ID: 1142591226

View in Genome Browser
Species Human (GRCh38)
Location 17:1006933-1006955
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 7, 1: 0, 2: 2, 3: 31, 4: 529}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142591226_1142591238 11 Left 1142591226 17:1006933-1006955 CCTCCGCCAGCCACGGGCCCGGG 0: 7
1: 0
2: 2
3: 31
4: 529
Right 1142591238 17:1006967-1006989 TACCTACGCCATGACGTCATGGG 0: 1
1: 6
2: 0
3: 3
4: 12
1142591226_1142591237 10 Left 1142591226 17:1006933-1006955 CCTCCGCCAGCCACGGGCCCGGG 0: 7
1: 0
2: 2
3: 31
4: 529
Right 1142591237 17:1006966-1006988 GTACCTACGCCATGACGTCATGG 0: 1
1: 6
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142591226 Original CRISPR CCCGGGCCCGTGGCTGGCGG AGG (reversed) Intronic
900072101 1:779112-779134 CCCCGGGCCCTGGCTGGGGGAGG - Intergenic
900103877 1:974080-974102 CCCGGGCTCCGGGCTGGCCGGGG + Intronic
900240743 1:1616148-1616170 TTCGTGCCCGTGGCTCGCGGAGG - Intronic
900307811 1:2019574-2019596 CCGGGGCCCGGGGCTCGCGCCGG - Intronic
900339168 1:2179733-2179755 CCCGGGCCCAGGGCTGCTGGTGG + Intronic
900349625 1:2228392-2228414 CGCGGGCCCGGGGCTCGCGGGGG - Intergenic
900371988 1:2336297-2336319 CGCGAGACCCTGGCTGGCGGGGG + Intronic
900387783 1:2418469-2418491 CCCGGGGCCATGGCTGGCATTGG + Intergenic
900695177 1:4005277-4005299 CCCGGGGTCCTGGCTGGCAGGGG - Intergenic
900710371 1:4109585-4109607 CCCGGGCCAGTGGCAGGCTGGGG - Intergenic
902286310 1:15410483-15410505 CCCCGGCCCCTGGCACGCGGCGG + Intronic
902585734 1:17437958-17437980 CCCGGGCCCGCGGCGGGGGAGGG - Intronic
903263165 1:22142270-22142292 CCAGGGCCCGGGGCTGGCGCTGG - Intronic
903350081 1:22711706-22711728 CGCGGGGCGGTGGCCGGCGGGGG - Intronic
904288699 1:29470274-29470296 CCCGGCCCTGGGGCTGGCGCTGG - Intergenic
905066969 1:35192466-35192488 CCCGGGCCCGGGACTGCCGCGGG + Exonic
905375635 1:37518390-37518412 CCCGGGCCAGTGGCTGCAGAGGG + Intergenic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
905626222 1:39491933-39491955 CCCGGGCCCAGGGGCGGCGGCGG + Exonic
905774783 1:40661576-40661598 GCCGGGCCCAGGGCTGGCTGGGG - Intronic
906168962 1:43707768-43707790 CCGGGACCCGCGGCCGGCGGGGG - Intronic
906519516 1:46458870-46458892 CCCTGGTCCCTGGCTGGGGGTGG + Intergenic
908291341 1:62670028-62670050 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
908501116 1:64744908-64744930 CCGGGGCCGGGGGCCGGCGGGGG + Intergenic
909169917 1:72282437-72282459 CTCGAACCAGTGGCTGGCGGCGG - Exonic
909904563 1:81178829-81178851 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
911305231 1:96224560-96224582 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
912312874 1:108641091-108641113 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
912819370 1:112854735-112854757 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
913161063 1:116146777-116146799 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
913222139 1:116667869-116667891 CCCGGCCCCGGGCCTGGCGGGGG + Intergenic
913692107 1:121289326-121289348 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
914145449 1:144990788-144990810 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
914928064 1:151906275-151906297 CCCGGGCCAGTGGCTGCAGAGGG + Intronic
917817641 1:178725982-178726004 TCCGGGGCCGGGGCTGGCGGGGG - Intronic
920479430 1:206307674-206307696 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
921801811 1:219410790-219410812 CCCGGGCCAGTGGCTGTGGAGGG + Intergenic
921903832 1:220475891-220475913 CCCGGGCCAGCGGCTGCGGGGGG - Intergenic
922267037 1:223993067-223993089 CCCCGGGCCCTGGCTGGGGGAGG - Intergenic
922855797 1:228773843-228773865 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
922951009 1:229558539-229558561 CCCGGGAACGCGGCTGGCCGCGG + Exonic
922985882 1:229865594-229865616 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1064197794 10:13259744-13259766 CCCGGGCCAGTGGCTGCAGAGGG + Intergenic
1066186308 10:33013430-33013452 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1066190265 10:33049364-33049386 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1066437550 10:35407960-35407982 CCCGAGTCCGTGACTGGCGCTGG + Intronic
1066567398 10:36734841-36734863 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1067669733 10:48307406-48307428 CCCAGGCCCGTGGCTCGGGTGGG + Intronic
1067694203 10:48523739-48523761 CCAGGGCCCGGGGCTGGCCGCGG - Intronic
1068669678 10:59710110-59710132 CCAGGGCACGTGGTGGGCGGCGG - Intronic
1068954975 10:62813985-62814007 CCTGGGTCCGTGGCTGGCTTGGG + Exonic
1069788521 10:71004890-71004912 CCTGGGCCCGTGGCTGTGGCTGG + Intergenic
1071003762 10:80859378-80859400 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1071037477 10:81265136-81265158 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1071086631 10:81874547-81874569 CCCCAGCCCCTGGCTCGCGGCGG + Intergenic
1071997738 10:91163564-91163586 CCGGGGCGCGCGGCTGCCGGCGG - Intronic
1072188613 10:93063429-93063451 CCTGGGTCCGGGGCTGGCGCTGG - Intronic
1073156889 10:101354326-101354348 CCCTGGGCCGAGGCTGGCGGCGG + Intronic
1074056051 10:109923561-109923583 CCCTCGCCCGTGGCGGGCGCTGG + Intergenic
1074057788 10:109938385-109938407 CCCGGAGCAGTGCCTGGCGGAGG + Intergenic
1074523911 10:114248433-114248455 CCAGGGCCCGTGGAGGGCTGGGG + Intronic
1074585895 10:114767917-114767939 CCCGGGCTCGGGGCTGCCGGGGG - Intergenic
1074999237 10:118783041-118783063 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1076622934 10:131804295-131804317 CCCTGCCCTGTGGCTGGCTGTGG + Intergenic
1076784910 10:132745030-132745052 CCCGAGCCAGTGGCTGGCTCAGG + Intronic
1076792599 10:132785200-132785222 GCGGGGCCCGGGGCTGGCGCTGG + Intronic
1076930670 10:133529717-133529739 CGCGGGCTGGTGGCGGGCGGGGG + Intronic
1076994981 11:293411-293433 CCCCAGCCAGTGGCTGGCGGTGG + Exonic
1077008396 11:369598-369620 CGCGGGCCCGGGGTGGGCGGCGG - Intergenic
1077008405 11:369609-369631 CCCGGGCCCGCGGCCGAGGGCGG + Intergenic
1077360405 11:2138133-2138155 CCCGGGCCGGGAGCGGGCGGAGG + Intronic
1077637834 11:3855620-3855642 GGCGGGCCCGGGGCGGGCGGGGG - Intronic
1078141112 11:8693687-8693709 CCAGGGCCCGGGACTGGCAGCGG + Exonic
1078474980 11:11622194-11622216 CCCGGGCGCGTCCCTGGGGGCGG - Intergenic
1078743691 11:14091549-14091571 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1079124287 11:17707974-17707996 CCAGGGCCAGGGGCTGGGGGAGG - Intergenic
1080195192 11:29600368-29600390 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1080621448 11:33990238-33990260 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1081126936 11:39333291-39333313 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1081420900 11:42874056-42874078 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1081422071 11:42881521-42881543 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1082283639 11:50298138-50298160 CCCCGGGCCCTGGCTGGGGGAGG + Intergenic
1083428783 11:62602925-62602947 CTCTGGGCCGTGGGTGGCGGTGG - Intronic
1083437573 11:62653178-62653200 CGCGGGACCGTGGGTGGCCGGGG + Exonic
1083827428 11:65211479-65211501 CCCGAGCCCATGGCTGGCACAGG - Exonic
1084008181 11:66334084-66334106 CCTGGGCCCGGGCCAGGCGGAGG + Exonic
1084128615 11:67118017-67118039 CCCTGGGCCGTGGCGGGCGCGGG - Intergenic
1084188989 11:67490464-67490486 ACCGGGCCCTGGGCTGCCGGGGG + Intronic
1084412081 11:69011122-69011144 CGGGGGCACGTGGCTGGCTGAGG - Intronic
1084486206 11:69449768-69449790 CCCGGCCCGGTGGCTGGCTTGGG - Intergenic
1084575615 11:69986233-69986255 CCAGGGGCAGTGGCTTGCGGAGG + Intergenic
1084642935 11:70436651-70436673 CCCCGGACCTGGGCTGGCGGAGG + Intergenic
1084668682 11:70592498-70592520 CCCCTGGCCGTGGCTGGAGGGGG - Intronic
1084712621 11:70853283-70853305 CCAGGGCCCGTGGGAGGCGCCGG - Intronic
1085332759 11:75667537-75667559 ACCGGCCCCGAGGCTGGCAGGGG - Exonic
1085353448 11:75815441-75815463 GCCGGGCCCGGGGGTGGCTGGGG - Exonic
1085375888 11:76060703-76060725 CCCGGGCCAGTGGCTGCCGAGGG + Intronic
1085447242 11:76609251-76609273 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1086210120 11:84308758-84308780 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1087354544 11:97076739-97076761 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1088797232 11:113274175-113274197 CCCAGGCCCGTGGCAGGGGAGGG + Intronic
1089146091 11:116330610-116330632 ACTGGGCCCTTGGCTGGCAGAGG - Intergenic
1089195461 11:116691919-116691941 CCCGGGCACCTGGCTGGCCTGGG - Intergenic
1089373570 11:117978709-117978731 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1089432682 11:118436636-118436658 CCCGGGCCCCCGGTCGGCGGTGG + Exonic
1089494865 11:118902799-118902821 CCAGGGGCCGGGGGTGGCGGCGG + Exonic
1089513845 11:119018981-119019003 CTCGGGCCCGTGGCGGGTGCGGG + Intronic
1089527712 11:119107843-119107865 CCGGGGCTTGTGGCTGGCGCGGG + Exonic
1089528673 11:119112898-119112920 CCCGGGCCCCTGGCTAGAGCTGG - Intronic
1089533943 11:119149465-119149487 CGCGGGCCCGGGGGTGCCGGCGG + Intronic
1089590214 11:119535316-119535338 CCGGGCTCCGTGGCTGGCAGAGG - Intergenic
1090188119 11:124751569-124751591 CCCGGCCCCAGGGCTGGCCGTGG - Exonic
1090307681 11:125704924-125704946 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1090403963 11:126466352-126466374 CCTGGGCCCCTAGCTCGCGGGGG + Intronic
1090776720 11:129972043-129972065 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1091207894 11:133833471-133833493 CTCGGGCCCGTGGATGACGTGGG + Intergenic
1091399731 12:174725-174747 CCCGGGGGCGTGGGTGGCGGCGG - Exonic
1091434044 12:459972-459994 GCCCGGTCCGGGGCTGGCGGGGG + Intergenic
1091703236 12:2677659-2677681 CCCGAGGCTGTGGCTGGCTGGGG + Intronic
1092221404 12:6716175-6716197 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1092272927 12:7037559-7037581 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1092617150 12:10225850-10225872 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1093527085 12:20115451-20115473 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1093970219 12:25369505-25369527 CCCGGGCCAGCGGCTGCGGGGGG + Intergenic
1094040252 12:26114406-26114428 CCCGGGGCGCTGGCGGGCGGCGG - Intergenic
1094448725 12:30561772-30561794 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1094661286 12:32472430-32472452 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1094666490 12:32525812-32525834 CCCGGGCCAGTGGCTGCAGAGGG + Intronic
1096413225 12:51391759-51391781 CCCGGGCCCGCAGCAGGCTGAGG - Intronic
1097128937 12:56796061-56796083 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
1097357839 12:58621368-58621390 CCCGGGCAGGTGGCAGGTGGAGG + Intronic
1099202073 12:79689917-79689939 CCCCGGCCCGCGGCGGTCGGAGG - Exonic
1099559617 12:84155343-84155365 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
1100211881 12:92406740-92406762 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1100362928 12:93894711-93894733 CACGGGCCGGCAGCTGGCGGGGG - Intronic
1100565519 12:95790531-95790553 CCCGGGCACCTGGGGGGCGGCGG + Exonic
1100819748 12:98420214-98420236 CCCAGGCACGTGGCTTGCGCTGG - Intergenic
1101021627 12:100559520-100559542 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1101461959 12:104905734-104905756 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1101910525 12:108857554-108857576 CCCGGGCCCGGCCCGGGCGGCGG - Exonic
1102007527 12:109597949-109597971 GCCGGGCCCAAGGCTGGCGTGGG - Exonic
1102101275 12:110281013-110281035 CGCGGTCGCGGGGCTGGCGGAGG - Intronic
1102124454 12:110468993-110469015 GCCGGGACCGAGGGTGGCGGCGG + Exonic
1102197149 12:111033959-111033981 CCCGGGCCCGTTGGCGGCGGCGG + Intergenic
1103899344 12:124295350-124295372 CCGGGGCCCGGGGCAGGCGGCGG - Intronic
1104582642 12:130022193-130022215 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1104749241 12:131227950-131227972 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1104977741 12:132559861-132559883 CCCGGGCCGGCGGCGGGCGCGGG + Intronic
1105037754 12:132938892-132938914 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1106419034 13:29570235-29570257 CCCAGGCACGTGGCAGGCCGTGG - Intronic
1106617062 13:31339888-31339910 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1106643429 13:31609049-31609071 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1106810951 13:33358119-33358141 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1108099176 13:46936277-46936299 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1108751531 13:53452615-53452637 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
1108804071 13:54132422-54132444 CCCGAGTCCGTGACTGGCGCCGG + Intergenic
1108851612 13:54737498-54737520 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1109141049 13:58714221-58714243 CCCGGGCCAGTGGCTGCAGAGGG + Intergenic
1112518648 13:100077654-100077676 CCCGGGCCAGTGGCTGTGGAGGG + Intergenic
1113538130 13:111084094-111084116 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1113567688 13:111328655-111328677 CCCGGGCCAGTGGCCGGGTGTGG + Intronic
1113660408 13:112103658-112103680 CGCGGGCCCGTGGCCTGGGGAGG - Intergenic
1113678057 13:112221855-112221877 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1113779558 13:112968565-112968587 CGTGGGTCCGTGGCTGGCCGGGG - Intronic
1114560305 14:23585104-23585126 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1116624018 14:47242582-47242604 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1117302513 14:54443190-54443212 CCCGGGCCAGTGGCTGCAGAGGG + Intergenic
1117571921 14:57056837-57056859 CCCGGGCCAGTGGCTGCAGAGGG - Intergenic
1117690399 14:58299358-58299380 CGCGGGCCCGGGGCGGGCCGAGG + Intronic
1118339094 14:64879819-64879841 CCCGAGCCCGGGGGTGGCGGCGG + Exonic
1119486781 14:74994287-74994309 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1119731951 14:76956670-76956692 CCCCGGCCCGCGGCGGGCGAGGG - Intergenic
1122211635 14:100177853-100177875 CCTGGGGACCTGGCTGGCGGGGG - Intergenic
1122776277 14:104118275-104118297 CCCCGGCCCCTGGCTGGAGGTGG - Intergenic
1122953000 14:105056235-105056257 CACAGGCCTGTGGCGGGCGGCGG + Intronic
1124500452 15:30223312-30223334 GCCGGGGCCGGGGCCGGCGGAGG + Intergenic
1124743122 15:32315355-32315377 GCCGGGGCCGGGGCCGGCGGAGG - Intergenic
1124952647 15:34337873-34337895 GTCGGGCCCGGGGCTGGGGGAGG - Intronic
1124973668 15:34514512-34514534 CCCCGGCCCGGGACTGCCGGAGG - Intergenic
1126626068 15:50686772-50686794 CCCAGCCCCGTCGCCGGCGGAGG - Exonic
1127674638 15:61228293-61228315 CCCGGCGCCCAGGCTGGCGGGGG - Intronic
1128028654 15:64460790-64460812 CCGGGGCCCCGGGCGGGCGGAGG + Intronic
1128110847 15:65075163-65075185 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1128199530 15:65792508-65792530 CCCGAGCCCCAGGCTGGCGTGGG + Intronic
1128598570 15:68975891-68975913 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1129859167 15:78847012-78847034 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1130554160 15:84911131-84911153 CGCGGGCCAGTGGTGGGCGGGGG - Intronic
1132109293 15:99090489-99090511 CCCGGGCCCATGGCTGCCTGGGG + Intergenic
1132513398 16:354706-354728 CCTGGGCCCTTGGCAGGCTGGGG - Intergenic
1132648438 16:1009792-1009814 CCCGGCCCCAGTGCTGGCGGAGG + Intergenic
1132723965 16:1330872-1330894 GCCGGGCCGGTGGCGGGGGGCGG - Intergenic
1132793479 16:1706699-1706721 CCGGGGCCCGGGGCTGGCTGGGG - Intronic
1132889481 16:2196743-2196765 CCCGGGCGCGCGGCCGGCGCGGG - Intergenic
1133937884 16:10283854-10283876 CCCGAGTCCGTGACTGGCGCCGG - Intergenic
1136146801 16:28320926-28320948 CCCGGGTCCGAGGGCGGCGGAGG - Exonic
1136397929 16:30003182-30003204 CCCAGGTCCATGGCTGTCGGGGG + Intronic
1136418681 16:30118627-30118649 CCAGGGGCCCTGGCTGGAGGAGG - Intronic
1136858640 16:33681135-33681157 CCCGGGGCCGGGGGTGGGGGGGG + Intergenic
1137655358 16:50153963-50153985 CCCAGGCCCCGGGCTGGTGGTGG - Exonic
1138478012 16:57283610-57283632 TCCGGGCCTGTGGCTGGTGTGGG + Intronic
1139446252 16:67000466-67000488 CTGGGCCCCGGGGCTGGCGGAGG + Intronic
1139469364 16:67170105-67170127 CCCGGGTCCAGGGCTGGCGCGGG + Intergenic
1139511411 16:67430505-67430527 CCTGGGACAGGGGCTGGCGGGGG - Intergenic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1139705348 16:68737404-68737426 CAAGGGCCCATGGCTGGCCGGGG - Exonic
1140091937 16:71846020-71846042 TCCGGGGCCGGGGATGGCGGCGG + Exonic
1141585080 16:85028160-85028182 CCCGGGCCGCTGCCTGGAGGAGG + Intronic
1141721178 16:85756140-85756162 CCCGGGCCCCTGGCAGGCACTGG + Intergenic
1141972381 16:87492546-87492568 CCCGCGCCCGTGCCCAGCGGCGG + Intergenic
1141980593 16:87547683-87547705 CCCTGGCCTCTGGCTGGCTGTGG - Intergenic
1142070799 16:88090528-88090550 AGCCGGCCCGTGGCTGGCGTGGG + Intronic
1142139756 16:88467654-88467676 CCAGAGCCCGTGACTGGAGGAGG - Intronic
1142263858 16:89054652-89054674 CCCAGGCCCCAGGCTGGAGGAGG + Intergenic
1142591166 17:1006738-1006760 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591186 17:1006803-1006825 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591206 17:1006868-1006890 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591226 17:1006933-1006955 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591246 17:1006998-1007020 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591266 17:1007063-1007085 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591286 17:1007128-1007150 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142611092 17:1109482-1109504 TGCGGGGCCGCGGCTGGCGGAGG + Intronic
1142614193 17:1125451-1125473 GCCGGGGCCATGGCTGCCGGGGG - Intronic
1142699274 17:1649538-1649560 GCCGGCCCCGTGGGTGGCGAAGG + Intronic
1142844315 17:2660406-2660428 CCCGGGCCTGTTGGTGGGGGTGG - Intronic
1143078541 17:4365636-4365658 CCGGAGCCCGTGCCAGGCGGAGG + Intronic
1144782212 17:17813943-17813965 CCCGGGCCGGTGGCGGGTGTGGG - Intronic
1145064885 17:19755616-19755638 ACCAGGCCCCTGGCTGGCTGTGG - Intergenic
1146058737 17:29593638-29593660 CTCGGGCCCCTTCCTGGCGGAGG - Exonic
1147139585 17:38453782-38453804 CCCGGGCCCGCGGCTCCGGGGGG + Intronic
1147648863 17:42050669-42050691 CCCGGGACCCTGGCCGGCGCTGG - Intronic
1147754752 17:42761090-42761112 TCGGGGCCCGCGGCTGGAGGGGG - Intronic
1148051193 17:44770632-44770654 CCTGGGCCTGTGGTTGGCTGAGG - Intronic
1148111589 17:45147539-45147561 CCGGGGCCGGGGGCGGGCGGGGG - Intergenic
1148769042 17:50056428-50056450 CCGGGGCCCATGGCTGCCAGCGG - Exonic
1148846848 17:50534511-50534533 CCCCAACCCGTGGCTGGGGGTGG - Intronic
1149598033 17:57875454-57875476 CCCGGCCCCTTGGCTGGCACTGG + Intronic
1149660889 17:58333382-58333404 CCAGGGCCCCTGGCTGGGGGAGG + Intergenic
1151659279 17:75510074-75510096 CCCGGGCCTGGCGCTGGGGGTGG + Intronic
1151805959 17:76405476-76405498 CCCAGGCCCGGGGCTGGGGTGGG + Intronic
1152035518 17:77869889-77869911 CCCCGGCCTGAGGCTGGCAGGGG - Intergenic
1152212438 17:79009611-79009633 TCCGGGCCCGTGGCTGGGGCAGG + Intronic
1152224523 17:79086458-79086480 CCCGGTCCCGGGGCTGGGGTGGG + Exonic
1152349675 17:79777891-79777913 GGCGGGCCCCTGGCTGGGGGAGG - Intergenic
1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG + Exonic
1153519688 18:5940010-5940032 TCGGGGCCCTTGGCTGGCAGGGG + Intergenic
1153644054 18:7178887-7178909 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1154358595 18:13641585-13641607 CCGGGGCCTGTGGCGGGCGAGGG + Intronic
1155208049 18:23577852-23577874 CCCGGGCCAGTGGCTGCAGAGGG - Intronic
1155772878 18:29723656-29723678 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1155856376 18:30839380-30839402 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1157085971 18:44580872-44580894 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1157279027 18:46333939-46333961 CGCGGGCGCGCGGGTGGCGGAGG - Intronic
1157464193 18:47930518-47930540 GCCGGGCCCGGGCCTGGGGGCGG - Exonic
1157764349 18:50285748-50285770 CCCGGGCCCGCAGCTGGCACTGG + Exonic
1158705753 18:59790673-59790695 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
1158976594 18:62716005-62716027 CCCGTACCCGGGGCCGGCGGCGG + Exonic
1159947754 18:74456962-74456984 CCCGGGGACTTGGGTGGCGGTGG - Intronic
1160006446 18:75072562-75072584 CCAGAGCCCGTGGGTGGCCGTGG + Intergenic
1160719301 19:590350-590372 GCCGGGGCCGGGGCCGGCGGAGG + Exonic
1160779718 19:872422-872444 CCCGGGCCCGCAGCTGTAGGAGG - Intronic
1161063763 19:2227828-2227850 CCCGAGCCCGCTGCAGGCGGCGG + Intronic
1161134453 19:2611432-2611454 CCCAGGACCGTGGCAGGAGGGGG + Intronic
1161469084 19:4447508-4447530 CCCGGGGCCCAGGCTGGGGGTGG - Intronic
1161560391 19:4969505-4969527 CCCGGGCCGGGGGCGCGCGGGGG + Intronic
1162257039 19:9498830-9498852 CCCGGGGGCGGGGCTGGAGGTGG + Intergenic
1162818274 19:13208812-13208834 CCCGAGCCCGTGCCCGGCCGTGG + Exonic
1162824762 19:13244667-13244689 CCCAGGCCCGGGGCTAGAGGAGG + Intronic
1162935563 19:13979921-13979943 CCAGGGACGGAGGCTGGCGGAGG + Intronic
1163118236 19:15200707-15200729 CCCAAGGCCGGGGCTGGCGGGGG - Intronic
1164975796 19:32571727-32571749 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1165743846 19:38218864-38218886 CCCGGGCTGGTGGCAGGCAGGGG + Intronic
1166222838 19:41376713-41376735 CCCGGGCCCGCTGCGCGCGGGGG - Exonic
1166230889 19:41425430-41425452 CCCAGGCCCCTGGCTGGGGGAGG + Exonic
1166358678 19:42242531-42242553 CCAGGGCCCGGGGGAGGCGGCGG - Exonic
1166649721 19:44563426-44563448 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1166806895 19:45492913-45492935 CCTGGGGCCGAGGCTGGGGGAGG + Intronic
1166882948 19:45940224-45940246 CTCGGGGCCGGGGCGGGCGGCGG - Exonic
1167134425 19:47608661-47608683 CCCGGGACTGGGGCTGGGGGCGG + Intronic
1167276509 19:48543407-48543429 CCCTGGCCCGAGGCAGGAGGAGG + Intergenic
1167587642 19:50384013-50384035 CCCGGGCGAGAGGCGGGCGGGGG + Intergenic
1168281579 19:55308767-55308789 GCGGGGGCCGTGGGTGGCGGGGG + Intronic
1168315708 19:55483902-55483924 CCCGGGCCCCGGGGAGGCGGGGG + Exonic
926027356 2:9556308-9556330 CCCGGGGCCGGGGGGGGCGGGGG - Intergenic
926035169 2:9630687-9630709 CCGCGGCCCGCGGCTGGAGGAGG + Intronic
926042109 2:9681592-9681614 CCTGGGCCCATGGCAGGCAGAGG - Intergenic
926096005 2:10080694-10080716 GCCGGGCCCGTGGGAGGCCGCGG + Intronic
926198574 2:10777944-10777966 CCCGGGCGCCTGGCTGGAGGTGG + Intronic
928313795 2:30231343-30231365 CCCGGGGCCGTGGTTCGCTGCGG - Intergenic
929452870 2:42048320-42048342 CCCGGACCCGGGGCCGGCGAAGG - Exonic
929889857 2:45910045-45910067 CCTGGGCACTTGGCTGGGGGGGG - Intronic
932359520 2:71092709-71092731 CCCGGGCCAGTGGCTGCAGAGGG - Intergenic
932486477 2:72087020-72087042 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
932521772 2:72421966-72421988 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
932567930 2:72921054-72921076 CCTGAGCCCCTGGCCGGCGGCGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
936288323 2:111198877-111198899 ACCGGGCTCGTGGCTGGCCCTGG - Intergenic
937261171 2:120587467-120587489 CCGGGGCCACGGGCTGGCGGCGG - Intergenic
937746598 2:125422387-125422409 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
937991400 2:127664300-127664322 ACCTACCCCGTGGCTGGCGGCGG + Exonic
940650484 2:156436157-156436179 ACCGGGGCCGGGGTTGGCGGGGG - Intronic
941705869 2:168657660-168657682 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
941820793 2:169841672-169841694 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
941911857 2:170771329-170771351 CCGGGCCCCGTGGCTGCCAGGGG + Intergenic
942451022 2:176107992-176108014 CCCAGGACCGGGGCTGGTGGCGG + Exonic
944728602 2:202497049-202497071 CCCGGGCCAGCGGCTGCGGGGGG + Intronic
945404006 2:209423788-209423810 CCCGGGCCAGCGGCTGGGCGGGG + Intergenic
945745783 2:213718630-213718652 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
945955439 2:216081947-216081969 CCAGGGACCGACGCTGGCGGAGG - Exonic
946219966 2:218217556-218217578 CCCGGGGCCGGGGGTGGCGGGGG + Intronic
946358082 2:219201649-219201671 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
947503441 2:230689031-230689053 CCCGGGCAGGTGGCAGGTGGAGG + Intergenic
947623442 2:231604959-231604981 TCCTGGCCCGGGGCAGGCGGGGG + Intergenic
947992162 2:234496689-234496711 CCCGGGGCCGGTGCGGGCGGCGG - Exonic
948887875 2:240893027-240893049 CCTGGGCCAGTGTCAGGCGGGGG - Intronic
948890958 2:240906904-240906926 CCCGGGGCCGCTGCTGGCTGTGG + Intergenic
948890978 2:240906982-240907004 CCCGGGGCCGCTGCTGGCTGTGG + Intergenic
948893739 2:240918897-240918919 CCTGGGCCCGGGGCTGGCCAAGG + Intronic
948893813 2:240919107-240919129 CCTGGGCCCGCGGCTGGCCAAGG + Intronic
949052614 2:241905227-241905249 CCCGGGCCCGTCACTGGTGCTGG + Intergenic
1168935402 20:1661205-1661227 CCTTGGCCAGTGGCTGGTGGAGG + Intergenic
1169116805 20:3071615-3071637 CCAGGGTCCGTGACTGGTGGCGG - Exonic
1169383322 20:5127256-5127278 CCCGGGCCCGGGGCCGCCGTCGG - Intronic
1170969077 20:21101841-21101863 CAGGGGCCAGAGGCTGGCGGGGG + Intergenic
1171318851 20:24220942-24220964 CCCGGGCCAGTGGCTGCAGAGGG - Intergenic
1172732065 20:37096382-37096404 CCAGGGCCCGTGGATAGAGGAGG - Intergenic
1173685968 20:44923850-44923872 CCAGGTCCCGTGGCAGGCTGAGG - Intronic
1173736262 20:45363618-45363640 GCTGGGCCTGTGGCTGGCGCTGG + Exonic
1173791921 20:45833726-45833748 CCCGGGCCCTTGGCTCCAGGAGG - Intronic
1173873747 20:46357213-46357235 CCGGGGCCCATGGCTGGTAGAGG - Intronic
1173934110 20:46846238-46846260 CCCAGGCCAGAGGCTGGTGGAGG + Intergenic
1175171236 20:57082760-57082782 CCCTGGCCCGTGCCTGCCTGAGG - Intergenic
1175254153 20:57628933-57628955 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1175847201 20:62065286-62065308 CCCGGGGCCGGGGCCGGCGCGGG + Exonic
1175877827 20:62238727-62238749 GCCGGGGCCGGGGCTGGAGGCGG - Intronic
1176075519 20:63246576-63246598 CCATGGCCGGCGGCTGGCGGTGG - Intronic
1176118717 20:63444630-63444652 CACGGCCCCAAGGCTGGCGGTGG - Intronic
1176118865 20:63445275-63445297 GCCGGTACCGTGGCTGGAGGGGG - Exonic
1176126461 20:63477553-63477575 CCTGGGCCCGTGCCTCCCGGTGG + Intergenic
1176299107 21:5090273-5090295 CCCGGGCTCCTGGCTGGTGGGGG + Intergenic
1176523728 21:7848890-7848912 CCAGGGCCTGTTGTTGGCGGGGG + Intergenic
1176966616 21:15218797-15218819 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1177486143 21:21758771-21758793 CCCTGTCCCTTGGCTGGAGGTGG - Intergenic
1178657748 21:34478902-34478924 CCAGGGCCTGTTGTTGGCGGGGG + Intergenic
1179463361 21:41553129-41553151 CCCAGACCCGTGCCTGGCCGGGG - Intergenic
1179658333 21:42859548-42859570 CGCTGGCCCCTGGCTGGCTGTGG - Intronic
1179718478 21:43302268-43302290 CTCGGGCCTGTGGGTGTCGGTGG - Intergenic
1179857918 21:44171675-44171697 CCCGGGCTCCTGGCTGGTGGGGG - Intergenic
1179979718 21:44889653-44889675 GGCGGCCACGTGGCTGGCGGGGG - Intronic
1179989581 21:44940160-44940182 CCCGCGGCCGAGGCCGGCGGAGG - Exonic
1180137399 21:45870701-45870723 CACGGTCGCGTGGCAGGCGGTGG - Intronic
1180831906 22:18910872-18910894 CCCGGCCCCACGGCAGGCGGTGG + Exonic
1181270270 22:21654429-21654451 CCAGGGGCCATGGCTGGAGGTGG + Intronic
1181570068 22:23763690-23763712 CCCGTGCCTCTGGCTGGAGGCGG + Intronic
1182289825 22:29268545-29268567 CCGGCGCCCGTGGCGCGCGGGGG + Intronic
1182447303 22:30397260-30397282 CGAGGGTCCGTGGCGGGCGGCGG + Intronic
1183635868 22:39062244-39062266 CCCGAGTCCGTGACTGGCGCCGG + Intronic
1184236621 22:43186667-43186689 CCCGGGCCCGAGACCGGCTGAGG - Intronic
1184271822 22:43388735-43388757 CCCGGCCCCGGGTCTGGCTGGGG + Intergenic
1184584256 22:45436867-45436889 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1184680734 22:46071185-46071207 CCCTTGCCCGGGGCGGGCGGCGG + Intronic
1184731817 22:46374882-46374904 CCGAGGCCCCGGGCTGGCGGGGG - Intronic
1184870042 22:47232073-47232095 CCCTGGCCCGTGGATGGCACTGG - Intergenic
1184906253 22:47488528-47488550 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1185011198 22:48315677-48315699 CCCGCGCCCATGGCCGGAGGCGG + Intergenic
1185235093 22:49707648-49707670 CCAGGGCCCGAGCCTGGCAGAGG + Intergenic
1203281984 22_KI270734v1_random:136143-136165 CCCGGCCCCACGGCAGGCGGTGG + Intergenic
949877207 3:8634236-8634258 CCTGGGCCAGTGCCTGGCTGGGG - Intronic
950282501 3:11719795-11719817 ACCGGGCGCGCAGCTGGCGGGGG - Intronic
950513364 3:13447418-13447440 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
951719804 3:25686867-25686889 TCCGGGTCCGGTGCTGGCGGCGG - Intergenic
952296616 3:32068200-32068222 CCCGAGTCCGTGACTGGCGCCGG - Intronic
952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG + Intronic
952889267 3:38029865-38029887 CCGCGGCCCGTGGGTGGCGGCGG - Intergenic
953002892 3:38951290-38951312 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
953705212 3:45225823-45225845 CCCGGGCCCGGAGGAGGCGGCGG - Exonic
953916212 3:46922656-46922678 GCTGGGCCGGTGGCTGGAGGAGG - Intronic
954041009 3:47887345-47887367 CCCGGGCCAGTGGCTGCAGAGGG + Intronic
954326925 3:49869023-49869045 GCAGGGCCCCTGGCTGGAGGTGG - Intronic
954327182 3:49869937-49869959 CCCGGGCCGGGGGCGGGCTGGGG + Exonic
954620131 3:51990711-51990733 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
955183353 3:56692018-56692040 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
955449485 3:59050997-59051019 CCCGGGCCAGTGGCTGCAGAGGG + Intergenic
956855258 3:73269332-73269354 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
957921821 3:86757736-86757758 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
961460464 3:127046816-127046838 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
962793985 3:138834998-138835020 CCCGGGCCCCGCGGTGGCGGCGG + Intergenic
963733128 3:148991666-148991688 CGGGGTCCCGGGGCTGGCGGCGG - Intronic
963733271 3:148992115-148992137 GCCGGGGCCGGGGCGGGCGGCGG - Intronic
965220900 3:165924559-165924581 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
965753231 3:171999092-171999114 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
966725005 3:183101036-183101058 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG + Exonic
968519025 4:1027413-1027435 CCGGGGCCCTTGCCTGCCGGGGG + Intergenic
968584662 4:1410620-1410642 CCCGAGCCCGTGGCCTCCGGGGG - Intergenic
968704552 4:2071886-2071908 CCCGGCCAAGTGGCTGGGGGTGG + Intergenic
968956388 4:3721848-3721870 CCAGGCCCTGTGGCTGGCAGGGG + Intergenic
969256055 4:6002585-6002607 CCTAGGCCTGTGGCTGGCTGGGG + Intergenic
969344745 4:6563685-6563707 CGCGGGCCCGGGGCGGGGGGCGG + Intergenic
970391218 4:15615053-15615075 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
971360657 4:25935294-25935316 CCACGGACCGTGCCTGGCGGTGG + Intergenic
971553037 4:27978556-27978578 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
971811958 4:31438791-31438813 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
973817583 4:54632676-54632698 CCCGGGCCAGTGGCTGTGGAGGG + Intergenic
974590594 4:63943095-63943117 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
974641742 4:64640694-64640716 CCCGGGCCAGTGGCTGCAGAGGG - Intergenic
974792767 4:66712635-66712657 CCCGGGCCAGTGGCTGCAGAGGG - Intergenic
974804388 4:66860308-66860330 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
974820229 4:67058123-67058145 CCAGGGCCTGTGGCGGGTGGGGG - Intergenic
976520627 4:86021828-86021850 CCCGGGCCAGTGGCTGCGGAAGG - Intronic
976980293 4:91218190-91218212 CCCGGGCCAGTGGCTGCCAAGGG - Intronic
978999574 4:115200415-115200437 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
979424748 4:120550958-120550980 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
980470226 4:133240629-133240651 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
981475085 4:145180046-145180068 CCCCGGCCTGGGGCAGGCGGCGG + Intronic
984770567 4:183433284-183433306 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
985195170 4:187421165-187421187 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
985589155 5:755816-755838 CCCGGCCCTGTGGCTGCGGGTGG - Intronic
985603834 5:848332-848354 CCCGGCCCTGTGGCTGCGGGTGG - Intronic
985794486 5:1952196-1952218 CTGGGGCATGTGGCTGGCGGGGG + Intergenic
986297115 5:6448803-6448825 GCCGGGCCCGGCGGTGGCGGCGG + Exonic
986912383 5:12574165-12574187 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
987384008 5:17311993-17312015 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
987876951 5:23691264-23691286 CCCGGGCCAGTGGCTGCAGAGGG + Intergenic
988132163 5:27120038-27120060 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
988915892 5:35893088-35893110 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
989346799 5:40438799-40438821 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
990545481 5:56816468-56816490 CCCGAGCCTGAGGCGGGCGGTGG + Intronic
990820909 5:59839254-59839276 CCCAGGCCTGTGGCTGCTGGAGG + Intronic
991967800 5:72108738-72108760 CCCGGGCCTCGGGCTGGCGGGGG + Intronic
992105745 5:73448074-73448096 CCCGGGCCCGGCCCCGGCGGCGG - Exonic
993287311 5:86016124-86016146 CCCCAGCCCTTGGCTGGTGGTGG - Intergenic
993822039 5:92631471-92631493 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
993865385 5:93188511-93188533 CCAGGGCCTGTGGCGGGGGGTGG + Intergenic
994605598 5:101962666-101962688 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
994701698 5:103142255-103142277 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
995224986 5:109690881-109690903 CGCGGGCCCCGGGCTGGCGGGGG - Intronic
995679866 5:114704509-114704531 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
995920402 5:117304801-117304823 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
996398658 5:123036615-123036637 CCCGGGCCCATGGTGAGCGGTGG + Exonic
997694443 5:135850307-135850329 CCCAGACCCTTTGCTGGCGGGGG + Intronic
1001563298 5:172683961-172683983 GCCGGGCCCGTGCCGAGCGGCGG + Exonic
1002296149 5:178232466-178232488 CCCGGGCGGGGGGCGGGCGGCGG - Intronic
1002426903 5:179181929-179181951 CCCGGGCTCGAGGCTGTCAGGGG + Intronic
1002691324 5:181052859-181052881 CCCAGGGGCTTGGCTGGCGGCGG - Intronic
1002709199 5:181184103-181184125 CCCGGGCCCAGGGCTGCAGGAGG - Intergenic
1003070225 6:2939770-2939792 CCCGGGCCAGTGGCTGCAGAGGG + Intergenic
1003107782 6:3228598-3228620 CCCGGGGGCGGGGCTGTCGGCGG + Intronic
1003671543 6:8164473-8164495 CCCGGGCCAGTGGCTGTGGAGGG + Intergenic
1003770153 6:9290660-9290682 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
1004217056 6:13712207-13712229 CCCGGGGCCTGGGCTCGCGGCGG - Intergenic
1004396121 6:15248122-15248144 TGCAAGCCCGTGGCTGGCGGCGG + Intronic
1004906930 6:20244991-20245013 CCCGGGCCGGTGGCTGCGGAGGG - Intergenic
1005035567 6:21552504-21552526 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1005913025 6:30327115-30327137 CCCGGGCCCGAGGCGGGCGGAGG - Intronic
1005977002 6:30807662-30807684 CCCGGGCCAGTGGCTGCAGAGGG - Intergenic
1006008307 6:31020860-31020882 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1006352644 6:33532530-33532552 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1006477835 6:34269166-34269188 CCCGGGCCAGTGGCTGCAGAGGG + Intergenic
1006614893 6:35319508-35319530 CCCGGGCCTGTGGAGGGGGGAGG - Exonic
1007072703 6:39048758-39048780 CCCGGGCTGGTGGCGGGCGGTGG - Intergenic
1007584260 6:42979054-42979076 CGGGGGCCCGTGGCCGGCGGCGG - Exonic
1007800511 6:44388152-44388174 CCCGGGGCCGGGGGGGGCGGGGG - Intronic
1008005589 6:46405987-46406009 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1009685341 6:66949355-66949377 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1010703233 6:79077566-79077588 CCGGGGCGCGGGGCGGGCGGGGG - Intronic
1011143695 6:84189508-84189530 CCCGGGCCAGTGGCTGCAGAGGG + Intronic
1013081481 6:106816982-106817004 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1013143563 6:107364465-107364487 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1013955339 6:115834820-115834842 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1014246837 6:119078579-119078601 CCTCGGCCCGCGCCTGGCGGAGG + Exonic
1016400858 6:143678244-143678266 CGCGGGCGCAGGGCTGGCGGCGG + Intronic
1016590148 6:145735309-145735331 GCCGGGCCTGTGGCTCGGGGAGG - Exonic
1017164104 6:151391353-151391375 CCCGGACCCTGGGCTGGGGGTGG + Intronic
1018686532 6:166308099-166308121 CCCGGGGCGGGGGCGGGCGGCGG + Exonic
1019000261 6:168744005-168744027 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1019283485 7:211835-211857 ACAGGGCACGTGGCGGGCGGAGG + Intronic
1019408329 7:895514-895536 CCTGGCCCTGAGGCTGGCGGTGG + Exonic
1019497260 7:1346416-1346438 CCCGGGCCAGTGGCTGGGCCTGG - Intergenic
1019517202 7:1445280-1445302 CCATGGCCCCTGGCTGTCGGGGG + Exonic
1019601932 7:1889174-1889196 CCAGGTCCCGGGGCTGGCAGAGG + Intronic
1019726988 7:2608210-2608232 TGGGGGCCCGTGGCGGGCGGAGG + Intronic
1019944266 7:4314158-4314180 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1019965750 7:4497150-4497172 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1020009134 7:4799007-4799029 CCCGTGCCGGTGGCAGGCAGAGG + Intronic
1024068778 7:45768618-45768640 CCCCGGGCCCTGGCTGGTGGAGG + Intergenic
1024529986 7:50383673-50383695 CCCTGGCTGGTGGCTGGCTGGGG - Intronic
1026038131 7:66844548-66844570 CCCCGGTCCCTGGCTGGAGGAGG + Intergenic
1026187086 7:68090634-68090656 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1026202949 7:68231171-68231193 CCCGGGCCAGCGGCTGCCGAGGG + Intergenic
1027158028 7:75782248-75782270 CCCGAGTCCGTGACTGGCGCCGG - Intronic
1027216487 7:76187095-76187117 TCCGGGACCGTGCCTGGCTGGGG - Intergenic
1027463654 7:78486950-78486972 GCCGGGTCCATGGCTGGCAGTGG + Intronic
1027579709 7:79977823-79977845 CCCGGGCCAGCGGCTGGGGAGGG - Intergenic
1029302854 7:99598508-99598530 CCCGGGGCAGGGGCTGGGGGCGG + Intronic
1029424338 7:100486859-100486881 CCCAGGCCCCTGGCCGGCCGCGG - Exonic
1029441091 7:100586902-100586924 CCCGGGCTGGGGGCGGGCGGGGG + Intronic
1029495678 7:100894699-100894721 CCCGGGGCCCTGGGGGGCGGTGG + Intronic
1029561964 7:101308787-101308809 CCCTGGCCCTCAGCTGGCGGCGG - Intergenic
1029640574 7:101816854-101816876 CCCGGGCCGGTGACAGCCGGGGG - Intronic
1032090866 7:128910825-128910847 GCCGGGCCCGGGGCGGGTGGAGG - Intergenic
1033039295 7:137903713-137903735 CCGGGGTCCTTGGCTGGCAGTGG + Intronic
1034091045 7:148363948-148363970 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1034441217 7:151086862-151086884 CCCGGGGCCGGGGGCGGCGGCGG + Exonic
1034656039 7:152730496-152730518 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
1034845302 7:154438939-154438961 CCAGGGCCCATGGGTGGAGGAGG + Intronic
1034911919 7:155003769-155003791 CCCGGCCCCGTCGCTGCCCGAGG + Intergenic
1035224783 7:157427089-157427111 CCCGGGAACGAGGGTGGCGGGGG - Intergenic
1035304071 7:157918872-157918894 CCCCGGAACGTGGCTGGTGGAGG - Intronic
1035695405 8:1591912-1591934 CCCGGGGCGGTGGATGGAGGAGG + Intronic
1035999243 8:4582967-4582989 CCCGGGCCAGTGGCTGCGGACGG + Intronic
1036768990 8:11565972-11565994 CCAGGGGACGTGGCTGGTGGGGG + Intergenic
1037263842 8:17037038-17037060 CCCGGGCCAGTGGCTGCGGAAGG - Intronic
1038017726 8:23529323-23529345 CCCAGGACCGCGGCTGGCCGGGG + Intronic
1038174074 8:25164636-25164658 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1039061307 8:33574043-33574065 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1042021448 8:64374014-64374036 GCCCGGCCCGCGGCTGGCCGGGG - Intergenic
1043701127 8:83290492-83290514 CCCGGGCCAGTGGCTGCAGAGGG + Intergenic
1043709883 8:83403082-83403104 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1044609870 8:94080717-94080739 CCCCGGCCAGTGGCAGGCAGAGG - Intergenic
1045131946 8:99163620-99163642 CCCCGGCCAGTGGCTGCCGAGGG - Intronic
1046265392 8:111823511-111823533 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1047393724 8:124475033-124475055 CCCGGGGCCGCGGCCGGGGGCGG - Exonic
1049235495 8:141510406-141510428 CCCGGGCCTGGGGCTGACCGGGG - Intergenic
1049613108 8:143564950-143564972 CCCGGCCCACTGGCTGGAGGTGG + Intergenic
1049660156 8:143816194-143816216 CCCCGTCCCGCGGGTGGCGGCGG - Intergenic
1049680313 8:143915249-143915271 CCCGGGCGGGTGGCAGGTGGAGG - Exonic
1051463800 9:17354074-17354096 CCCGGGCCAGTGGCTGCGGAGGG + Intronic
1052985346 9:34482985-34483007 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1056143425 9:83707147-83707169 CCCCGCCCGGAGGCTGGCGGTGG + Intronic
1056771394 9:89480639-89480661 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1056992302 9:91423604-91423626 GCCGGGCCCCCGGCCGGCGGTGG + Intronic
1057383920 9:94591365-94591387 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1057543860 9:96001940-96001962 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1057628631 9:96701109-96701131 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1060180389 9:121529703-121529725 CCTGGGCAGGGGGCTGGCGGTGG + Intergenic
1060301333 9:122376125-122376147 TCTGGGCCTGTGGCTGGGGGAGG + Intronic
1060403618 9:123362130-123362152 CCTAGGCCAGTGGCTGGCAGGGG + Intronic
1060480372 9:124013731-124013753 CCTGGGCCCGTGGCTGGCGAGGG + Intronic
1061944994 9:133903601-133903623 ACCGGACCCGAGGCTGGCTGAGG - Intronic
1062022998 9:134327825-134327847 CCCGTGACCGGGGCAGGCGGTGG + Intronic
1062306173 9:135908008-135908030 CCCGGCCCCCTGGCCGGCCGAGG + Intergenic
1062341526 9:136095647-136095669 CCGGGGCCCGGGGAGGGCGGAGG - Intergenic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1062425017 9:136502149-136502171 CCCTGGCCCGGGCCTGGCGTGGG + Intronic
1062491559 9:136807479-136807501 CCCGGGTCGGTGGAGGGCGGGGG + Intronic
1062537774 9:137028376-137028398 CCCGGGCGCGGCGCGGGCGGCGG - Intronic
1062578885 9:137221178-137221200 CCCGGGCCCGAGGCGGGCAGTGG - Exonic
1203792687 EBV:160155-160177 CCCGGGCCCGGGGCGGCCGGAGG - Intergenic
1187005842 X:15231952-15231974 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1187304608 X:18083942-18083964 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1187557574 X:20367071-20367093 CCCGGGCCAGTGGCTGCGGAAGG - Intergenic
1192817970 X:74614267-74614289 CCCAGGCCCGTTGCTGCGGGGGG - Intronic
1192869661 X:75173819-75173841 CCCGGGCCAGTGGCTGCAGAAGG - Intergenic
1192870568 X:75179739-75179761 CCCGGGCCAGTGGCTGCAGAAGG - Intergenic
1193804043 X:85972579-85972601 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1194166344 X:90521474-90521496 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1194650824 X:96512473-96512495 CCCGGGCCAGTGGCTGCAGAGGG - Intergenic
1196761974 X:119208694-119208716 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
1196762348 X:119211101-119211123 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1196775201 X:119332013-119332035 CCCGGGCCAGTGGCTGTGGAGGG + Intergenic
1196781467 X:119387806-119387828 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1197793447 X:130278050-130278072 CCCGAGTCTGTGGCTGGCGCCGG - Intergenic
1198517857 X:137427205-137427227 CCGGGGCCCGAGGCTGGGAGCGG - Intergenic
1198664313 X:139004247-139004269 CCCGGGCCAGTGGCTGCGGAGGG - Intronic
1199028801 X:142972358-142972380 CCCGGGCCAGTGGCTGCAGAGGG - Intergenic
1199831286 X:151551409-151551431 CCCGGGCCAGTGGCTGTGGAGGG - Intergenic
1200423565 Y:2998597-2998619 CCCGGGCCAGTGGCTGCGGAGGG - Intergenic
1200512612 Y:4099255-4099277 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic
1202109838 Y:21407340-21407362 CCCGGGCCAGTGGCTGCGGAGGG + Intergenic