ID: 1142591266 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:1007063-1007085 |
| Sequence | CCCGGGCCCGTGGCTGGCGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 569 | |||
| Summary | {0: 7, 1: 0, 2: 2, 3: 31, 4: 529} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142591266_1142591277 | 10 | Left | 1142591266 | 17:1007063-1007085 | CCTCCGCCAGCCACGGGCCCGGG | 0: 7 1: 0 2: 2 3: 31 4: 529 |
||
| Right | 1142591277 | 17:1007096-1007118 | GTACCTGCGCCATGACGTCATGG | 0: 6 1: 1 2: 0 3: 3 4: 35 |
||||
| 1142591266_1142591278 | 11 | Left | 1142591266 | 17:1007063-1007085 | CCTCCGCCAGCCACGGGCCCGGG | 0: 7 1: 0 2: 2 3: 31 4: 529 |
||
| Right | 1142591278 | 17:1007097-1007119 | TACCTGCGCCATGACGTCATGGG | 0: 6 1: 1 2: 0 3: 0 4: 31 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142591266 | Original CRISPR | CCCGGGCCCGTGGCTGGCGG AGG (reversed) | Intronic | ||