ID: 1142591562

View in Genome Browser
Species Human (GRCh38)
Location 17:1008436-1008458
Sequence CCGTGTGCGCGCGTGTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142591562_1142591568 0 Left 1142591562 17:1008436-1008458 CCTCACCACACGCGCGCACACGG 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1142591568 17:1008459-1008481 TCCAGCCAGGGGCCCAGATGTGG 0: 1
1: 0
2: 4
3: 38
4: 320
1142591562_1142591574 25 Left 1142591562 17:1008436-1008458 CCTCACCACACGCGCGCACACGG 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1142591574 17:1008484-1008506 ACAGACTGTGCCCAGTTCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 219
1142591562_1142591570 1 Left 1142591562 17:1008436-1008458 CCTCACCACACGCGCGCACACGG 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1142591570 17:1008460-1008482 CCAGCCAGGGGCCCAGATGTGGG 0: 1
1: 0
2: 4
3: 31
4: 325
1142591562_1142591575 26 Left 1142591562 17:1008436-1008458 CCTCACCACACGCGCGCACACGG 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1142591575 17:1008485-1008507 CAGACTGTGCCCAGTTCCCAGGG 0: 1
1: 0
2: 1
3: 24
4: 241
1142591562_1142591576 29 Left 1142591562 17:1008436-1008458 CCTCACCACACGCGCGCACACGG 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1142591576 17:1008488-1008510 ACTGTGCCCAGTTCCCAGGGTGG 0: 1
1: 0
2: 4
3: 33
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142591562 Original CRISPR CCGTGTGCGCGCGTGTGGTG AGG (reversed) Intronic
900496809 1:2979431-2979453 CCGTGTGTGGGCATGGGGTGGGG - Intergenic
900596454 1:3482289-3482311 CTGTGTGTGCGTGTGTGTTGGGG + Intergenic
900840233 1:5042720-5042742 CCGTGTGGCCCTGTGTGGTGTGG + Intergenic
901001934 1:6153165-6153187 CCATGTCCGTGTGTGTGGTGTGG - Intronic
901022809 1:6263539-6263561 CTGTGAGCACGTGTGTGGTGAGG - Intergenic
901443876 1:9295236-9295258 GTGTGTGCGCGCGTGCGGTTGGG + Intronic
905174078 1:36125367-36125389 CCGGGAGCGCGTGTGTGGAGGGG - Intergenic
906436812 1:45803570-45803592 CGGTGCGCGCGCGTGAGGGGCGG + Intronic
908131975 1:61082974-61082996 GCGTGTGCCCGCGGGTGGGGGGG + Intronic
918048346 1:180954407-180954429 ACGCGTGCGCGCGTGTGCTGGGG - Intergenic
919723655 1:200867002-200867024 CCGTGTGTGTGAGTGGGGTGGGG - Intergenic
1062794922 10:337622-337644 GTGTGTGCGCACGTGTGTTGTGG + Intronic
1070809918 10:79292556-79292578 CAGTGTGCTTGGGTGTGGTGGGG + Intronic
1074465540 10:113678762-113678784 CCGTGTGTGTGTGTGTTGTGGGG + Intergenic
1075953442 10:126502045-126502067 GTGTGTGCGTGTGTGTGGTGTGG - Intronic
1076868830 10:133182836-133182858 CAGTGTGGGCGCAGGTGGTGTGG + Intronic
1083227515 11:61294425-61294447 GCGTGTGCGCGCGTGGGGGTGGG - Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1085397878 11:76216350-76216372 CCCTGTGTGTGCGTGTGATGGGG - Intergenic
1085926178 11:81024662-81024684 TTGTGTGCATGCGTGTGGTGGGG + Intergenic
1092064843 12:5581402-5581424 CCATGTGCACGAATGTGGTGAGG - Intronic
1094005005 12:25740046-25740068 GTGTGTGCGAGTGTGTGGTGAGG - Intergenic
1094123864 12:27002041-27002063 ACGTGTGTGCGTGTGTGTTGTGG - Intronic
1097190573 12:57217495-57217517 CCGTGTGTGCGTGTGTGCTCGGG - Intronic
1100565325 12:95789849-95789871 CCCTGGGCGCGCGTGGGCTGGGG - Intronic
1104045570 12:125160286-125160308 CCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1105850311 13:24328396-24328418 CCGCGCGGGTGCGTGTGGTGAGG - Intergenic
1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG + Intronic
1106088152 13:26561323-26561345 CCGTGTGTGTGTATGTGGTGGGG + Intronic
1108363707 13:49690487-49690509 GTGCGTGCGCGTGTGTGGTGGGG + Intronic
1113363578 13:109654911-109654933 GCGTGTGAGCATGTGTGGTGTGG + Intergenic
1113874030 13:113583577-113583599 CTGTGTGCGCGAGTGTGGGGGGG - Intergenic
1114793512 14:25685676-25685698 CCGTCTGAGTGAGTGTGGTGTGG + Intergenic
1118181037 14:63493488-63493510 GTGTGTGCGTGTGTGTGGTGGGG + Intronic
1118925494 14:70187641-70187663 CCGCGCGCGCGTGTGTGTTGGGG + Intronic
1120690897 14:87591134-87591156 GCGTGTGTGTGTGTGTGGTGGGG - Intergenic
1121503775 14:94460868-94460890 CCGTGTGGCCCTGTGTGGTGGGG + Intergenic
1129503147 15:76059603-76059625 CTGAGTGCGAGCGTGTGGAGAGG - Intronic
1129606447 15:77027563-77027585 CTGTGTGCGCACGTGTGTTGGGG + Intronic
1132683266 16:1152529-1152551 CCGCGCGCGCGTGTGTGATGGGG - Intergenic
1138936101 16:61725900-61725922 GCGTGTGTGTGTGTGTGGTGTGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983429 16:87563992-87564014 GTGTGTGTGCGCGTGTGTTGGGG + Intergenic
1141983444 16:87564208-87564230 CTGTGTGCGTGCTTGTGTTGGGG + Intergenic
1142410585 16:89913953-89913975 GTGTGTGTGCGCATGTGGTGTGG + Intronic
1142591562 17:1008436-1008458 CCGTGTGCGCGCGTGTGGTGAGG - Intronic
1143476015 17:7204404-7204426 GCGTGTGCGTGTGTGTGATGTGG - Intronic
1146492705 17:33293439-33293461 CCGGGTGCGGGGGTGGGGTGTGG + Intronic
1150764667 17:67993671-67993693 CCGTGAGCGCGCGCGTCGCGGGG + Intergenic
1151388493 17:73770119-73770141 CCCTGTGCCTGCGTGTGCTGGGG - Intergenic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152645347 17:81466086-81466108 CTGTGTGCGTGCGAATGGTGCGG + Exonic
1154954356 18:21241195-21241217 CCGTGTGCGTGGGAGTGGGGAGG - Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1160662812 19:308914-308936 CCGTGTGCGCACCTGCGGGGAGG + Exonic
1161235035 19:3193456-3193478 CCGTGGGCGTGGGTGTGGGGAGG + Intronic
1161258638 19:3323410-3323432 CCATGTGTGTGTGTGTGGTGGGG - Intergenic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1163726970 19:18928433-18928455 CCGTGGGCGCTCGTGTTGTGCGG + Exonic
1167033512 19:46979001-46979023 ACGTGTGTGTGTGTGTGGTGGGG + Intronic
925383828 2:3447985-3448007 CTGTGTGTGTGCGTGTGGTTTGG - Intronic
927705713 2:25295217-25295239 CCGTGTGTGGGTGTGAGGTGGGG - Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929678930 2:43968869-43968891 CTGTGTGCATGAGTGTGGTGAGG - Intronic
933776982 2:85776976-85776998 CCCTGTGTGTGCGTGTGGAGGGG - Intronic
935066026 2:99648870-99648892 GTGTGTGCGCGCGTGTTTTGAGG - Intronic
938119642 2:128624529-128624551 CTGTATGTGTGCGTGTGGTGTGG - Intergenic
938119645 2:128624557-128624579 CTGTATGTGTGCGTGTGGTGTGG - Intergenic
943950436 2:194127999-194128021 CTGTGTGTGAGTGTGTGGTGGGG - Intergenic
945777695 2:214127738-214127760 CCGGGTGAGGGTGTGTGGTGAGG - Intronic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947110617 2:226715454-226715476 GTGTGTGTGTGCGTGTGGTGGGG + Intergenic
947110650 2:226715694-226715716 GTGTGTGTGTGCGTGTGGTGGGG + Intergenic
948569450 2:238908503-238908525 TCGTGTGGGTGTGTGTGGTGTGG - Intronic
948657686 2:239486896-239486918 CCCTGTGTGTGCGTGGGGTGTGG + Intergenic
1169867800 20:10219105-10219127 CCGTGTGTGCACGTCTGGTGGGG + Intronic
1174568378 20:51483610-51483632 CTGTGTGTGTGTGTGTGGTGGGG - Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1178610366 21:34073931-34073953 CCGCGTGCGCGCGGGAGGCGGGG + Intronic
1178750475 21:35297694-35297716 TCGTGTGTGTGTGTGTGGTGAGG - Intronic
1179627655 21:42657714-42657736 CTGTGGGCTCGGGTGTGGTGAGG + Intronic
1179655266 21:42841041-42841063 CGGAGTGCGCACGTGTGATGTGG + Intergenic
1180870511 22:19144083-19144105 CCTTCTGTGTGCGTGTGGTGGGG + Intronic
1184128940 22:42505719-42505741 GTGTGCGCGTGCGTGTGGTGGGG - Intergenic
1184137735 22:42559034-42559056 GTGTGCGCGTGCGTGTGGTGGGG - Intronic
1184457172 22:44617226-44617248 CTGTGTGTACGCGTGTGGTGTGG - Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185105643 22:48868095-48868117 CCTGGTGCACGCGAGTGGTGGGG - Intergenic
1185140216 22:49095818-49095840 CCGTGTGTGCATGTGTGTTGGGG - Intergenic
953548980 3:43885884-43885906 GAGTGTGCGTGCGTGTGGGGTGG - Intergenic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
954682272 3:52352140-52352162 AACTGTGCGTGCGTGTGGTGGGG - Intronic
960281247 3:115783980-115784002 CCGTGTGCGCGCGCGTGTCGGGG + Intergenic
961458114 3:127034209-127034231 CTGTGTGCGCAGCTGTGGTGTGG - Exonic
963299323 3:143581269-143581291 CTATGTGGGCACGTGTGGTGGGG + Intronic
967762356 3:193240711-193240733 GCGTGTGTGTGTGTGTGGTGTGG + Intergenic
967948840 3:194824817-194824839 GCCTCTGCGTGCGTGTGGTGAGG + Intergenic
968660635 4:1797417-1797439 CCATCTGCCCGTGTGTGGTGGGG - Intronic
971077321 4:23164938-23164960 GCGTGTGTGCATGTGTGGTGGGG - Intergenic
972765938 4:42152237-42152259 CCTGGTGCGCGCGTGTGGGAGGG + Exonic
973532870 4:51850748-51850770 CTGTGTGCGGGCGTGGGGTGGGG + Intronic
973635876 4:52861959-52861981 GCGAGTGCGCGCGTGGGCTGTGG + Intergenic
982705120 4:158700551-158700573 GCGTGTGTGTGTGTGTGGTGGGG - Intronic
985985552 5:3513069-3513091 CTGTGTGTGCGCGTGTGGAAGGG + Intergenic
990426427 5:55694488-55694510 CTGTGTGTGTGTGTGTGGTGGGG + Intronic
994314807 5:98320480-98320502 GTGTGTGTGTGCGTGTGGTGTGG - Intergenic
994710660 5:103259684-103259706 CCGTGTGTGCGCGTGTGGATTGG + Intronic
996210070 5:120798068-120798090 CAGTGTGTGTGTGTGTGGTGGGG + Intergenic
997234456 5:132264759-132264781 CTGTGTGGGTGTGTGTGGTGGGG - Intronic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
999536261 5:152520866-152520888 CCGTGCCCGCGTGTGTGTTGGGG + Intergenic
1000665423 5:163989215-163989237 GTGTGCGCGCGCGTGTGGGGGGG + Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003320145 6:5043990-5044012 CCCTGTGCGGCCCTGTGGTGTGG + Intergenic
1007637614 6:43308601-43308623 CCGAGTGGGAGCGGGTGGTGCGG + Intronic
1012007523 6:93733175-93733197 CTGTGTGCGCCTGGGTGGTGGGG - Intergenic
1014192999 6:118519496-118519518 CCGTGTGCGTGTGTGTGGCGGGG + Intronic
1017304105 6:152896720-152896742 GCGTGTGCGTCTGTGTGGTGCGG - Intergenic
1017439604 6:154451460-154451482 GTGTGTGTGCGCGTTTGGTGGGG - Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1032165192 7:129539789-129539811 CTGTGTGAGCCTGTGTGGTGTGG + Intergenic
1033657905 7:143385632-143385654 GTGTGTGTGAGCGTGTGGTGTGG + Intronic
1035354363 7:158268276-158268298 CCGTGTGCACGCGTCTGGGCTGG - Intronic
1035361776 7:158318176-158318198 CTGTGTTCCCGCCTGTGGTGCGG - Intronic
1036652378 8:10653590-10653612 GCGTGTGCGCACATGTGATGTGG - Intronic
1037895662 8:22652505-22652527 GCATGTGCGCATGTGTGGTGGGG + Intronic
1040978281 8:53217888-53217910 GAGTGTGCGCGTGTGTGGGGGGG + Intergenic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1048293014 8:133194645-133194667 GCGTGTGTGCGTGTGTGGTGGGG + Intronic
1049671104 8:143870272-143870294 CCGTGCGCAGGGGTGTGGTGGGG - Exonic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1051170258 9:14314134-14314156 GCGAGTGCGCGCGGGTGGCGGGG + Intronic
1056859360 9:90165492-90165514 GCGTGTGTGTGTGTGTGGTGTGG + Intergenic
1061498791 9:130990617-130990639 GCGTGTGTGTGCGTGTGTTGTGG - Intergenic
1061886386 9:133593049-133593071 CCGTGTGCGCCTGTGCGGTGCGG + Intergenic
1203791115 EBV:152089-152111 CCGTGTGCATGCCTTTGGTGGGG + Intergenic
1189204686 X:39227575-39227597 GCGTGTGTGTGTGTGTGGTGGGG - Intergenic
1189241709 X:39529675-39529697 GTGTGTGCGTGTGTGTGGTGGGG - Intergenic
1193130201 X:77911576-77911598 CCGGGTGCGGGGGGGTGGTGGGG + Intronic