ID: 1142599220

View in Genome Browser
Species Human (GRCh38)
Location 17:1045116-1045138
Sequence GCTTCGGAGGAGCCGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142599214_1142599220 12 Left 1142599214 17:1045081-1045103 CCTCAAGAAGGGAAAAGGCACAG 0: 1
1: 0
2: 0
3: 33
4: 304
Right 1142599220 17:1045116-1045138 GCTTCGGAGGAGCCGGAGGAAGG 0: 1
1: 0
2: 0
3: 24
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142599220 Original CRISPR GCTTCGGAGGAGCCGGAGGA AGG Intronic
900060230 1:674817-674839 GGGTCGGAGGAGCAGGAGTATGG + Intergenic
900095402 1:938118-938140 GCTTCGGAGGAGCTCGGGGTGGG + Intronic
900107109 1:987391-987413 GCTTCTGAGGAGGCTGAGGCAGG - Intergenic
900339643 1:2181949-2181971 GCTGGGGAGGAGCCGGAGGGAGG - Intronic
900512840 1:3068544-3068566 GCTTCGGAGGAGCCGGGTTCTGG + Intergenic
901207175 1:7503917-7503939 GCTGGAGAGGAGCCAGAGGAAGG + Intronic
901296055 1:8161720-8161742 GCCACGGAGCAGCAGGAGGAAGG - Intergenic
901392770 1:8957844-8957866 GCTTCTGAGGAGGCTGAGGTGGG + Intronic
901763746 1:11487251-11487273 GAGTCGGAGGAGCCTGGGGAGGG + Intronic
902633613 1:17720378-17720400 GCTTCCCAGGAGCCAGAGGCCGG + Intergenic
902722310 1:18312048-18312070 GCTACGGAGAAGCAGAAGGAAGG - Intronic
902749403 1:18496751-18496773 GCTACGGGGGAGCCTGAGGCAGG + Intergenic
903420958 1:23217539-23217561 GCGAGGGAGGAGCTGGAGGAGGG - Intergenic
904014575 1:27409827-27409849 GCCCCGGAGGAGGAGGAGGAGGG + Exonic
904030042 1:27528032-27528054 ACTTGGCTGGAGCCGGAGGAAGG + Intergenic
905253769 1:36666601-36666623 GATTCTGAGGAGCCAGAGGGAGG - Intergenic
906618648 1:47255043-47255065 GCTTCTCAGGAGCCTGAGGCAGG + Intronic
910953039 1:92671912-92671934 GCTACTCAGGAGGCGGAGGAAGG - Intronic
911296284 1:96119932-96119954 GCTGCGCAGGAGGCTGAGGAAGG - Intergenic
912231001 1:107792417-107792439 GCTACTGAGGAGCCTGAGGTGGG - Intronic
913361048 1:117980341-117980363 GCTACCGAGGAGCCTGAGGCAGG - Intronic
913470461 1:119180852-119180874 GATCAGGAGGAGCAGGAGGAAGG - Intergenic
916651585 1:166839376-166839398 GCCTCGGCGGCGCCGGGGGACGG - Intergenic
917484939 1:175447303-175447325 CCTTCAGAGAAGCAGGAGGAAGG - Intronic
918071758 1:181138438-181138460 GCTACTGAGGAGGCTGAGGAAGG - Intergenic
920056386 1:203195792-203195814 ATTTCAGAGGAGCCAGAGGAGGG + Intergenic
920073548 1:203320960-203320982 GCTGGGGAGGAGCTGGGGGAGGG - Intergenic
920445450 1:206012682-206012704 GTTTCCTAGGAGCCGGGGGAGGG - Intronic
920974382 1:210771933-210771955 GCTTTGGAGGAAATGGAGGAAGG + Intronic
922773638 1:228204684-228204706 GCTACTGAGGAGGCTGAGGAAGG + Intronic
923436705 1:233974294-233974316 GCTACTCAGGAGGCGGAGGAAGG - Intronic
1062878069 10:957906-957928 GCTACTGAGGAGGCTGAGGAGGG - Intergenic
1063238782 10:4146707-4146729 GCTTCTGAGGAGGCTGAGGTAGG - Intergenic
1063266661 10:4458996-4459018 GCTTCGGGGGTGCGGGAGGAGGG - Intergenic
1063466062 10:6245526-6245548 GCTACGGGGGAGGCTGAGGACGG - Intergenic
1063646975 10:7894985-7895007 GCTTCTGAGGAGGCTGAGGCAGG - Intronic
1064644523 10:17447292-17447314 GCTACTGAGGAGGCGGAGGCAGG + Intronic
1064723983 10:18258612-18258634 GCTACTCAGGAGCCTGAGGAAGG + Intronic
1066016190 10:31246202-31246224 GCTACGGAGGAGGCTGAGGCAGG + Intergenic
1066180764 10:32958439-32958461 GGCTAGGAGGAGGCGGAGGATGG + Intronic
1066353002 10:34654715-34654737 ACTTGGGAGGAGCTGTAGGATGG - Intronic
1067031661 10:42882192-42882214 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1067295836 10:44974794-44974816 GCTTCCGAGGGGCTAGAGGAGGG + Intronic
1069411702 10:68160803-68160825 GCTACGCAGGAGCCTGAGGTAGG + Intronic
1069698429 10:70404633-70404655 GCTTCGGTGGAGCTGGGGGCGGG - Intronic
1069740630 10:70685001-70685023 GCTCCGGAGGAGCCGCAGTGAGG - Intronic
1069748587 10:70731701-70731723 GCAGCGGGGGAGCTGGAGGAAGG - Intronic
1069772355 10:70907820-70907842 GCTTTGGGGGAGGTGGAGGAAGG + Intergenic
1070332694 10:75429804-75429826 GCTTCTGTGAAGCCAGAGGACGG + Intergenic
1070372919 10:75802204-75802226 GCTACTGAGGAGCCTGAGGTGGG + Intronic
1071072139 10:81706697-81706719 GCTACTCAGGAGCCCGAGGAAGG - Intergenic
1071935137 10:90521720-90521742 GCTACGTAGGAGGCTGAGGAAGG - Intergenic
1072610775 10:97016505-97016527 GCTTCTCAGGAGGCTGAGGAGGG - Intronic
1072656751 10:97334954-97334976 GCCTCGGAGGAGGCTGAGGTTGG + Intergenic
1073299989 10:102465311-102465333 GCTACTGAGGAGACTGAGGAAGG + Intronic
1075106394 10:119542681-119542703 GCGGCGGCTGAGCCGGAGGAAGG + Exonic
1075619447 10:123915048-123915070 GCATCAGAGGAGCCGCGGGAGGG - Intronic
1077243382 11:1523760-1523782 GCTGTCGAGGAGCCGCAGGAAGG + Intergenic
1078729473 11:13962651-13962673 GCGGCGAAGGAGCGGGAGGAGGG - Intergenic
1080426155 11:32156258-32156280 GCTTCTCAGGAGGCTGAGGAAGG - Intergenic
1081661570 11:44891719-44891741 GCTTTGGAGCAGCCAGAGCAGGG + Intronic
1081921341 11:46780077-46780099 GCTACTCAGGAGCCTGAGGAAGG - Intronic
1083463311 11:62829650-62829672 GCTACTGAGGAGCCTGAGGCAGG + Intronic
1084328577 11:68416264-68416286 GCCACAGAGGAGCTGGAGGACGG - Intronic
1084440468 11:69169903-69169925 GCTTTTGAGGAGGCGGAGGATGG - Intergenic
1084481711 11:69425070-69425092 GTTTCCCAGGAGCAGGAGGAGGG + Intergenic
1084485387 11:69445000-69445022 GCTGCGGGGGAGACGGAGGGCGG + Intergenic
1084559324 11:69893859-69893881 GCCTGGGTGGGGCCGGAGGAAGG + Intergenic
1085677460 11:78537687-78537709 GCTACTGAGGAGGCTGAGGAAGG + Intronic
1088165040 11:106924891-106924913 GCTACTGAGGAGCCTGAGGTGGG + Intronic
1090620185 11:128553695-128553717 GCTGAGGAGGAGGAGGAGGAGGG - Intronic
1092248605 12:6878289-6878311 GCTACGCAGGAGGCTGAGGAAGG + Intronic
1092658224 12:10710089-10710111 GCTGGGGAGGAGGAGGAGGAAGG - Exonic
1094538866 12:31346101-31346123 GCTACTGAGGAGGCTGAGGAAGG + Intergenic
1095272230 12:40233087-40233109 GCTACTGAGGAGGCTGAGGAAGG + Intronic
1095852668 12:46828034-46828056 GCTTGGGAGGAGGCTGGGGAGGG - Intronic
1098618536 12:72560712-72560734 GCTACTGAGGAGGCTGAGGAAGG + Intronic
1100468897 12:94873364-94873386 GCGTCAGGGGAGCCGGAGAAGGG + Intergenic
1100963025 12:99984563-99984585 GCTTTTGAGGAGCGGGAGGAGGG + Intronic
1101650511 12:106673272-106673294 GCCAGGGAGGAGCCGGAGCAGGG - Intronic
1102460525 12:113097030-113097052 GCTGGGGAGGAGCCTGCGGAAGG + Exonic
1102462782 12:113110202-113110224 GCTGGGGAGGAGGGGGAGGAGGG + Intronic
1102596535 12:113997015-113997037 GCTTCGCAGGAGGCTGAGGCAGG + Intergenic
1102903536 12:116657479-116657501 GTTTATGAGGAGTCGGAGGAGGG - Intergenic
1103133873 12:118491073-118491095 TCTTGGAAGGAGCTGGAGGAGGG + Intergenic
1103555786 12:121765777-121765799 CCTGAGGAGGAGCTGGAGGAGGG - Intronic
1103613029 12:122135565-122135587 GCTTGGGAAGAGCCGGGAGACGG - Exonic
1105775918 13:23659964-23659986 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106299344 13:28449928-28449950 GCTTAGGCGAAGCCAGAGGAAGG - Intronic
1107911824 13:45112503-45112525 GCTTCTCAGGAGGCTGAGGAAGG + Intergenic
1108475020 13:50807405-50807427 GCTTGAGAGAAGCAGGAGGAGGG - Intronic
1109821304 13:67659058-67659080 GCTATGGAGTAGCCAGAGGAAGG + Intergenic
1111139684 13:84099800-84099822 GCTTCTGAGTAGCAAGAGGATGG + Intergenic
1111670668 13:91325795-91325817 GCTTCTCAGGAGGCTGAGGAGGG - Intergenic
1112513040 13:100026902-100026924 GCTTAGGAGGAGGAAGAGGAGGG - Intergenic
1113854843 13:113437470-113437492 GCTTGGGAGAGGCAGGAGGACGG - Intronic
1113857830 13:113458474-113458496 ACTTGGGAAGAGCCGCAGGAGGG - Intronic
1114450650 14:22822809-22822831 GCCTCCTCGGAGCCGGAGGAGGG + Intronic
1114815563 14:25954074-25954096 GCTTTGGAGGAGCGAGGGGAGGG - Intergenic
1115215506 14:31009989-31010011 GCTTCTGAGGAGGCTGAGGCAGG + Intronic
1116665124 14:47764850-47764872 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1116679452 14:47946852-47946874 GCTACTCAGGAGCCTGAGGAAGG + Intergenic
1116849521 14:49893713-49893735 GCGTCGGAGGAGCCGGGGCCGGG - Exonic
1117694265 14:58342799-58342821 GCTACTCAGGAGCCTGAGGAAGG + Intronic
1118827038 14:69393203-69393225 GCTACTGAGGAGACTGAGGAAGG + Intronic
1118961124 14:70533969-70533991 GCTTCTCAGGAGGCTGAGGAAGG + Intronic
1119040509 14:71270118-71270140 GCTTGGGAGGGGCTGGGGGAGGG + Intergenic
1119331773 14:73800308-73800330 GCTTCTCAGGAGGCTGAGGAGGG + Intergenic
1119650588 14:76380234-76380256 ACTTCTGATGGGCCGGAGGAAGG + Intronic
1119753474 14:77097925-77097947 GGTTCAGAGGAGCCGGGGGTGGG - Intergenic
1121052748 14:90830153-90830175 GGTGGGGAGGAGACGGAGGACGG + Intergenic
1121158873 14:91715438-91715460 GCTACTGAGGAGCCTGAGGCAGG + Intronic
1121231595 14:92362603-92362625 GCTTAGGAGCTGCCGGGGGATGG + Intronic
1122264452 14:100540149-100540171 GCTTCGCAGGAGCCTGTGGCTGG - Intronic
1122633883 14:103121414-103121436 GCTGGGGAGGAGCCGTAGGCTGG + Intergenic
1123043521 14:105500164-105500186 CCTTAGGAGGAGCTGGCGGAGGG - Intergenic
1123487664 15:20755871-20755893 GGTGAGGAGGAGCTGGAGGAGGG - Intergenic
1123544156 15:21324929-21324951 GGTGAGGAGGAGCTGGAGGAGGG - Intergenic
1123739217 15:23218978-23219000 GCTACTGAGGAGGCTGAGGAAGG + Intergenic
1124233290 15:27965524-27965546 GCATCGGAGGAACTGGAGTATGG + Intronic
1124290435 15:28447934-28447956 GCTACTGAGGAGGCTGAGGAAGG + Intergenic
1124292802 15:28469614-28469636 GCTACTGAGGAGGCTGAGGAAGG - Intergenic
1126002188 15:44221274-44221296 GCTACTGAGGAGTCTGAGGAAGG + Intergenic
1126710752 15:51453080-51453102 GCTTGGGAGGGGTGGGAGGAGGG + Intronic
1127958070 15:63870567-63870589 GCTTCGGAGGGGGAGCAGGAGGG - Intergenic
1128018098 15:64365376-64365398 GCTTCTCAGGAGGCTGAGGAGGG - Exonic
1129233912 15:74212408-74212430 GCTGAGCAGGAGCTGGAGGAGGG - Intergenic
1129300341 15:74621741-74621763 GACTCGGAGGAGGAGGAGGAGGG + Intronic
1129917836 15:79290134-79290156 GCTTCTGAGGAGGCTGAGGCAGG - Intergenic
1131036458 15:89225628-89225650 GCTACTGAGGAGGCTGAGGAAGG + Intergenic
1131430123 15:92380619-92380641 GCTACTCAGGAGCCTGAGGAAGG + Intergenic
1131467558 15:92667858-92667880 GCCTCAGAGGAGGTGGAGGAGGG - Intronic
1132102450 15:99034216-99034238 GCTTCTCAGGAGACTGAGGAAGG - Intergenic
1202952499 15_KI270727v1_random:52200-52222 GGTGAGGAGGAGCTGGAGGAGGG - Intergenic
1134849760 16:17470524-17470546 GCGGCGGAGGAGGAGGAGGACGG - Exonic
1135717459 16:24784111-24784133 GCTACTCAGGAGCCTGAGGAAGG - Intronic
1135724765 16:24845949-24845971 GCTTGGGACGAGCTGGAGGAAGG - Exonic
1138242157 16:55435977-55435999 GCTTCCCAGGAGCTGGAGAAAGG - Intronic
1138508040 16:57488018-57488040 GCTACTGAGGAGCCTGAGCAGGG - Intergenic
1138840254 16:60493574-60493596 GCTTGGGAGGAGGCTGAGGCAGG - Intergenic
1139220566 16:65177307-65177329 GCTTCTCAGGAGGCTGAGGAGGG + Intergenic
1139298860 16:65926855-65926877 GCTACTGAGGAGCCTGAGGCAGG + Intergenic
1139932929 16:70543963-70543985 GCTACTGAGGAGGCGGAGGTGGG - Intronic
1141150303 16:81560034-81560056 GCTACTCAGGAGCCTGAGGAAGG + Intronic
1141174727 16:81711229-81711251 GGTTTGGAGGTGCCGGAGGAGGG - Exonic
1141329922 16:83101680-83101702 GCTACTGAGGAGGCTGAGGAAGG + Intronic
1142228656 16:88889263-88889285 GCGTGGGAGGGGGCGGAGGAAGG + Intronic
1142599220 17:1045116-1045138 GCTTCGGAGGAGCCGGAGGAAGG + Intronic
1142665256 17:1459312-1459334 GCTACTGAGGAGGCTGAGGAAGG - Intronic
1142889775 17:2935707-2935729 TCTTCGGAAGTGCCGGAGGATGG + Intronic
1143827912 17:9627830-9627852 GCTTCTTAGGAGGCTGAGGAAGG - Intronic
1144572341 17:16407742-16407764 GGGGTGGAGGAGCCGGAGGAGGG + Intergenic
1147574149 17:41588950-41588972 CCCTCGGAGGAGGGGGAGGAAGG - Intergenic
1147702624 17:42405418-42405440 GCGTCGGAGGAGGCGGATGTGGG + Intronic
1148053863 17:44782051-44782073 GCTTTGCTGGAGCCAGAGGAGGG - Intergenic
1149974531 17:61252506-61252528 GCTCCAGAGGGGCCGGAGGCAGG + Intronic
1150433826 17:65139176-65139198 GCTGGGGAGGAGGAGGAGGATGG - Intronic
1150937994 17:69658601-69658623 GCTCCTGAGGAGCCTCAGGATGG + Intergenic
1151444186 17:74152559-74152581 TCTTCAGAGGTCCCGGAGGAAGG - Intergenic
1152232049 17:79118648-79118670 GCCTTGGAGGAGGTGGAGGAGGG - Intronic
1152440843 17:80308536-80308558 ACTTAGGAGGAGCCTTAGGAGGG - Intronic
1152474539 17:80509366-80509388 GCTCCGCAGCAGCCGGAAGAGGG + Intergenic
1153234619 18:2974186-2974208 GCTACTGAGGAGGCTGAGGAAGG - Intronic
1153794406 18:8609504-8609526 GCGGCGGAGGAGGAGGAGGAGGG + Exonic
1153905748 18:9659738-9659760 GGTCCGGAGGAGCCGGAGTCAGG + Intergenic
1155607601 18:27625214-27625236 GCTCCTGAGGAGGCTGAGGAAGG + Intergenic
1159492355 18:69153506-69153528 GCTACCGAGGAGGCCGAGGAGGG + Intergenic
1159590670 18:70332030-70332052 GTTTTGGAGGAGTCGTAGGAGGG + Intergenic
1159918102 18:74203689-74203711 GCTTCAGGGGAGCTGGGGGAAGG + Intergenic
1160493458 18:79356765-79356787 GCTGCAGAGCAGCCGCAGGAGGG + Intronic
1160909695 19:1468915-1468937 GTCTGGGAGGAGCTGGAGGAGGG - Exonic
1161085550 19:2333315-2333337 GCTTTGCGGGAGCAGGAGGAAGG + Intronic
1161968476 19:7561915-7561937 GCTTCTGAGGAGCCAGAGAAGGG - Intergenic
1162154005 19:8664466-8664488 GCTCAGGAGGTGCCGGGGGAGGG + Intergenic
1163018406 19:14470520-14470542 GGTTTGGAGCAGCCAGAGGAGGG + Intronic
1163117229 19:15195898-15195920 GCTTTGGGGGAGACGGAGGGGGG + Intronic
1163429664 19:17259688-17259710 GCTGCGGAGGCGCCGAAGCAGGG + Exonic
1163508600 19:17722338-17722360 GCTACTCAGGAGCCCGAGGAGGG + Intronic
1163607094 19:18281481-18281503 GCGGCGGGGGAGGCGGAGGATGG - Exonic
1164712624 19:30368260-30368282 GCTAAGGAGAAGCTGGAGGATGG - Intronic
1165429974 19:35766976-35766998 GCCTGGGGGGAGCTGGAGGAGGG + Intronic
1166140014 19:40800493-40800515 GCGGAGGAGGAGGCGGAGGAGGG + Exonic
1168251969 19:55146680-55146702 GCTGCGGAGGAGGAGGAGGAAGG - Exonic
1168335580 19:55595700-55595722 GCTTTGGAGGAACTGGAGGAAGG - Intronic
1168339469 19:55615023-55615045 GCTGCGGAGGCGCCCAAGGACGG + Exonic
925182682 2:1827199-1827221 GCTTCGTAGGAGCTGGGGCACGG + Intronic
925317142 2:2935275-2935297 GCTGAGGAGGAGGCAGAGGAGGG + Intergenic
927641314 2:24847501-24847523 GCTTCGGTGGAGCCAGGGCAGGG - Intronic
927836368 2:26402175-26402197 GCGCCGCAGGAGCCGGAGAAGGG + Intronic
927863122 2:26572795-26572817 GCTTCCGAGGAGGAGAAGGAGGG + Intronic
927902688 2:26832288-26832310 GCTACTCAGGAGCCTGAGGAAGG - Intergenic
928638121 2:33268811-33268833 GCTTGGGAAGAGCCAGAGGAAGG - Intronic
928832247 2:35500975-35500997 GCTGAGGAGGAGCAGGAGAAAGG + Intergenic
928969013 2:37007453-37007475 GCTTCTGAGGAGGCTGAGGCAGG - Intronic
929099491 2:38296685-38296707 GCTTCAGAGGAGTCCCAGGAAGG - Intronic
929503147 2:42507281-42507303 GCTACTTAGGAGCCTGAGGAGGG - Intronic
929561077 2:42956987-42957009 GCTACTCAGGAGCCGGAGGCAGG - Intergenic
929802980 2:45120250-45120272 GATTCAGAGGAGCCAAAGGAAGG + Intergenic
930110574 2:47675446-47675468 GCTTCTGAGAAGCAGGAGGGAGG - Intergenic
931516109 2:63051497-63051519 ACTTCGGAGGAGGCGGGGGAGGG - Intronic
932595078 2:73088509-73088531 GCTTGCAAGGAGCCAGAGGATGG + Exonic
932735880 2:74254323-74254345 GCTAAGGAGGAGCAGGAGGAAGG - Intronic
932857465 2:75251685-75251707 GGTTGGGAGGGGCTGGAGGATGG - Intergenic
933415533 2:81982585-81982607 GCTACTCAGGAGCCTGAGGAAGG - Intergenic
934636183 2:95991969-95991991 GCTGCGGAGGTGCCGCGGGAGGG + Intergenic
934797466 2:97113457-97113479 GCTGCGGAGGTGCCGCGGGAGGG - Intergenic
934835945 2:97589982-97590004 GCTGCGGAGGTGCCGCGGGAGGG + Intergenic
935265509 2:101390218-101390240 GCTTCTCAGGAGGCTGAGGATGG - Intergenic
935353871 2:102179990-102180012 GGTGGGGAGGAGCTGGAGGAGGG + Intergenic
935746597 2:106194416-106194438 GCGGGGGCGGAGCCGGAGGAAGG - Intergenic
936156350 2:110049794-110049816 GCTGGGGAGGTGCCTGAGGATGG - Intergenic
936188339 2:110321648-110321670 GCTGGGGAGGTGCCTGAGGATGG + Intergenic
936225181 2:110642801-110642823 GCTTCTCAGGAGCCTGAGGTGGG - Intronic
936267616 2:111022608-111022630 GCTTCTGGGGACCCCGAGGAAGG + Intronic
936321993 2:111474967-111474989 GCTGCGGTGGAGCAGGAGGCTGG - Intergenic
936964131 2:118110435-118110457 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
937104535 2:119297616-119297638 GCTACTGAGGAGGCTGAGGAGGG - Intergenic
937922720 2:127143228-127143250 CCTTTGGAGGAGCAGAAGGATGG - Intergenic
938895052 2:135741792-135741814 GCTTGTGCGGAGCCGGAGGTGGG + Exonic
941487248 2:166097689-166097711 GCTACTGAGGAGGCTGAGGAAGG - Intronic
941715027 2:168754885-168754907 GCTACTGAGGAGGCGGAGGCAGG - Intronic
941754555 2:169171005-169171027 GCTACGCAGGAGCCTGAGCAGGG - Intronic
944491665 2:200263775-200263797 GCATGGCAGGAGCAGGAGGAAGG - Intergenic
946147523 2:217742208-217742230 GCCTAGGAGGAGGGGGAGGATGG - Intronic
946248055 2:218398431-218398453 GCTACCCAGGAGCAGGAGGAGGG + Intronic
947819170 2:233058844-233058866 GCTGCGGAAGGGCCGGAGCATGG + Intergenic
1169274210 20:4221985-4222007 GCAGCGCAGGAGACGGAGGAAGG + Exonic
1170202954 20:13764764-13764786 GCTGAGGAGGAGCAGGAAGAGGG + Intronic
1170537718 20:17357780-17357802 GCTACTCAGGAGCCTGAGGAAGG + Intronic
1172528907 20:35617413-35617435 GCTTGGGAGGGGCCGGGGGTGGG - Intronic
1172758729 20:37307071-37307093 GCTACTGAGGAGGCAGAGGACGG - Intronic
1173358916 20:42321959-42321981 GCTTCTTAGGAGGCGGAGGCAGG + Intronic
1173867987 20:46324701-46324723 ACTTCCGAGGATCCGGAGGGTGG - Intergenic
1174063625 20:47849408-47849430 ACATGGGAGGAGCAGGAGGAGGG - Intergenic
1174411005 20:50335613-50335635 GCTACTGAGGAGCCTGAGGCAGG - Intergenic
1175130698 20:56787362-56787384 GCTACGCAGGAGCCTGAGGCAGG - Intergenic
1175200979 20:57277535-57277557 GCCTAGGAGGAGCAGGGGGAGGG + Intergenic
1175777695 20:61663514-61663536 GGGTCAGAGGGGCCGGAGGAAGG + Intronic
1177150969 21:17455154-17455176 GCTACTCAGGAGCCTGAGGAGGG + Intergenic
1177353036 21:19970448-19970470 GCTACTGAGGAGGCTGAGGAAGG - Intergenic
1178118439 21:29442267-29442289 GCTTCTCAGGAGGCGGAGGCAGG - Intronic
1178362537 21:31961100-31961122 GCTTAGGGAGAGCAGGAGGAAGG - Intronic
1178859278 21:36275505-36275527 GCTTCTGAGGAGGCTGAGGTGGG + Intronic
1179613869 21:42569392-42569414 CCTTCGGAGGAGCAGCAGGGAGG - Intronic
1180129906 21:45820682-45820704 GTTTCTGAGAAGCCAGAGGAGGG + Intronic
1180674933 22:17580706-17580728 CCTGCGGAGGAGCCAGAGGACGG + Intronic
1181309073 22:21933971-21933993 GCTTCGGAGGACCGGGGCGAGGG - Intronic
1181386889 22:22552886-22552908 GCTTCAGAGGGGCCAGAGGAGGG - Intronic
1182008194 22:26978975-26978997 GCCTCGGAGTAGATGGAGGATGG - Intergenic
1182137414 22:27919020-27919042 GCTTCGAAGGGGCCGGGGGAGGG + Intronic
1182207723 22:28645513-28645535 GCTTCTGAGGAGGCTGAGGCAGG + Intronic
1183909850 22:41070473-41070495 GCTTCTCAGGAGGCTGAGGAGGG - Intergenic
1184018110 22:41800903-41800925 CCTTCGGAGCTCCCGGAGGAGGG - Intronic
1184221479 22:43103254-43103276 GCTTCTCAGGAGGCTGAGGAAGG + Intergenic
1184673837 22:46029516-46029538 GCTACTGAGGAGGCTGAGGAGGG + Intergenic
1185101466 22:48843153-48843175 GCCTTTGAGGAGCCGGAGGAAGG + Intronic
1185169602 22:49285153-49285175 ATTTCGGAGGAGCCTGTGGAGGG - Intergenic
949533372 3:4978424-4978446 GCTCCGGAGGGGGCAGAGGAGGG + Intergenic
950306246 3:11917128-11917150 GCTGAGGGGGAGCCGGCGGAGGG + Intergenic
950576021 3:13832484-13832506 GAGTAGGAGGAGCCTGAGGAGGG - Intronic
950657817 3:14447913-14447935 TCTTCGGGGGAGTGGGAGGAGGG + Intronic
953978006 3:47396812-47396834 GCTACGCAGGAGTCTGAGGAGGG + Intronic
954552028 3:51489673-51489695 GCTTCGGGGGAGGCTGAGGCAGG + Intronic
954999410 3:54913192-54913214 GCTACACAGGAGCCTGAGGAGGG - Intronic
956938024 3:74125912-74125934 GCTACTCAGGAGCCTGAGGAAGG + Intergenic
957287076 3:78230761-78230783 GCTTCAGAGGAGAAGGAGGATGG + Intergenic
957932390 3:86897830-86897852 GCTTCTCAGGAGGCTGAGGAAGG + Intergenic
960814610 3:121659862-121659884 GCCTCAGAGGAGCCACAGGAAGG - Intronic
961550369 3:127667488-127667510 GCTGGGGAGGAGCCGGAGTGAGG + Intronic
961797702 3:129421606-129421628 GCTTTGGGGGAGCCTGAGGTTGG + Exonic
961847155 3:129775353-129775375 ACTTGGGAGGAGCCTGAGGTGGG + Intronic
962456000 3:135566327-135566349 GCTTTGGTGGAGATGGAGGAAGG + Intergenic
962741302 3:138364277-138364299 GCTTTGGAGAAGCAGGAGGAGGG + Intronic
964743744 3:159992234-159992256 GCTTCTGAGGAGGGGCAGGAAGG - Intronic
968164392 3:196452751-196452773 GCTCCTGGGGAGGCGGAGGAGGG + Intergenic
968382364 4:107671-107693 GCGGGGGAGGAGCAGGAGGAGGG - Intergenic
968603342 4:1520645-1520667 GCCTCGGAGGGGCTGGAGGAGGG - Intergenic
968603359 4:1520686-1520708 GCCTCGGAGGGGCTGGAGGGGGG - Intergenic
968603398 4:1520768-1520790 GCCTCGGAGGGGCTGGAGGGGGG - Intergenic
968603457 4:1520891-1520913 GCCTCGGAGGGGCTGGAGGGGGG - Intergenic
968603476 4:1520932-1520954 GCCTCGGAGGGGCTGGAGGGGGG - Intergenic
968603514 4:1521014-1521036 GCCTCGGAGGGGCTGGAGGGGGG - Intergenic
968603533 4:1521055-1521077 GCCTCGGAGGGGCTGGAGGGGGG - Intergenic
968603552 4:1521096-1521118 GCCTCGGAGGGGCTGGAGGGGGG - Intergenic
968603571 4:1521137-1521159 GCCTCGGAGGGGCTGGAGGGGGG - Intergenic
968603590 4:1521178-1521200 GCCTCGGAGGGGCTGGAGGGGGG - Intergenic
968641021 4:1714877-1714899 ACTTCAGAGGAGGAGGAGGAGGG - Intergenic
969672364 4:8596826-8596848 GCTTTGGAGGAGCAGGTGCAGGG + Intronic
975556803 4:75673298-75673320 GCTTCCGAGTTGTCGGAGGAAGG - Exonic
977631686 4:99249898-99249920 GCTACTCAGGAGCCTGAGGAGGG - Intergenic
979107362 4:116705362-116705384 GTTTCTGAGGAGCAGGGGGAGGG - Intergenic
979971675 4:127143245-127143267 GCTACTGAGGAGCCTGAGGCAGG + Intergenic
980246710 4:130254731-130254753 GCTACTGAGGAGCCTGAGGTGGG - Intergenic
981456924 4:144963167-144963189 GCTTCTTGGGAGCCTGAGGAGGG + Intergenic
981516875 4:145619349-145619371 GCGTGGGAGGATCCGGCGGAAGG + Exonic
982169090 4:152643933-152643955 GAGTGGGAGGAGCAGGAGGAAGG - Intronic
985429675 4:189867159-189867181 GCCTCAGAGGAGGCGTAGGAGGG + Intergenic
985606227 5:859525-859547 GCCTAGGAGGAACCGGGGGAGGG + Intronic
985868886 5:2538317-2538339 GCTGCAGAGGAGGCGGAGGCAGG - Intergenic
986280095 5:6315703-6315725 GCTCAGCAGGAGCAGGAGGAAGG - Intergenic
987700609 5:21393185-21393207 GCTACTGAGGAGCCTGAGGCAGG + Intergenic
992325851 5:75658945-75658967 GGTTCCCAGGAGCTGGAGGAGGG - Intronic
994710389 5:103258694-103258716 GCGGAGGAGGAGGCGGAGGAGGG + Exonic
996978444 5:129461296-129461318 CCTTTGGAGGAGCCCGTGGAGGG + Exonic
997168231 5:131685566-131685588 GCTACTGAGGAGCCTGAGGCAGG - Intronic
997709341 5:135990706-135990728 GCGTCAGAGGAGCCGGAGGTGGG + Intergenic
998215653 5:140237038-140237060 GCTGCTGAGGAGCCTGAGCAAGG - Intronic
998887106 5:146706156-146706178 GCTTTGGGGCAGCCGTAGGAGGG + Intronic
999253289 5:150195273-150195295 GCTCAGGAGGAGGTGGAGGAAGG - Intronic
1000432591 5:161167994-161168016 GCTACGCAGGAGGCTGAGGAGGG - Intergenic
1001366091 5:171141493-171141515 GCTTCTGGGGAGGCGGAGGGAGG + Intronic
1001988392 5:176095376-176095398 GATTTGGAGGAGCAGAAGGAAGG + Intronic
1002078429 5:176723494-176723516 GGCTGGGAGGAGCTGGAGGAGGG - Intergenic
1002228476 5:177742757-177742779 GATTTGGAGGAGCAGAAGGAAGG - Intronic
1002694190 5:181073122-181073144 GTGTCGGAGAAGCAGGAGGATGG + Intergenic
1003325292 6:5085961-5085983 GCTTCGGAGGCGCGAGAGCACGG - Exonic
1004505244 6:16241851-16241873 GCTTCTCGGGAGCCTGAGGAAGG - Intronic
1004838832 6:19559611-19559633 GCTACGCAGGAGGCTGAGGAGGG + Intergenic
1005418073 6:25622359-25622381 GCTACTGAGGAGGCTGAGGAAGG + Intergenic
1005504615 6:26458677-26458699 GCTGAGGAGGAGGAGGAGGAGGG - Exonic
1005586073 6:27277773-27277795 GCTACTGAGGAGCCTGAGGCAGG - Intergenic
1005827275 6:29641224-29641246 GCTACGGGGGAGGCTGAGGAAGG + Intergenic
1007647065 6:43391184-43391206 GCCTCTGAGGAACCGGGGGAGGG + Intergenic
1008092594 6:47308747-47308769 GCTTTGGAGGCGCCGGAGAGTGG + Intronic
1009832661 6:68958087-68958109 GCTACGCAGGAGGCTGAGGAAGG + Intronic
1012196872 6:96354052-96354074 GCTTCGGAGTAGCAGGATCAGGG + Intergenic
1012502437 6:99903997-99904019 GCTGGGTAGGAGCCAGAGGAAGG - Intergenic
1013619320 6:111873016-111873038 GCCTCGGCCGCGCCGGAGGAGGG - Exonic
1013781841 6:113737477-113737499 GCTTCGCAGGAGGCTGAGGCAGG - Intergenic
1014681173 6:124432494-124432516 GCTTCTCAGGAGGCTGAGGAGGG + Intronic
1014947675 6:127516312-127516334 GCATCCGAGGAGGCGGAGGTGGG - Exonic
1016737359 6:147493890-147493912 GACTCTGAGGAGCGGGAGGAGGG - Intergenic
1017441486 6:154468186-154468208 GCTTGGGAGGAGGCTGAGGCAGG - Intronic
1017871747 6:158492700-158492722 GCTCCTGAGGAGTGGGAGGATGG - Intronic
1018243733 6:161802530-161802552 GCACAGGAGGAGCCGGAGAAAGG - Intronic
1019343419 7:518892-518914 GCGCCGGAGGAGCCGGCGCAGGG + Intronic
1019409779 7:901438-901460 GCTGGGGAGAAGCCTGAGGAGGG - Intronic
1019718807 7:2555557-2555579 GGCCCGGAGGAGGCGGAGGACGG + Exonic
1020246759 7:6435372-6435394 GCTTCTGAGGAGGCTGAGGCAGG + Intronic
1022094407 7:27130083-27130105 GCTTGGGAGGCGCGGGAGGTGGG - Intronic
1022549446 7:31224906-31224928 GCTACTCAGGAGCCTGAGGAGGG - Intergenic
1022712267 7:32863245-32863267 GCATGGGAGGAGGAGGAGGAGGG - Intergenic
1022911610 7:34904115-34904137 GCATGGGAGGAGGAGGAGGAGGG + Intergenic
1023227787 7:37989757-37989779 GCTTAGGAGGACCAGGAAGATGG - Intronic
1023909804 7:44545623-44545645 GCTTCTCAGGAGACGGAGGTTGG - Intergenic
1024295364 7:47837442-47837464 GCTCAGGAGGTGCCAGAGGAAGG - Intronic
1024353974 7:48395606-48395628 GCTGAGGAGGAGGAGGAGGAAGG - Intronic
1025069866 7:55888492-55888514 GCTACTGAGGAGGCTGAGGAAGG - Intronic
1026736562 7:72952695-72952717 GCTACGCAGGAGGCTGAGGAAGG + Intergenic
1027107172 7:75412367-75412389 GCTACGCAGGAGGCTGAGGAAGG - Intergenic
1027567230 7:79810786-79810808 GCTACTAAGGAGCCTGAGGAAGG + Intergenic
1029232185 7:99079369-99079391 GCTGGGGAGGAGCTGCAGGAGGG - Intronic
1029252313 7:99245637-99245659 GCTTCTGAGGAGGCTGAGGCAGG - Intergenic
1030077345 7:105748005-105748027 GCTACTGAGGAGCCTGAGGCAGG + Intronic
1031470486 7:122162963-122162985 GCTTCTGAGGAGGCTGAGGGGGG + Intergenic
1032885392 7:136132934-136132956 GCTACGGAGGAGGCTGAGGCAGG - Intergenic
1035488802 7:159253848-159253870 GCTTCAGAGGAGCCTAAGGAAGG + Intergenic
1036049321 8:5178588-5178610 GCCTCGGATGAGCATGAGGAAGG + Intergenic
1037190459 8:16118565-16118587 GCTTCTCAGGAGGCTGAGGAGGG + Intronic
1037787442 8:21911293-21911315 GCTTTTGAGGAGCTGGTGGAGGG - Intronic
1037836724 8:22219081-22219103 GCTACTGAGGAGCCTGAGGCAGG - Intergenic
1039293244 8:36121592-36121614 GCCTCGGAGGAGGAGGACGAGGG + Intergenic
1041251344 8:55937805-55937827 GCTTCTCAGGAGCCTGAGGCAGG - Intronic
1044096989 8:88079063-88079085 GCTGCGTAGGAGCTGGAGGCAGG - Intronic
1044306375 8:90645652-90645674 GCTTCGGAGCTGCCGGAGCCGGG - Exonic
1044344368 8:91087835-91087857 GATTGGGAGGAGTCTGAGGAGGG - Intergenic
1044818658 8:96139784-96139806 GCTACTGAGGAGGCTGAGGAGGG + Intergenic
1045383301 8:101647873-101647895 GATTGGGAGGAGGGGGAGGAGGG + Intronic
1045428709 8:102093044-102093066 GCTTCTCAGGAGGCTGAGGAGGG + Intronic
1048993366 8:139774308-139774330 GCTCAGGAGAAACCGGAGGATGG + Intronic
1049150808 8:141034423-141034445 GCTTAGGTGGAGGCGGAGGCTGG + Intergenic
1049799886 8:144512846-144512868 GCTTTGGACATGCCGGAGGAGGG - Exonic
1050660534 9:7878801-7878823 GCTTCCTAGGAGCCAAAGGAAGG - Intronic
1055777433 9:79781631-79781653 GCTACTGAGGAGCCTGAGGAGGG - Intergenic
1058056838 9:100457301-100457323 GCTACTCAGGAGCCTGAGGAAGG + Intronic
1060105004 9:120868181-120868203 GCTTCGTAGGAGGCTGAGGTGGG - Intronic
1060407553 9:123380402-123380424 GCCTCGGGGAAGCAGGAGGAGGG - Exonic
1062327282 9:136018286-136018308 GCTGGGGAGCAGCCTGAGGAGGG + Intronic
1062452589 9:136621815-136621837 GCCTAGGAGGAGCAGGGGGAAGG - Intergenic
1062713361 9:137988795-137988817 CCTTTGGAGGAGGCTGAGGAGGG + Intronic
1185507070 X:639370-639392 GCTTCCGAGGAGGCCGAGAAGGG + Intronic
1186165379 X:6821511-6821533 GCTTTGGAGGAGAAGGATGAGGG - Intergenic
1186661296 X:11670050-11670072 GCTACTGAGGAGGCTGAGGAAGG - Intergenic
1187029661 X:15472644-15472666 GGTTCCTAGGAGCTGGAGGAAGG + Intronic
1187094002 X:16127442-16127464 GCATGGGAGGAGAGGGAGGATGG - Intronic
1189244860 X:39555526-39555548 GCTGCCGAGGAGCCGTAGGTAGG + Intergenic
1189311020 X:40017634-40017656 GCTACGCAGGAGCCTGAGGTGGG - Intergenic
1189788275 X:44579286-44579308 GCTACTCAGGAGCCTGAGGAAGG + Intergenic
1190417786 X:50198412-50198434 GCTGGGGAGGAGCCTGAGGGAGG - Intronic
1192279818 X:69672768-69672790 GCTTCTGAGGAGGCTGAGGCAGG + Intronic
1195534768 X:105998773-105998795 GGGTGGGAGGAGGCGGAGGATGG + Intergenic
1197149827 X:123207997-123208019 GCTTCTGAGCAGCAGGAGGAAGG - Intronic
1198370182 X:135982583-135982605 GCTACTGAGGAGGCTGAGGAAGG - Intergenic
1201179743 Y:11333086-11333108 GCCACGGAGGAGCCTGAGGGTGG - Intergenic
1201482563 Y:14455606-14455628 GCCTATGAGGAACCGGAGGAGGG + Intergenic
1201909671 Y:19121206-19121228 GCTTCTCAGGAGGCTGAGGAAGG + Intergenic