGCAAAAGAAG 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1142589916 17:998874-998896 AAAGAAGTGCTGAAAGACATGGG 0: 1
1: 1
2: 3
3: 28
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142589913 Original CRISPR CTTCTTTTGCAGTCGGTGTA CGG (reversed) Exonic
903273838 1:22208528-22208550 CTTCTTTTGAAGTAGGTTTTAGG + Intergenic
910723383 1:90312304-90312326 CTTCTTTTGAGGTAGTTGTAGGG - Intergenic
910806849 1:91196874-91196896 CATCTATTGTAGTCGGTGCAAGG + Intergenic
914901132 1:151711734-151711756 CTTCTTTTGGCGTGGGTGTAGGG - Intronic
915426674 1:155833338-155833360 CTTTTTTTGCAGTGGGAGAATGG - Intronic
916053698 1:161053069-161053091 CTTCTTCTGCTGTCAGTCTAGGG - Intronic
1063093549 10:2889758-2889780 CTTCTGTTGCCGTTGGTTTAGGG - Intergenic
1071161325 10:82749146-82749168 CTTCAGTTGCAGTCGGAGTAGGG + Intronic
1074889436 10:117722843-117722865 CTCCTTTTGCAGATGGTGAAAGG + Intergenic
1076412565 10:130262391-130262413 CTTCCTTTGCAGTCGTTTTCTGG + Intergenic
1078948420 11:16098855-16098877 CTTTTTTTGGAGTTGGGGTATGG + Intronic
1081615523 11:44588510-44588532 CTTATTTTGCAGGCTGGGTACGG - Intronic
1083930344 11:65839632-65839654 CTTATTTTCCAGCCGGTGTGCGG - Intronic
1086564429 11:88209355-88209377 CTTCTTTTGCAGTTGGTTTGGGG + Intergenic
1088794215 11:113253836-113253858 GTTCATTTGCAGTAGGTCTAGGG + Intronic
1089720143 11:120410258-120410280 CTTCTTTTGGAGTCTGATTAGGG + Intronic
1098419072 12:70272091-70272113 CTTCTGCTGCAGTCCTTGTAAGG + Intronic
1107169751 13:37326848-37326870 CTTCTTTTGTATACAGTGTATGG - Intergenic
1110262401 13:73500271-73500293 CTTCTTTTGCATTAGGTGTAAGG - Intergenic
1114785723 14:25596293-25596315 CTCCTTTTGCATTCATTGTATGG + Intergenic
1115508174 14:34112528-34112550 CTTCTTTTGTAGCCACTGTATGG + Intronic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1126270883 15:46815620-46815642 CTTCTCTTGCAGTTGTTGTTGGG - Intergenic
1126519632 15:49577295-49577317 CTTTTTTTGCAGGGGGTGTGGGG - Intronic
1138949240 16:61890857-61890879 CTTCTTTTACAATTGGTCTATGG - Intronic
1142589913 17:998858-998880 CTTCTTTTGCAGTCGGTGTACGG - Exonic
1143709839 17:8726705-8726727 CGTCTTCTGCTGTCGCTGTAAGG - Intergenic
1147317672 17:39628537-39628559 CTTCTTTTCCAGTCTCTGTAAGG - Intronic
1148002773 17:44399584-44399606 CTTCTGGTGCAGCCGGTGTGAGG + Exonic
1149123009 17:53192595-53192617 CTTCATTTGCAGTAGTTGAATGG - Intergenic
1151335741 17:73438664-73438686 CTTCTCTTGCAGTTGGGGAATGG - Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1154215501 18:12412978-12413000 CTGCTTCTGCAGTCTGTGTTTGG + Intronic
1157952154 18:52051554-52051576 CTTCTTTTTCTGTCGCTTTAAGG + Intergenic
1163019918 19:14476441-14476463 CTTCTTGTGCCTTGGGTGTACGG - Intergenic
927875372 2:26651701-26651723 CTTATTTTGAAGTCTGTGTCAGG - Intergenic
931460787 2:62448480-62448502 CTTCTTTTCCAGTGGGTAGAAGG - Intergenic
936777921 2:115996120-115996142 CTTCTTCTGCAGTGGCTTTAGGG - Intergenic
937994426 2:127681768-127681790 CTTCTTTTGCAGTCTGTCCGTGG - Intronic
938248876 2:129798543-129798565 CTTCTTCTGCATTCGGTGCAAGG + Intergenic
939892962 2:147759380-147759402 CTTCTATTTCATTAGGTGTATGG + Intergenic
940529608 2:154864290-154864312 CTGCTCTTGCAGTCTGTGAAGGG + Intergenic
944384356 2:199148058-199148080 CTTCTGTTTCAGTCTGTTTAGGG - Intergenic
946028579 2:216687616-216687638 CTTCTTTTGGAGTTGGGGAAGGG + Intronic
1170055774 20:12200978-12201000 GTTCCTTTTCAGTCTGTGTACGG - Intergenic
1171720862 20:28561979-28562001 TTTATTGTGCAGTCAGTGTATGG - Intergenic
1171757204 20:29121575-29121597 TTTATTGTGCAGTCAGTGTATGG + Intergenic
1177019526 21:15836902-15836924 CATCCTTTGCTGTCAGTGTAGGG + Intronic
1180140274 21:45889296-45889318 CGACTTTTGCAGTCGGAGGAAGG - Intronic
970904261 4:21197149-21197171 ATTCTATTGCAGTGGGTGTCTGG + Intronic
971712810 4:30138615-30138637 TTTCTTTAGCAGTCAATGTAAGG + Intergenic
974462917 4:62211347-62211369 CTTTTTTTGCAGTTTTTGTAAGG + Intergenic
979322818 4:119343847-119343869 CTTCTTTTGCAGTCCATTGATGG + Intergenic
979777649 4:124611253-124611275 CTTCTTTTGCTGTCTATGTGAGG - Intergenic
980489652 4:133508286-133508308 CTTCTTTTGCATTTGCTGTGGGG - Intergenic
982147960 4:152418294-152418316 CTTATTTTTCAGTCTCTGTAAGG + Intronic
983240660 4:165228496-165228518 CTTCTTTTGCAGTCCATTGATGG + Intronic
987405370 5:17518931-17518953 ATTCTTTTGCAGTTGCTGTTGGG - Intergenic
987405817 5:17522365-17522387 ATTCTTTTGCAGTTGCTGTTGGG - Intergenic
987406264 5:17525799-17525821 ATTCTTTTGCAGTTGCTGTTGGG - Intergenic
987406710 5:17529233-17529255 ATTCTTTTGCAGTTGCTGTTGGG - Intergenic
987407435 5:17585172-17585194 ATTCTTTTGCAGTTGCTGTTGGG + Intergenic
987408136 5:17590374-17590396 ATTCTTTTGCAGTTGCTGTTGGG + Intergenic
987409037 5:17597242-17597264 ATTCTTTTGCAGTTGCTGTTGGG + Intergenic
989197505 5:38730268-38730290 CTTCTTTTGCAACTGCTGTATGG + Intergenic
989851291 5:46214668-46214690 CTTCTTTTGGAATCTGTGCAGGG + Intergenic
990684038 5:58279225-58279247 CTACTTTTGCAGGCAGTGTATGG - Intergenic
994233732 5:97338098-97338120 CTACCTTTGCAGTTGGTGGATGG + Intergenic
999169126 5:149578386-149578408 CTTCTTTTGCCTGAGGTGTATGG - Intronic
1004337068 6:14773755-14773777 CTACTTTTGCATGCTGTGTAAGG + Intergenic
1004566778 6:16805359-16805381 ATTCTGATGCAGTCGGTGTGGGG + Intergenic
1016109254 6:140201581-140201603 CTTATTTTTCACTCAGTGTAGGG + Intergenic
1016317188 6:142803811-142803833 CTTCTTTGGCACCCAGTGTATGG + Intronic
1016802783 6:148183441-148183463 CTTGCTTTGCAGTCAGTGTGAGG - Intergenic
1018174929 6:161170239-161170261 CTTGTTTAGCAGTCTCTGTAGGG - Intronic
1018197420 6:161367346-161367368 TTTCTTTTGCAGTGGGGGTGGGG + Intronic
1023248241 7:38230430-38230452 CTTGTTTTGCATTATGTGTATGG + Exonic
1028029588 7:85893464-85893486 CTTTCTTTGAAGTGGGTGTAAGG - Intergenic
1028682814 7:93556752-93556774 ATTCTTTTGAAATAGGTGTATGG + Intronic
1030503060 7:110384437-110384459 CTTTTTCTGCAGTCAGTTTAAGG - Intergenic
1032450135 7:132023605-132023627 CTTGTTTTGGAGACAGTGTAGGG + Intergenic
1034048697 7:147958888-147958910 ATTTTTTTGCAGTAAGTGTAGGG + Intronic
1040956793 8:52988040-52988062 CTTCTGTTGCAGTCGGTCACTGG + Intergenic
1044265609 8:90177887-90177909 CTTCTTTTGCAGTTGGTTGGGGG + Intergenic
1044637959 8:94345930-94345952 CTTCTTTTTCACTCAGTGAAAGG - Intergenic
1048657763 8:136560612-136560634 CTTCTTTTGATGTCGTTGTCTGG + Intergenic
1057136561 9:92693627-92693649 CTGCTTTTGGAGTCTGTGTCAGG + Intergenic
1059298618 9:113295151-113295173 CATCTTTTGTAGTCAGTGGAGGG - Intergenic
1202801292 9_KI270720v1_random:1770-1792 TTTATTGTGCAGTCAGTGTATGG - Intergenic
1187094168 X:16128944-16128966 TTTCTTTTCCAGTAAGTGTAAGG + Intronic
1191966994 X:66769584-66769606 CTTGTTATGCATTCGGTATATGG + Intergenic