ID: 1142592241

View in Genome Browser
Species Human (GRCh38)
Location 17:1011389-1011411
Sequence CTGAACCAGCAGGAGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 415}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142592231_1142592241 24 Left 1142592231 17:1011342-1011364 CCTGGCCAGTGCAGGTTTCTTGA 0: 1
1: 0
2: 2
3: 29
4: 252
Right 1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG 0: 1
1: 0
2: 5
3: 53
4: 415
1142592230_1142592241 28 Left 1142592230 17:1011338-1011360 CCTGCCTGGCCAGTGCAGGTTTC 0: 1
1: 0
2: 2
3: 18
4: 216
Right 1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG 0: 1
1: 0
2: 5
3: 53
4: 415
1142592229_1142592241 29 Left 1142592229 17:1011337-1011359 CCCTGCCTGGCCAGTGCAGGTTT 0: 1
1: 1
2: 19
3: 101
4: 903
Right 1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG 0: 1
1: 0
2: 5
3: 53
4: 415
1142592232_1142592241 19 Left 1142592232 17:1011347-1011369 CCAGTGCAGGTTTCTTGACAGTG 0: 1
1: 0
2: 0
3: 26
4: 448
Right 1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG 0: 1
1: 0
2: 5
3: 53
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142592241 Original CRISPR CTGAACCAGCAGGAGCAGGG AGG Intronic
901435000 1:9242068-9242090 CTGATCCAGTAGGTGTAGGGTGG - Intronic
901753593 1:11427373-11427395 CTGGACCAGCAGACTCAGGGAGG + Intergenic
901790276 1:11650255-11650277 CTCAGCCAGCTGGGGCAGGGCGG - Intronic
902159760 1:14520416-14520438 CTGAAGCTGCAGGAGCCTGGGGG + Intergenic
902219088 1:14953309-14953331 CTGAACCAGCAGGGCCCAGGTGG - Intronic
902225998 1:14996794-14996816 CTGGAGCACCAGGAGCGGGGAGG - Intronic
902237076 1:15064344-15064366 CTGATCCACCAGGTACAGGGTGG + Intronic
902362274 1:15948434-15948456 CTGAACCAGCAGCGGCAGCTGGG - Exonic
902580001 1:17402266-17402288 ATCATCCAGGAGGAGCAGGGTGG - Intergenic
903288130 1:22289819-22289841 CTGAACCAACAGGAGGCTGGAGG - Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903623375 1:24714277-24714299 CAGACCCAACAGGAGCAGAGTGG + Intergenic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
904324619 1:29720275-29720297 CAGAGGCAGCAGGTGCAGGGAGG - Intergenic
905169012 1:36098972-36098994 CTAAGCCAGCTGGACCAGGGAGG + Exonic
906035463 1:42747873-42747895 CTCAACCAGCAGCAGGAGGGTGG + Intronic
906132527 1:43469108-43469130 CTGAGCCTGCAGGAGGAAGGGGG + Intergenic
906581836 1:46941347-46941369 CAGAAGCAGAATGAGCAGGGAGG + Exonic
906601881 1:47137550-47137572 CAGAAGCAGAATGAGCAGGGAGG - Exonic
907241809 1:53085145-53085167 CAGCACCTGGAGGAGCAGGGTGG - Exonic
907590193 1:55659369-55659391 GTGAGCCTCCAGGAGCAGGGTGG + Intergenic
908783554 1:67713473-67713495 CTGAAGCAGGGAGAGCAGGGTGG + Intronic
910259774 1:85283923-85283945 CTGAGCCTGCAGGGGCAGGGAGG - Intergenic
911087111 1:93988308-93988330 CTAAACCAGCAGGAGCCTGAGGG - Intergenic
915106953 1:153540717-153540739 CTCAACAAGGAGCAGCAGGGAGG + Intronic
915488726 1:156239887-156239909 GGGAACCAGCAGGAGGGGGGCGG - Intronic
915662374 1:157414994-157415016 CTGAACCGGCAGGGACATGGTGG - Intergenic
915898317 1:159828267-159828289 CAGCACCAGGAGGAGCAGGTAGG + Intronic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916459483 1:165008662-165008684 CTGAACCATCAGAACCAGGATGG - Intergenic
916648898 1:166816813-166816835 CTGAGCCAGCAGGGGAAGGCGGG + Intergenic
918243882 1:182642536-182642558 CTGAAGAAGAAGGAGCAGGTGGG - Intergenic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
921199545 1:212792004-212792026 CGGGACCAGAGGGAGCAGGGAGG + Intronic
922041847 1:221904515-221904537 TTGCACCAGCTGCAGCAGGGAGG - Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922537076 1:226389305-226389327 CTGAGCCAGCTGGGGCAGGCTGG - Intronic
922614168 1:226951351-226951373 CTGAAGCGACAGGAGGAGGGAGG + Intronic
922803774 1:228375565-228375587 CTGAATGAACAGGACCAGGGAGG + Intronic
922849276 1:228718759-228718781 GTGAACCAGGAGGACCAGGTTGG + Intergenic
923094218 1:230761757-230761779 CTGAACCAGAAGGAACGGGTAGG + Intronic
923097289 1:230785548-230785570 TGGAAAAAGCAGGAGCAGGGTGG - Intronic
1063505406 10:6593624-6593646 CTGATGCAGCTGGAGCTGGGTGG - Intergenic
1064000631 10:11661203-11661225 AGGCACCAGCAGGAGCAGGGGGG + Intergenic
1066347136 10:34598917-34598939 CTGGACCATCAAGGGCAGGGTGG - Intronic
1067058199 10:43064546-43064568 CTGACCCAGCAGGAGCTCAGGGG + Intergenic
1067576410 10:47411326-47411348 ATGGATCACCAGGAGCAGGGAGG + Intergenic
1067819963 10:49519888-49519910 CTGAGGCAGCAGGTGCAGAGTGG - Intronic
1068443804 10:57095071-57095093 CTGAGCCTGCAGGTTCAGGGGGG - Intergenic
1068510976 10:57965470-57965492 CAGAAACTGTAGGAGCAGGGTGG + Intergenic
1069582086 10:69573139-69573161 CTGACCCAGCGGGGGCTGGGAGG - Intronic
1070169783 10:73924198-73924220 CTGAGCCAGCTGGAGGAGGGAGG - Intergenic
1070787815 10:79172222-79172244 CTGACCAAGCAGGAACATGGCGG + Intronic
1070830632 10:79415983-79416005 CTGACCCAGCAGGACTGGGGTGG + Intronic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1071876745 10:89850962-89850984 CAGAAGCAGGTGGAGCAGGGAGG + Intergenic
1072442423 10:95468792-95468814 GTGAACCAGGAGGTGCAGGCTGG + Intronic
1072861297 10:99007807-99007829 CTGAGAAAGCAGGAGCAGTGAGG + Intronic
1073579887 10:104655782-104655804 CGGAAGAAGCAGGAGCAAGGCGG - Intronic
1074457968 10:113612151-113612173 CTGAGCCAACAGGAGCCTGGAGG + Intronic
1074531460 10:114301491-114301513 ATGAAGCAGCCGGGGCAGGGTGG + Intronic
1075345893 10:121681792-121681814 CTGGACCAGCACGGGGAGGGAGG - Intergenic
1076202104 10:128567028-128567050 CTGAGCAGGCAGGGGCAGGGAGG - Intergenic
1076230712 10:128817883-128817905 CTGAACCAGCACCAGGAGGTGGG - Intergenic
1077341361 11:2027808-2027830 CTGAGCCAGCAGGACCGGCGAGG - Intergenic
1078484189 11:11706504-11706526 CTTAACTTGCAGGACCAGGGAGG - Intergenic
1079428219 11:20363861-20363883 ACGACGCAGCAGGAGCAGGGCGG - Exonic
1080720980 11:34848367-34848389 CTCAACCATCAGAAGCAAGGTGG + Intergenic
1083183880 11:61006546-61006568 ATGAACCAGCAGCAGCATGGTGG - Intronic
1083733736 11:64667901-64667923 CTGGCCCAGCAGGAGCATGGTGG + Intronic
1083779851 11:64912150-64912172 CTGAACCAGCAGCTGCAGGCAGG - Exonic
1084153911 11:67303536-67303558 CTGGACCCGCAGGACCAGGAAGG - Exonic
1084205055 11:67586343-67586365 CTCAGCCAGCGGGAGCAGGCTGG - Intronic
1084321403 11:68375438-68375460 CAGCACGAGCAGGGGCAGGGAGG - Intronic
1084484186 11:69438550-69438572 CTGAGCCACTAGGAGCCGGGAGG - Intergenic
1084800978 11:71543715-71543737 CTGATCCATCAAGTGCAGGGAGG + Intronic
1084868264 11:72078106-72078128 CTGAGGCAGGAGGAGCAGGCGGG - Intronic
1085057343 11:73413163-73413185 CTGAGTCATCAGGGGCAGGGGGG - Intronic
1085782678 11:79423662-79423684 CTGGAGCAGCAGGCGCAGGGAGG + Intronic
1086927959 11:92661169-92661191 GTGAGCCAGCAGAAGAAGGGTGG + Intronic
1087195161 11:95297808-95297830 CTGAACCAGGAGGTGCTGGGAGG + Intergenic
1088461325 11:110086516-110086538 CTGAACTAGCAGAAGAAGGCAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1089100702 11:115959754-115959776 CAGCACCAGCTGGAGGAGGGGGG - Intergenic
1089487733 11:118860169-118860191 CTGATTCAGTAGGACCAGGGTGG + Intergenic
1089996020 11:122908264-122908286 CTGATTCAGCAGGTGTAGGGTGG + Intronic
1090885710 11:130874432-130874454 CTGAAACTGCAGCAGCAGGAAGG + Intergenic
1202824346 11_KI270721v1_random:82997-83019 CTGAGCCAGCAGGACCGGCGAGG - Intergenic
1091413648 12:261386-261408 CTGAAAGAGCAGGGGCAGAGTGG - Intronic
1091784045 12:3231596-3231618 CTGAGCCAGCAGGGGCGGGGTGG + Intronic
1092243655 12:6850953-6850975 CTCAACCAGGAGTTGCAGGGTGG + Exonic
1093999467 12:25679402-25679424 AGGAACCAGCTGGAGCAGTGAGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094808034 12:34109527-34109549 CTGTACCAGGAGCTGCAGGGTGG - Intergenic
1096241970 12:49964424-49964446 CTGAACCTGGAGGTGCAGAGGGG + Intronic
1096245784 12:49985000-49985022 ATGACCCAGAAAGAGCAGGGAGG - Intronic
1096472681 12:51889142-51889164 GTGAACCAGCAGGACAAAGGAGG + Exonic
1097379054 12:58873644-58873666 CTGAACCCGCAGTCGAAGGGTGG - Intronic
1097450804 12:59734429-59734451 CTGAGCCTGCAGGGGCAGGGGGG + Intronic
1097626431 12:62007104-62007126 CTGGAGCAGAAGGAGCATGGGGG - Intronic
1098079295 12:66766803-66766825 CTGAACTAGGAAGAGCAGGTTGG - Intronic
1098258651 12:68644913-68644935 CTGGACCAGCTGGACCAGGCTGG - Intronic
1098322241 12:69257864-69257886 CTGGGCCAGCAGGACCAGGAGGG + Exonic
1101038255 12:100726661-100726683 CTGCACTCGGAGGAGCAGGGTGG + Intronic
1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG + Intronic
1102762311 12:115398693-115398715 CAGAGGCAGCAGGAGCTGGGAGG - Intergenic
1103344579 12:120240892-120240914 CTGAGCCAGCAGGAAGAGGGTGG - Intronic
1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG + Intronic
1103914663 12:124370064-124370086 CACAGCCAGCAGGAGCGGGGCGG + Intronic
1104928082 12:132324037-132324059 CTGAACCAGCAGGAGCCATTTGG + Intronic
1105437493 13:20391028-20391050 CTGAGCCAGCCTTAGCAGGGAGG - Intergenic
1106537321 13:30658600-30658622 CTGAAGCAGCATGAGCATGTGGG - Exonic
1106844966 13:33728613-33728635 CTGACACAGCAGGGGCAGGAAGG - Intergenic
1106997437 13:35502729-35502751 CTAAACAAGCTGGTGCAGGGAGG - Intronic
1110127410 13:71963668-71963690 CTCACCCAGCAGGAGCAGACAGG - Intergenic
1111597207 13:90427581-90427603 CCAAGCCTGCAGGAGCAGGGGGG - Intergenic
1112127267 13:96481726-96481748 CTAAAAAAGAAGGAGCAGGGTGG + Intronic
1113088023 13:106587762-106587784 CAGAACCAGGAAGAGCAGGATGG - Intergenic
1113378831 13:109785653-109785675 GAGAACGAGCAGGAGCAGGAGGG - Exonic
1113601107 13:111568783-111568805 CTGCACCAGGAGGAACAGGCAGG - Intergenic
1113674122 13:112196369-112196391 CTGAGGAGGCAGGAGCAGGGAGG - Intergenic
1115312307 14:31991769-31991791 CTGACTAGGCAGGAGCAGGGAGG + Intergenic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1119147745 14:72332216-72332238 GTGAACCATCTGGAGCTGGGAGG - Intronic
1120338651 14:83190581-83190603 GTGAGCTAGCAGAAGCAGGGTGG - Intergenic
1120525226 14:85569378-85569400 CCGTACCAGGAGCAGCAGGGAGG + Intronic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1121511556 14:94516512-94516534 GTGCACCAGCAGGTGAAGGGGGG + Intronic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122015851 14:98796085-98796107 GTGACCCGGCAGGAGCATGGAGG - Intergenic
1122100182 14:99402281-99402303 GTGAACCAGCAGGAGCAATGTGG + Intronic
1122660209 14:103290146-103290168 TTGACTCACCAGGAGCAGGGTGG + Intergenic
1122819148 14:104332584-104332606 CTTGTCCAGCAGGAGCAGGAAGG + Intergenic
1122981917 14:105195927-105195949 CTGAACCAGCTGGAGCAGGATGG - Intergenic
1202883739 14_KI270722v1_random:84854-84876 CTGAGCCTGCGGGGGCAGGGGGG + Intergenic
1123681692 15:22768553-22768575 CGGAAGCAGGAGGAGCAGGTGGG - Intergenic
1123681831 15:22769243-22769265 CTGAAGCAGAAGGAGCAGATGGG - Intergenic
1124001822 15:25766545-25766567 CTGAGCCAGCAGAAGAAGTGAGG + Intronic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1124612357 15:31216680-31216702 CAGAACCTCCAGGAGCAGGGTGG + Intergenic
1124723244 15:32131973-32131995 CTGAAACAGCAGGAGGCGGCTGG + Intronic
1126664060 15:51059879-51059901 CTGACCCAGAAGGAGCAGAGAGG - Intronic
1127918724 15:63476524-63476546 CTGGAAGACCAGGAGCAGGGAGG + Intergenic
1128134193 15:65250631-65250653 CTGCAGCAGTAGGAGAAGGGAGG - Intronic
1128790757 15:70431973-70431995 CTGAGCCTGCAGGGACAGGGAGG + Intergenic
1129446837 15:75625071-75625093 TTGAAACAGCAGGAGCCCGGCGG - Intronic
1129829734 15:78660945-78660967 CTGACTCAGCAGGACAAGGGTGG + Intronic
1129858658 15:78843268-78843290 CTGAACCTACAGGAGCCAGGAGG - Intronic
1130199379 15:81810775-81810797 CTGGACCAGCAGGAGCTTTGTGG - Intergenic
1130276057 15:82476918-82476940 GTGAACCTGCAGGAGCTGCGGGG - Intergenic
1130468417 15:84204309-84204331 GTGAACCTGCAGGAGCTGCGGGG - Intergenic
1130485329 15:84395441-84395463 GTGAACCTGCAGGAGCTGCGGGG + Intergenic
1130495849 15:84469233-84469255 GTGAACCTGCAGGAGCTGCGGGG + Intergenic
1130590710 15:85208907-85208929 GTGAACCTGCAGGAGCTGCGGGG - Intergenic
1132433722 15:101780063-101780085 GTGTTCCAGCAGGAGCAGAGAGG - Intergenic
1132739229 16:1403061-1403083 CAGAGCCTGCAGCAGCAGGGAGG + Intronic
1132761141 16:1509165-1509187 AAGCACCAGGAGGAGCAGGGGGG + Intronic
1133050752 16:3115959-3115981 CAGAACCAGCAGATGCAGGAAGG - Intronic
1134096471 16:11422103-11422125 TTGAAACAGCGGGAGCAGGCTGG + Intronic
1134384377 16:13758227-13758249 AGGAACTAGCAGGAGCTGGGAGG + Intergenic
1134823006 16:17261743-17261765 CTGAGGCTGCAGGAGCTGGGAGG + Intronic
1135766169 16:25179458-25179480 CTGAACCTGCATGTGCAGGGTGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139923384 16:70473101-70473123 CTGGACCACCAGGAGGATGGGGG + Exonic
1140070553 16:71645699-71645721 AAGAGCCAGCAGGAGCAGCGTGG - Exonic
1140103401 16:71938144-71938166 CTGAACCTGCAGGGGCAGGGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141733358 16:85836694-85836716 CTAGACCAACAGGAGCAGTGAGG - Intergenic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142246084 16:88970691-88970713 CTGAAGGACCAGGAGCACGGAGG + Intronic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1142607195 17:1088364-1088386 CTGAACCGGAGGGAGCAGGGGGG + Intronic
1143839959 17:9724207-9724229 CTGAACCAGCAGGACGAAGCGGG - Intronic
1143872108 17:9964456-9964478 CTAAATCAGCAGGAATAGGGAGG - Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1146718607 17:35107015-35107037 CTGAAGCAGCTGGAGGAGGCGGG + Exonic
1147157574 17:38551986-38552008 CTGAACCTGCATGAGCTGAGCGG - Exonic
1147403618 17:40195350-40195372 GTGCATCAGCAGTAGCAGGGAGG - Exonic
1148002858 17:44400131-44400153 CTGAACAAGCAGGAGCCTGGGGG - Exonic
1148238398 17:45984014-45984036 CAGAAGCAGCAGGAGTCGGGAGG - Intronic
1148795675 17:50195578-50195600 CAGCACCAGCAGGGCCAGGGGGG + Exonic
1149597539 17:57873185-57873207 CTGCACCAGCAGCCTCAGGGTGG + Intronic
1149640598 17:58200055-58200077 ATGAAGCAGCTGGAGCTGGGAGG - Intronic
1150266321 17:63834477-63834499 ATGATCCAGCATGAGCAGGAGGG + Exonic
1150285157 17:63950116-63950138 CTGGCCCAGCAGGAGGAGGTGGG - Intronic
1150384839 17:64750571-64750593 GTGAGCCTGCAGGAGCAGGTTGG - Intergenic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151697141 17:75723513-75723535 CTGAGCCAGCAGGGAAAGGGTGG - Intronic
1151743567 17:76000230-76000252 CTGTACAAGCAGGAGCGGGGCGG + Exonic
1152007252 17:77690427-77690449 CTGACGTGGCAGGAGCAGGGTGG - Intergenic
1152209483 17:78995397-78995419 CTGAACCTTCAGGAGCTGAGGGG - Intronic
1152750488 17:82060312-82060334 CTGAACCACCAGCTCCAGGGAGG + Intronic
1152796669 17:82310952-82310974 GGGAACCAGCATGAGCCGGGCGG + Intergenic
1155292345 18:24354932-24354954 CTTAACCATCAGGAGCCAGGGGG - Intronic
1155399198 18:25419704-25419726 CAGAAGCAGCAGGGGCAGGATGG - Intergenic
1155865799 18:30963426-30963448 AGGAACCAGCAGAAGCAGGAAGG - Intergenic
1156592662 18:38509227-38509249 CTGACCAAGCAGGAGGATGGGGG + Intergenic
1157161118 18:45315375-45315397 CTTACCCAGCAGAAGGAGGGTGG + Intronic
1158142481 18:54269841-54269863 TTCACCCAGCAGGAGTAGGGTGG + Intronic
1158787949 18:60739484-60739506 CTGAGCCTGCAGGGGAAGGGGGG - Intergenic
1159623778 18:70669214-70669236 CTGAGCCTGCAGGGGCAGCGAGG - Intergenic
1160116723 18:76085380-76085402 CTGAGTCTGCAGGGGCAGGGGGG + Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160433162 18:78826208-78826230 CTGAACCAGGGTGAGCATGGAGG - Intergenic
1160528931 18:79552484-79552506 CGGATCCACCTGGAGCAGGGAGG - Intergenic
1160631670 18:80250789-80250811 CTGAACCATCAGGAGCAAAAAGG + Intergenic
1160842115 19:1150817-1150839 CTGTACCCGCAGGTGCTGGGTGG + Intronic
1160950672 19:1665779-1665801 CTGATGGAGCAGGAGCTGGGGGG - Intergenic
1161042747 19:2118692-2118714 CTGCAGCAGAAGGAGCAGGCCGG - Exonic
1161265581 19:3362114-3362136 CTGGTGCAGGAGGAGCAGGGAGG + Intronic
1161378784 19:3953621-3953643 CTGGCCCAGCAGCTGCAGGGGGG + Intergenic
1161563543 19:4986822-4986844 CTGAGCTGGCAGGAGCAGAGAGG + Intronic
1162432559 19:10637775-10637797 CTCACCCAGCAGGAGCTGGCGGG - Intronic
1164495291 19:28754820-28754842 GTGCACCAGCAGTGGCAGGGTGG - Intergenic
1164556703 19:29258623-29258645 CTGAACCAGCAGAACCACTGGGG - Intergenic
1165432938 19:35782680-35782702 GTAAACCAGGAGGGGCAGGGCGG + Intronic
1165896149 19:39142501-39142523 CAGATCCAGCAGAAGTAGGGTGG + Intronic
1167299546 19:48670948-48670970 CTGGCCCAGGAGGAGCAGGAGGG + Exonic
1167497547 19:49828432-49828454 ATGAACCTGCAGGGGCAGAGCGG - Exonic
1167553951 19:50181047-50181069 CTGATTCAGCAGGTCCAGGGTGG - Intergenic
1168261924 19:55200171-55200193 AAGAACCAGCAGGAGCGGCGTGG - Intronic
1168689560 19:58368605-58368627 CCCAACCAGCAGCAGCAGGCGGG - Exonic
1202632885 1_KI270706v1_random:16333-16355 CTGGACCTGCAGGGGCAGGGGGG + Intergenic
924998302 2:384140-384162 CTGATGCAGCAGGAGCCGGGTGG + Intergenic
925011092 2:486863-486885 CTGAACCAGCGGGCACAGTGGGG - Intergenic
925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG + Intergenic
926033346 2:9612594-9612616 CTGGACCAGTAGGAGGAGTGTGG + Intronic
926306036 2:11637795-11637817 CTTCTCCAGCAGGAGCTGGGCGG - Exonic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927285978 2:21357082-21357104 CTGAATCAGCAGGTCTAGGGTGG - Intergenic
927613653 2:24566885-24566907 CTGAGCCTGCAGGGGCATGGGGG + Intronic
927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG + Exonic
928004654 2:27553343-27553365 CTGAAGGAGCAGGAGATGGGAGG - Intronic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
930020703 2:47000491-47000513 CTGACGCAGCAGGAGCTCGGAGG + Intronic
930155780 2:48106513-48106535 CTGAGCCAGCCTGGGCAGGGTGG + Intergenic
932170899 2:69555122-69555144 CTGAACAAGCATGGGCAAGGAGG + Intronic
932292329 2:70593034-70593056 GTCAACCAGCAGCAGCAAGGTGG + Intergenic
932466036 2:71925007-71925029 CTGAAAAAACACGAGCAGGGAGG + Intergenic
932842733 2:75098954-75098976 CAGAACCAGCAGGTGGAGTGAGG + Intronic
932892971 2:75611933-75611955 CTGTCCCAGCAGCAGTAGGGAGG - Intergenic
934232348 2:90195826-90195848 CAGAACCAGCAGGACAATGGAGG + Intergenic
934680141 2:96277867-96277889 GTGAGCCTGCAGGAGCAGGTTGG + Exonic
935159234 2:100514841-100514863 CTGAAGCAGGATGTGCAGGGTGG - Intergenic
935974784 2:108567398-108567420 CTGAACTAGAATAAGCAGGGTGG + Intronic
938600184 2:132829720-132829742 CTGAATCAGGAGGTGTAGGGTGG + Intronic
938695696 2:133833522-133833544 CTAACCCAGCAGGGGCAGGTGGG + Intergenic
940124774 2:150311163-150311185 GAGAACTAGCAGAAGCAGGGTGG + Intergenic
943485359 2:188473182-188473204 CTGAACCACCAGAAGTAGGGTGG + Intronic
943933700 2:193886648-193886670 CTGAACCACCTGGAACCGGGAGG - Intergenic
944417443 2:199492973-199492995 CTGGAGTAGCATGAGCAGGGAGG + Intergenic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
946280901 2:218664791-218664813 CAGAGGCAGCAGGAGCGGGGGGG - Exonic
947603149 2:231467097-231467119 CTGAGCCAGCTGGAGCAGGTGGG - Intronic
947852960 2:233303399-233303421 ATGAAGCAGCAGGAGAATGGGGG + Intergenic
948467327 2:238158740-238158762 CAGAACCAGGAGTTGCAGGGGGG + Intergenic
948648295 2:239422835-239422857 GTGAAGCAGGAGGAGCAGGAAGG + Intergenic
948826615 2:240576192-240576214 ATGAACCAGCAGGGGCGGGATGG - Intronic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1170190503 20:13640380-13640402 GTGAAGCAGCAAGAGCAGGAAGG + Intergenic
1170684799 20:18559530-18559552 CTGAACCAGCAAAGGCTGGGTGG - Intronic
1171879591 20:30608507-30608529 CTGAATCAGCAGGAGAAAAGAGG + Intergenic
1172457946 20:35092583-35092605 CTGGACCAGGAGGGGCGGGGCGG - Intronic
1173207694 20:41007505-41007527 CTGAGCCTGCAGGGGCAGGGGGG + Intergenic
1173410126 20:42802733-42802755 CTGATCATGCAGGAGAAGGGAGG - Intronic
1173934999 20:46853599-46853621 CTGGACGGGAAGGAGCAGGGCGG + Intergenic
1174365783 20:50055367-50055389 CTGAAGCTGCAGGAGCAGTCCGG + Intergenic
1174606825 20:51767714-51767736 CCGAACCAGCAGTCGCAGGAGGG - Intronic
1174763377 20:53228841-53228863 CTCAACCAGGAGGAGTTGGGGGG - Intronic
1174859283 20:54075243-54075265 CTGTCTCAGCTGGAGCAGGGTGG - Intergenic
1174983107 20:55419734-55419756 CTGATTCAGCAGGTGCATGGTGG - Intergenic
1175440822 20:58989915-58989937 CTGGCCCAGGAGGAGCAGGGGGG + Exonic
1175549628 20:59808701-59808723 CTGATGCTGCAGGTGCAGGGAGG + Intronic
1175715950 20:61253920-61253942 CTGAAGGAGCAGGAGCACAGCGG - Intronic
1175741482 20:61422757-61422779 CTGAGCAAGCAGGTGCAAGGTGG - Intronic
1175793487 20:61757100-61757122 CTGAACTTGCAGGAGCGTGGAGG - Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176721518 21:10397539-10397561 GGGAGCCAGCAGGAGCCGGGGGG + Intergenic
1177861861 21:26463725-26463747 TTGAACCAACAGGAGCAGAATGG - Intergenic
1178370093 21:32020341-32020363 GTGAACTTGAAGGAGCAGGGAGG + Intronic
1178580166 21:33831592-33831614 TTGGAACAGCAGGAGCAGGAAGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1180326624 22:11435553-11435575 CTGAGCCTGCGGGGGCAGGGGGG + Intergenic
1180367846 22:11957021-11957043 CTGGGCCTGCAGGGGCAGGGGGG - Intergenic
1180378243 22:12114313-12114335 CTGAGCCTGCGGGGGCAGGGGGG + Intergenic
1180419264 22:12798966-12798988 CTGAGCCTGCGGGGGCAGGGGGG - Intergenic
1180708498 22:17824117-17824139 TTGCACCAGCAGGAAGAGGGCGG + Intronic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182264504 22:29103265-29103287 CAGACCCAGCAGGAGCCAGGGGG + Intronic
1182453621 22:30435678-30435700 GTGCACCAGCAGGGGCAGGGAGG - Intergenic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182663030 22:31938444-31938466 CTGAACAAGCTGGAGGGGGGCGG + Intronic
1182760417 22:32718104-32718126 CTTTCCCAGCTGGAGCAGGGTGG + Intronic
1183599618 22:38832364-38832386 CTGCCCCAGCAGGAGCTGAGTGG - Intronic
1183603052 22:38851113-38851135 CTCGACGGGCAGGAGCAGGGAGG - Intergenic
1184118083 22:42433502-42433524 CTGAGCAGGCAGTAGCAGGGTGG - Intergenic
1184333245 22:43839066-43839088 GTGCACCAGCAGGTTCAGGGAGG - Intronic
1184407502 22:44308414-44308436 CTGAAGCTCCAGGAACAGGGAGG - Intronic
1184726149 22:46347805-46347827 CTGACCCAGCAGAAGCAGCAGGG - Intronic
1185330596 22:50250555-50250577 GGTCACCAGCAGGAGCAGGGGGG + Intronic
949716157 3:6933938-6933960 AGGAACCAACAGGATCAGGGTGG + Intronic
950528224 3:13536976-13536998 CAGCACAAGCAGGAGCTGGGAGG + Intergenic
950957497 3:17070195-17070217 CTGAATCAGCAGGACTAGGGTGG - Intronic
952414933 3:33081689-33081711 CTTAACCATCAGAAGCAGGAAGG + Intronic
952793248 3:37217240-37217262 CTGAGTCTGCAGGGGCAGGGGGG - Intergenic
953405888 3:42659527-42659549 CTGAACCTGAAGAAGCTGGGCGG + Exonic
953808861 3:46094974-46094996 CTGAACCAACAATGGCAGGGAGG - Intergenic
954152014 3:48662528-48662550 CTCAGCCAGGAGGAGCTGGGGGG - Exonic
954431890 3:50475282-50475304 CTGAACCAGCAACAGTAGGTTGG + Intronic
955008616 3:54992951-54992973 CTGAAGCAGGAGGAAGAGGGAGG + Intronic
956017726 3:64901706-64901728 CTGAATCAGCAGGAGCAACCAGG - Intergenic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956488023 3:69741648-69741670 CTGAACCAGCAGGGAAAGGAAGG + Intronic
957095217 3:75771831-75771853 CTGAGCCTGCAGGGGCAGGGGGG - Intronic
958019741 3:87980904-87980926 CTGAACCTGCAGGGGCAGGGAGG + Intergenic
958675673 3:97265580-97265602 CCGAGCCTGCAGGGGCAGGGGGG + Intronic
959259204 3:104053211-104053233 CTGAACCTGCAGGAGGATGGAGG - Intergenic
961026565 3:123563502-123563524 CTAAACCCACAGGAGCAGTGTGG + Intronic
961311296 3:126003786-126003808 CTGAGCCTGCAGGGGCAGGGGGG - Intergenic
961449606 3:126996573-126996595 CTGAAAGAGCTGGAGCTGGGGGG + Intronic
961643931 3:128382386-128382408 CGGCACCAGCAGGAGCTGTGTGG + Intronic
961672896 3:128547794-128547816 CAAAACCACCAGGGGCAGGGAGG + Intergenic
962808433 3:138943071-138943093 AGGAACCGGCAGGAGCAGGATGG - Intergenic
963807665 3:149741590-149741612 TTGAACCAAATGGAGCAGGGTGG + Exonic
963852776 3:150224684-150224706 CTGAACCATCAGAGGCAAGGTGG + Intergenic
965117947 3:164515487-164515509 CTGAACCTGGAGGAGCAAGAGGG + Intergenic
967231430 3:187341124-187341146 CTGAAGTAGTAGGAGCAGGTGGG + Intergenic
967578743 3:191126598-191126620 CTTAACCATCAGGAGCATGGTGG - Intergenic
968494479 4:907718-907740 CTGAACCTGCAGCTGCACGGGGG + Intronic
968558791 4:1265367-1265389 CAGAACCACCAGCATCAGGGTGG + Intergenic
968838423 4:2982079-2982101 CTGAGCCTGCAGGGGCAGGGGGG + Intronic
968913574 4:3487531-3487553 CAGACCCACCAGGAGCAGGAGGG + Intronic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
969109959 4:4838423-4838445 CTCATCCAGCAGCAGCAGTGGGG - Intergenic
969289605 4:6230288-6230310 CTGCTCCAGCAGGTTCAGGGTGG + Intergenic
970493342 4:16598964-16598986 CTGTTCCAGCATGGGCAGGGTGG + Intronic
970601337 4:17643091-17643113 CTGGAAGAGCAAGAGCAGGGGGG + Intronic
972612566 4:40669099-40669121 CTGAAACAGCTGGAGTAGGAAGG + Intergenic
973271537 4:48267855-48267877 CTGGAACAGCTGGGGCAGGGAGG + Intronic
973398579 4:49618554-49618576 CTGAGCCTGCGGGGGCAGGGGGG - Intergenic
975832795 4:78387593-78387615 CTGAACCATCATGAGCATAGTGG - Exonic
978309965 4:107376612-107376634 CTGAAACAGCAGGGGTAAGGAGG - Intergenic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
979649054 4:123107940-123107962 CTGAGCCTGCAGGGGCAGGAGGG + Intronic
980738190 4:136917836-136917858 CTGAACCTGCAAGGGCAAGGGGG - Intergenic
982741520 4:159061838-159061860 CTGAAACAGCAGGAGCACCATGG + Intergenic
983266833 4:165516146-165516168 ATGAAGCAGCAGGACCAGGTGGG + Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
986018518 5:3779378-3779400 GTGAACCACCAGGAGCAAAGAGG - Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986093749 5:4536193-4536215 CTGCACCAGCAGAAGCCAGGAGG + Intergenic
986153190 5:5146657-5146679 CTAGAACAGCAGCAGCAGGGTGG - Intronic
986290665 5:6396725-6396747 CTCCAGCAGCGGGAGCAGGGAGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
988109955 5:26807499-26807521 TGGAACCTGCAGGAGCAAGGGGG - Intergenic
991230789 5:64330944-64330966 CTGAGCCTGCAGGGGCAAGGGGG - Intronic
992460445 5:76954625-76954647 GTGGACCAGCAGGAGCGAGGCGG - Intronic
993429490 5:87814240-87814262 GTGCACCAGCAGTAGCTGGGTGG - Intergenic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
997355557 5:133260616-133260638 CTGGACCAGGAGGTGGAGGGCGG - Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
998090470 5:139364137-139364159 CTGAATCAGGAGGATGAGGGTGG + Intronic
998141530 5:139702274-139702296 CTGGAGCAGAAGGAGCAGGGAGG - Intergenic
998200629 5:140115107-140115129 CTCACCCTGCAGTAGCAGGGTGG - Exonic
998530148 5:142876893-142876915 CTGAACCAGAATCAGAAGGGTGG + Intronic
998563285 5:143192334-143192356 CAGCACCAGCAGGAACATGGAGG + Intronic
998869237 5:146536169-146536191 CTAAACCACTAGGAGCAGGAAGG - Intergenic
998977002 5:147659328-147659350 GAGAACCAGCAGAAGCAGGGTGG - Intronic
999269493 5:150288605-150288627 CTGAGGCAGCAGGAGCACGGGGG - Intronic
999523102 5:152372903-152372925 CTGAACAAATAGAAGCAGGGGGG + Intergenic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1002678100 5:180935578-180935600 CTGAGCCTGCAGGGGCAGAGAGG + Intronic
1003227225 6:4217363-4217385 CTCAACCAGCAGGTGAAGAGGGG + Intergenic
1005642264 6:27807595-27807617 CGGAAGCAGCAGGCGCACGGCGG + Exonic
1006582041 6:35082849-35082871 CTGGCCGAGAAGGAGCAGGGAGG - Intronic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1006888250 6:37400181-37400203 CAGAACCAACAGGAGAAGGAAGG - Intergenic
1006944684 6:37777576-37777598 CTGAAGCTGGAGGAGCGGGGAGG + Intergenic
1007294956 6:40814585-40814607 GTGACCCAGCAGGGGCATGGTGG + Intergenic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1010133643 6:72524300-72524322 CTGTGCCAGCAGGAGCAGGTGGG - Intergenic
1011930238 6:92701777-92701799 CTGAGCCTTCAGGGGCAGGGGGG + Intergenic
1013178750 6:107700386-107700408 CTCTACCTGCAGGAGCAGGGCGG + Intergenic
1013309226 6:108878328-108878350 CTGGGCTGGCAGGAGCAGGGAGG + Intronic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1016929363 6:149388339-149388361 CTAATTCAGCAGGAACAGGGAGG + Intronic
1017182337 6:151565141-151565163 CTGAAGCAGCAGCTGCAGGTGGG + Intronic
1017708926 6:157148481-157148503 CTGCACCAGCAGCAACAGGAAGG + Intronic
1017861955 6:158406905-158406927 CTGAACCTGCATGTGCTGGGGGG - Intronic
1017987916 6:159460668-159460690 CTGGAGCTGCAGGAGCAGGTAGG - Intergenic
1017996294 6:159534290-159534312 CTGGACCGGCAGGCGCAGGCTGG + Intergenic
1018291005 6:162292636-162292658 CTGAATCAGCTGGAGGAAGGTGG + Intronic
1018327728 6:162691841-162691863 CTGAAGCAGCAGTAGCAGCCTGG + Intronic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019224711 6:170500398-170500420 CAGAAACAGCAGGGGCAGGGGGG - Intergenic
1019572269 7:1718765-1718787 CTGAACCAACACGGCCAGGGAGG - Intronic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1020279876 7:6644718-6644740 TTGAACCACCAGGAGCCAGGCGG - Intronic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1021112529 7:16711915-16711937 CTGAATCAGCATGAGCTGGGAGG - Intergenic
1022275161 7:28847756-28847778 CTGCATCAGCTGGAGCTGGGAGG + Intergenic
1022482484 7:30753011-30753033 CTGAGCCTGGAGGAGCAGGCCGG + Intronic
1022615551 7:31926634-31926656 GTGGGCCAGCAGAAGCAGGGTGG + Intronic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1024668055 7:51565333-51565355 CTGAAATAGCAGGGGCAGGTGGG + Intergenic
1026285449 7:68958750-68958772 CTGAGCCTGGGGGAGCAGGGAGG - Intergenic
1028167142 7:87550262-87550284 CTGAACCTGAAGGTGCAGAGTGG - Exonic
1028816938 7:95157217-95157239 CTGAGCCTGCAGGGGCAGGGGGG + Intronic
1029032997 7:97488440-97488462 CTGCCCCAGCAGTTGCAGGGAGG + Intergenic
1029172628 7:98641678-98641700 CTGAAAGAGAAAGAGCAGGGAGG - Intergenic
1029309130 7:99644935-99644957 CCCACCCAGCAGGAGCAGGATGG + Intergenic
1029652963 7:101906330-101906352 GTGAGGCAGGAGGAGCAGGGAGG + Intronic
1030310027 7:108059652-108059674 CTGAACAGGCTGGAGTAGGGGGG - Intronic
1030988752 7:116274031-116274053 GTGACCCAGGAGGAGAAGGGTGG + Intergenic
1031780784 7:125961458-125961480 ATGGAACAGCAGGAGGAGGGAGG - Intergenic
1032081379 7:128860138-128860160 CTGATCCAGGAGGGGTAGGGAGG - Intergenic
1033274372 7:139960029-139960051 CAGAACGAGCAGGGCCAGGGTGG + Intronic
1033477925 7:141708682-141708704 GTGAACCTACAGAAGCAGGGAGG - Exonic
1035459277 7:159029352-159029374 CTGAGCCAGCTGCAGAAGGGTGG - Exonic
1035717486 8:1764615-1764637 CAGAACCTGTAGGAGCGGGGAGG + Intronic
1035732573 8:1863215-1863237 CTGAACCAGCAGATGCATGTGGG + Intronic
1035755533 8:2028374-2028396 CTGAACCTCTAGGAGGAGGGTGG + Intergenic
1036183181 8:6602241-6602263 CTTAAGCACCAAGAGCAGGGCGG + Intronic
1036710292 8:11074200-11074222 CTGCTCCAGCAGGAGCAGAAAGG + Intronic
1037810004 8:22081488-22081510 CTGAAGCAGCAGGGGTAAGGGGG - Exonic
1041182466 8:55263051-55263073 CTGAGGCAGAAAGAGCAGGGTGG - Intronic
1042624978 8:70748204-70748226 CAGAGCCAGCAGGAGCAGGTGGG + Intronic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1047451963 8:124973182-124973204 CTGGACCAGAAGGAGCGTGGGGG - Intergenic
1048206222 8:132417383-132417405 AGGAACCAGCAGGAGATGGGTGG - Intronic
1049044373 8:140137605-140137627 CTGATTCAGCAGGTGCGGGGTGG - Intronic
1049688665 8:143949403-143949425 CTGTACCAGCAGGACCCAGGTGG - Intronic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1050022068 9:1294539-1294561 CTGAGGCAACAGGGGCAGGGTGG - Intergenic
1050865032 9:10488011-10488033 CTGAACCACCTGGAGCTGGGGGG + Intronic
1051879957 9:21829747-21829769 CAGTGCCAGCATGAGCAGGGCGG + Intronic
1052784387 9:32815106-32815128 TTGAACCTGCAGGAGCGTGGAGG + Intergenic
1053466466 9:38312143-38312165 CTGAACCAGCAGGGGCTGGGAGG + Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056156052 9:83838787-83838809 CTGAACCAGAGTGAGCAGTGGGG - Intronic
1056905759 9:90646293-90646315 CTGAATCAACAGGTCCAGGGTGG - Intergenic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1059437507 9:114285493-114285515 CTGAGCCAGCAGGGGAGGGGAGG - Intronic
1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060966381 9:127714481-127714503 CTGACCCAGCCGGGGCAGGGAGG - Intronic
1061150423 9:128824976-128824998 CTGAACCAGCAGCAGCACCCAGG - Exonic
1061177114 9:129004341-129004363 GGGAACCAGCTGGAGAAGGGAGG + Intronic
1061893351 9:133634352-133634374 CTGACCCCGGAGGAGCAGGAGGG + Intergenic
1062026444 9:134342801-134342823 CTGAGCCAGCCAGAGCAGGAAGG - Intronic
1062026829 9:134344414-134344436 CTGACTCAGCAGCTGCAGGGTGG + Intronic
1062112929 9:134791979-134792001 CTGACCCAGAAGGTCCAGGGAGG + Intronic
1062568292 9:137172925-137172947 CTGGAATAGCAGGTGCAGGGAGG - Intergenic
1062733150 9:138120477-138120499 CATAACCAGCCAGAGCAGGGTGG + Intronic
1203691650 Un_GL000214v1:47995-48017 CTGAGCCTGCGGGGGCAGGGGGG + Intergenic
1203540639 Un_KI270743v1:84673-84695 CTGAGCCTGCGGGGGCAGGGGGG + Intergenic
1203644645 Un_KI270751v1:56196-56218 CTGAGCCTGCGGGGGCAGGGGGG - Intergenic
1187274103 X:17803664-17803686 CTGAGGCAGGAGGAGAAGGGGGG + Intronic
1190023825 X:46903937-46903959 CCGACCCAGCAGCAGCAGGTAGG + Intergenic
1196054507 X:111340382-111340404 CTGAACCTGTAGGAGTAAGGGGG + Intronic
1197146840 X:123181418-123181440 CTGAGCCAGCAGGGGCACAGTGG - Intergenic
1197342115 X:125287198-125287220 CTGAGCCTGCAGGGGCAGGGGGG - Intergenic
1197609631 X:128623617-128623639 CTGAGCCTGCAGAGGCAGGGTGG + Intergenic
1198664509 X:139005204-139005226 CTGTACCACCTGGAGCTGGGGGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199111907 X:143945490-143945512 CTGAAACAGAATGGGCAGGGTGG + Intergenic
1199649983 X:149940498-149940520 CTGAGGGAGGAGGAGCAGGGGGG + Intergenic
1200740347 Y:6847096-6847118 GAGAGCAAGCAGGAGCAGGGTGG - Intergenic
1201589040 Y:15593496-15593518 CTGAACAAGAAGGAGAAGAGAGG - Intergenic