ID: 1142591166

View in Genome Browser
Species Human (GRCh38)
Location 17:1006738-1006760
Sequence CCCGGGCCCGTGGCTGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 7, 1: 0, 2: 2, 3: 31, 4: 529}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142591166_1142591177 10 Left 1142591166 17:1006738-1006760 CCTCCGCCAGCCACGGGCCCGGG 0: 7
1: 0
2: 2
3: 31
4: 529
Right 1142591177 17:1006771-1006793 GTACCTGCGCCATGACGTCATGG 0: 6
1: 1
2: 0
3: 3
4: 35
1142591166_1142591178 11 Left 1142591166 17:1006738-1006760 CCTCCGCCAGCCACGGGCCCGGG 0: 7
1: 0
2: 2
3: 31
4: 529
Right 1142591178 17:1006772-1006794 TACCTGCGCCATGACGTCATGGG 0: 6
1: 1
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142591166 Original CRISPR CCCGGGCCCGTGGCTGGCGG AGG (reversed) Intronic