ID: 1142591226

View in Genome Browser
Species Human (GRCh38)
Location 17:1006933-1006955
Sequence CCCGGGCCCGTGGCTGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 7, 1: 0, 2: 2, 3: 31, 4: 529}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142591226_1142591238 11 Left 1142591226 17:1006933-1006955 CCTCCGCCAGCCACGGGCCCGGG 0: 7
1: 0
2: 2
3: 31
4: 529
Right 1142591238 17:1006967-1006989 TACCTACGCCATGACGTCATGGG 0: 1
1: 6
2: 0
3: 3
4: 12
1142591226_1142591237 10 Left 1142591226 17:1006933-1006955 CCTCCGCCAGCCACGGGCCCGGG 0: 7
1: 0
2: 2
3: 31
4: 529
Right 1142591237 17:1006966-1006988 GTACCTACGCCATGACGTCATGG 0: 1
1: 6
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142591226 Original CRISPR CCCGGGCCCGTGGCTGGCGG AGG (reversed) Intronic