ID: 1142598050

View in Genome Browser
Species Human (GRCh38)
Location 17:1039195-1039217
Sequence CACCCTTCAGAGGCGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142598041_1142598050 8 Left 1142598041 17:1039164-1039186 CCTGTCTGGACCGGCTTCTCTGC 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1142598050 17:1039195-1039217 CACCCTTCAGAGGCGGGTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 102
1142598040_1142598050 16 Left 1142598040 17:1039156-1039178 CCTGAGGTCCTGTCTGGACCGGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1142598050 17:1039195-1039217 CACCCTTCAGAGGCGGGTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 102
1142598043_1142598050 -2 Left 1142598043 17:1039174-1039196 CCGGCTTCTCTGCATGGTGCCCA 0: 1
1: 0
2: 4
3: 49
4: 355
Right 1142598050 17:1039195-1039217 CACCCTTCAGAGGCGGGTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142598050 Original CRISPR CACCCTTCAGAGGCGGGTCA GGG Intronic
900929636 1:5728454-5728476 CACCCTCCAGAGGAGGCTCGTGG + Intergenic
901164388 1:7207560-7207582 CACCCATTAGAGGTGGGACAGGG - Intronic
904024909 1:27496724-27496746 CTCCCCTCAGATGGGGGTCAGGG - Intergenic
904895194 1:33812033-33812055 CACCCTTCCTAGGAGGGTCTGGG + Intronic
906210061 1:44007785-44007807 CAGCCTTCAGAGGAGACTCAGGG - Intronic
913283557 1:117207998-117208020 GAGCCTTCAGAGGGGGGTCAAGG - Intronic
917843471 1:179001737-179001759 CACCCTTCACAGGAGGGTGGTGG - Intergenic
919910080 1:202105890-202105912 CACCCTAGAGAGGAGGGTGAAGG - Intergenic
922531498 1:226348831-226348853 GACGCTTCAAGGGCGGGTCACGG - Intergenic
924233345 1:241980388-241980410 CATTCTTCAGAGGCTGGCCATGG - Intergenic
924384591 1:243489490-243489512 CGACCTTCAGAGGCAGCTCAAGG - Intronic
1064207916 10:13340160-13340182 GACCTCACAGAGGCGGGTCATGG + Intronic
1066044453 10:31583576-31583598 CACCCTGCAGAGCCAGGACAGGG - Intergenic
1067460936 10:46458104-46458126 CACCTTACAGAGGAGGATCATGG - Intergenic
1067626255 10:47926496-47926518 CACCTTACAGAGGAGGATCATGG + Intergenic
1074793283 10:116914181-116914203 AACCCATCAGAGGCCGGGCATGG + Intronic
1075648044 10:124109360-124109382 CAGCCTTCAGATGAGTGTCAGGG - Intergenic
1075786743 10:125055105-125055127 TACCATTCAGAGGGGGGTCTAGG - Intronic
1076896134 10:133313271-133313293 CACCCCTCAGAGGTGGGTGATGG + Intronic
1076922243 10:133460027-133460049 CACACTTCGGAGCCGGGGCAGGG + Intergenic
1079356309 11:19732796-19732818 GACCCTGCAGAGGCTGGGCAGGG - Intronic
1084715551 11:70871235-70871257 CACACTTCAAAGGGGAGTCAGGG + Intronic
1084945053 11:72633913-72633935 CTCCCTTCAGCGCTGGGTCATGG - Intronic
1090931996 11:131306025-131306047 CAACCTTCACTTGCGGGTCATGG + Intergenic
1092165597 12:6340747-6340769 CAGCCTTCAGAGGCCGGGCAGGG + Intronic
1092385649 12:8033742-8033764 CCCTCTTCAGAGGCAGGTGACGG - Exonic
1101817807 12:108159118-108159140 CAACCTCCAGAGGTGGGACAGGG - Intronic
1105774026 13:23639713-23639735 CTCCCTCCAGGGCCGGGTCAGGG - Intronic
1108309435 13:49172542-49172564 CAGCCTACAGAAGCTGGTCAAGG - Intronic
1108466034 13:50715971-50715993 CACCCTGCTGAGGCAGGTCTGGG + Intronic
1112818366 13:103300729-103300751 CATCCTTCAGAGGAGGCTAAGGG - Intergenic
1113780039 13:112971316-112971338 CACTCTTCAGCGGGAGGTCATGG + Intronic
1118702918 14:68451741-68451763 CACCCATCAGAGCAGGGCCAGGG + Intronic
1121427443 14:93862603-93862625 CACCCTGCAGAGAAGGGTCTGGG + Intergenic
1122459434 14:101882931-101882953 CCCCCTGCAGAGTTGGGTCATGG + Intronic
1129177860 15:73852919-73852941 GACCCTTCAGAGTGGGGTGAGGG - Intergenic
1132204747 15:99978513-99978535 AACCCTTCGGAGGCAGCTCATGG + Intronic
1132467495 16:84176-84198 CTCCCTACTGAGGTGGGTCAGGG + Intronic
1133442803 16:5835172-5835194 CAGCCTTAAGAGGCTGGTGAGGG + Intergenic
1133522535 16:6573222-6573244 CAGCCATCAGACGTGGGTCATGG + Intronic
1135778691 16:25279785-25279807 CACCCTGCAGAGGCCAGTCCAGG + Intergenic
1137257632 16:46790075-46790097 CACCCTCCCGAGGCGGGGAAGGG - Intronic
1138595606 16:58027502-58027524 CACCGTTCAGAAGCGGCTCCGGG - Intronic
1142598050 17:1039195-1039217 CACCCTTCAGAGGCGGGTCAGGG + Intronic
1143410197 17:6704053-6704075 CAGCCTGCAGAGGAGGGGCAGGG + Exonic
1146591263 17:34129896-34129918 CCCCCTTGAGAGGCAGGACATGG - Intronic
1148115034 17:45170484-45170506 CCCCCTGCAGAGAGGGGTCAGGG - Intergenic
1151578382 17:74963989-74964011 CAGGCTGCAGAGGAGGGTCAGGG + Intronic
1152869751 17:82746508-82746530 CGTCCTTCAGAGGCTGGGCATGG + Intronic
1153762403 18:8344694-8344716 CACCCTTAGGAGGCTGGGCAGGG + Intronic
1153989318 18:10381915-10381937 CACCATTCACAGGCTGGCCATGG + Intergenic
1154402681 18:14056615-14056637 GACCCTTCAGAAGCTGGGCAAGG + Intergenic
1156487777 18:37477520-37477542 CATTCTTCAGAGGCTGGCCAAGG - Intronic
1158833515 18:61305303-61305325 CAGCCTTCAGAGGTGGGTACTGG - Intergenic
1162073899 19:8171825-8171847 CACCTTTCTCAGGCAGGTCAGGG + Intronic
1163852165 19:19670268-19670290 CTCCCTTCTGAGGCAGCTCAGGG + Intronic
1168269550 19:55242090-55242112 GGCCCCTCAGAGGCGGGTCTCGG - Intronic
927848446 2:26484315-26484337 CACTCTTCCGAGGCAGGGCAGGG - Intronic
930089770 2:47523299-47523321 CACCCTTCAGAGACTGAGCATGG + Intronic
931390985 2:61843851-61843873 CAGTCTTCAGAGGCCGGGCACGG + Intronic
932715846 2:74100388-74100410 CACCCTTCAGAGACAGGCCTGGG - Exonic
934663818 2:96156914-96156936 CACCCTTCAGCAGGGAGTCAAGG + Intergenic
935108506 2:100069320-100069342 TACCCTCCAGAGGGGGGTCCAGG + Intronic
936597907 2:113866812-113866834 CACAGTTCAGAGGAGGGTTATGG - Intergenic
938084299 2:128388661-128388683 CAGCCTTCAGGGGTGGGTCCAGG + Intergenic
946759856 2:222982762-222982784 CACCCTTAAGAGGAGGGGCAAGG - Intergenic
948415250 2:237798414-237798436 CCGCCCTCAGAGGCGGGACAGGG - Intronic
1170871203 20:20208430-20208452 CAGGCTTCAGCAGCGGGTCAGGG - Intronic
1171334473 20:24371009-24371031 CTCCCTTCAGAGGAGGCTCCCGG - Intergenic
1176191766 20:63814538-63814560 CCCCCTGCAGAGGCAGGTCTTGG - Intronic
1180703160 22:17792753-17792775 CGTCCTTCAGAGGAGGCTCAGGG - Intronic
1183238509 22:36638306-36638328 CACCCTTCAGAGGCTTCCCATGG + Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
952495289 3:33910603-33910625 CACCCTTCAGAGGCAGGGGTGGG + Intergenic
953500215 3:43425932-43425954 CACCCTTCAGAGGGGATACATGG - Intronic
953772982 3:45792900-45792922 CACACTTCAGGGAAGGGTCAGGG - Intronic
961520193 3:127462832-127462854 CACCCCACAGAGGCGGCTGAGGG + Intergenic
968545099 4:1194338-1194360 ACCACTTCAGAGGCGGTTCAAGG + Intronic
968647076 4:1746454-1746476 CACCCTGAAGGGGCGGGGCACGG + Intergenic
968972277 4:3802294-3802316 CACCCTGCAGGGGCGGGCCGCGG + Intergenic
975106558 4:70574057-70574079 CACCATTCTTAGGCCGGTCATGG + Intergenic
982060654 4:151601148-151601170 AACCCTTCAGAGGGGAGTCAGGG + Intronic
985899669 5:2778845-2778867 GTCCCTTCAGAGGTGGGTAATGG - Intergenic
985906924 5:2846043-2846065 CAGCTTGCAGAGGCAGGTCATGG - Intergenic
986374299 5:7114724-7114746 CTCCCTTCAGAGGGGAGGCAGGG - Intergenic
993537211 5:89101634-89101656 CACCCTTGAGAAGGGGTTCAAGG + Intergenic
998370821 5:141659923-141659945 CACCCTGCAGAGGGGTGCCACGG + Exonic
1000239863 5:159399391-159399413 CACCATCCAGGGGCGGGCCACGG - Intergenic
1005226521 6:23649759-23649781 CACCCTTCACAGGCTGGACTGGG + Intergenic
1006389249 6:33748884-33748906 CACCCTGCAGGGGGGAGTCAGGG - Intergenic
1011197324 6:84794777-84794799 GACCCTAAAGAGGCAGGTCAGGG - Intergenic
1014613142 6:123568714-123568736 CACTCTTCTGAGGCTGGCCAGGG + Intronic
1015655610 6:135514843-135514865 CTCCCTTCAGAGGCTCGGCAGGG + Intergenic
1019738361 7:2661239-2661261 CACCCTCCAGGGCCGGGCCAAGG - Intronic
1029016977 7:97325453-97325475 CATCCTGCAAAGGGGGGTCAGGG - Intergenic
1034164380 7:149014315-149014337 CACCCATCTGAGGCGGTTCTTGG + Intronic
1035826850 8:2654048-2654070 CACCCTTCAGAGGGAGGGTAAGG - Intergenic
1037948396 8:23003663-23003685 CAGCTTTCAGATGCGGGTGAGGG - Intronic
1046835295 8:118794230-118794252 TACTCATCAGAGGCGGGTAAAGG + Intergenic
1047220094 8:122911906-122911928 CACCTTTTAGAGGCGGGGAATGG + Intronic
1049019665 8:139947237-139947259 CACACTTCAGATGCGAGTGAGGG + Intronic
1056764498 9:89436530-89436552 CACCCTTCAGCGCAGGGACAAGG + Intronic
1057187246 9:93063653-93063675 CACCCTGAGGAGGCAGGTCAGGG + Intronic
1058961270 9:109994870-109994892 CACCCATCAGCTGCGAGTCAGGG + Intronic
1059639470 9:116202595-116202617 CACTCTTGAGAGGCGGCTCAGGG + Intronic
1061036082 9:128115063-128115085 CACCCTTCTGAGGTGAGGCAAGG - Intergenic
1062473222 9:136715199-136715221 CACCCTTCAGCTGCAGGTCAGGG + Intronic
1062573494 9:137196036-137196058 CACCCCTCGGAGGCGGGCAAGGG + Intronic
1196754429 X:119145455-119145477 CACCCTCCAGTTGAGGGTCAAGG + Intronic
1200091055 X:153636233-153636255 GACCCTTCAGAGGCCGAGCAAGG + Intergenic