ID: 1142599654

View in Genome Browser
Species Human (GRCh38)
Location 17:1047402-1047424
Sequence GCCCTCAGAGCCACCGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142599654_1142599661 20 Left 1142599654 17:1047402-1047424 CCATCCACGGTGGCTCTGAGGGC 0: 1
1: 0
2: 1
3: 13
4: 256
Right 1142599661 17:1047445-1047467 TAAGCCACAGCCCGCCCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 140
1142599654_1142599660 19 Left 1142599654 17:1047402-1047424 CCATCCACGGTGGCTCTGAGGGC 0: 1
1: 0
2: 1
3: 13
4: 256
Right 1142599660 17:1047444-1047466 CTAAGCCACAGCCCGCCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 144
1142599654_1142599659 18 Left 1142599654 17:1047402-1047424 CCATCCACGGTGGCTCTGAGGGC 0: 1
1: 0
2: 1
3: 13
4: 256
Right 1142599659 17:1047443-1047465 TCTAAGCCACAGCCCGCCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142599654 Original CRISPR GCCCTCAGAGCCACCGTGGA TGG (reversed) Intronic
900101279 1:963127-963149 GGCCTCACAGTCTCCGTGGATGG - Exonic
900336753 1:2168034-2168056 GTCCTCAGTGCACCCGTGGAGGG - Intronic
900563132 1:3318020-3318042 GGCCTCGGAGCCGCCGTGGGTGG - Intronic
900822628 1:4900971-4900993 GGCCTCACAGTCACAGTGGAAGG + Intergenic
901232437 1:7648740-7648762 CCCCTCAGAACCACCTGGGAGGG + Intronic
901443515 1:9293250-9293272 GCCCCCGGAGCCACCGCGGGAGG - Intronic
902336446 1:15757610-15757632 AGCCCCAGAGCCACCCTGGAGGG + Intronic
903018737 1:20378992-20379014 GGCCTCACAATCACCGTGGAAGG + Intergenic
904675669 1:32197931-32197953 GCCCTCAGGGCCACCGTGATGGG - Exonic
904710013 1:32423273-32423295 GCCATCAGAGCCACCTGAGAAGG - Intergenic
904756278 1:32770477-32770499 GCCCTCAGAGCCACCCTTAGAGG - Exonic
904798350 1:33074410-33074432 GTCTTCAGAGCCACCCGGGAGGG - Intronic
904911203 1:33935797-33935819 GTTCTCAGAGCCAGCGTGGCAGG + Exonic
910936058 1:92485213-92485235 GCCCTAGGAGCCACCCCGGAGGG - Intronic
912498743 1:110107890-110107912 GCCCTCACAGCAACCCTGCAAGG + Intergenic
913137625 1:115908102-115908124 TGCCTCAGACCCACTGTGGAAGG + Intergenic
916755794 1:167769150-167769172 GCCCTCACAACCACCCTGCAAGG - Intronic
919449654 1:197755721-197755743 GGCCTCACAACCACGGTGGAAGG + Intronic
921708030 1:218346131-218346153 GCTCTCAGCGCCGCAGTGGAAGG + Intergenic
922507566 1:226135424-226135446 GCCCTCACAGCCTCCGTGCTAGG + Intergenic
922718643 1:227889308-227889330 GCCCCCAGAGCTACCTGGGAAGG - Intergenic
923655950 1:235917189-235917211 CCCACCAGAGCCTCCGTGGATGG - Intergenic
923764824 1:236883353-236883375 GCTCCCAGAGCCACAGTGGCAGG - Intronic
1063222370 10:3981506-3981528 GCCCCCAGAGAGACCCTGGAAGG + Intergenic
1064223593 10:13462279-13462301 GGCCTCACAATCACCGTGGAAGG + Intronic
1066780793 10:38942879-38942901 GCCCTCAGAGCCGCGGCGGTGGG - Intergenic
1067081940 10:43217042-43217064 GCACTGAGAGGCATCGTGGAGGG + Intronic
1068514639 10:58010520-58010542 GCCCTTAGAGGCTCAGTGGAGGG - Intergenic
1069882333 10:71601624-71601646 TCCCTCAGGGCCCCCTTGGAGGG + Intronic
1070977182 10:80614683-80614705 GCCCTCAGAACCACACTGCATGG - Intronic
1072682320 10:97516366-97516388 ACACACAGTGCCACCGTGGATGG + Intronic
1073040672 10:100602492-100602514 GCCTTGAGAGCCACAGTCGAAGG + Intergenic
1073422296 10:103434287-103434309 GCCCTGAGGGCCACCGTTGTTGG + Exonic
1075063010 10:119269882-119269904 TTTCTCAGAGCCACCTTGGAGGG + Intronic
1076821093 10:132939981-132940003 GCCCTCAGGGGCACTGTGGACGG - Intronic
1077578844 11:3404303-3404325 GTCCTCAGAGTCACCTTGAAAGG - Intergenic
1077589547 11:3480893-3480915 GCCCTCTTAGCCACTGTGGGGGG + Intergenic
1078581253 11:12541329-12541351 GCCCTCAGGGCCACCTGGGCAGG - Intergenic
1078612728 11:12835608-12835630 AACCTCAGAGCCACCGGGTACGG - Intronic
1079107322 11:17579806-17579828 GGCCACAGAGACACAGTGGAAGG + Intronic
1079573295 11:21971254-21971276 GCCCTCAATGCCATCCTGGAGGG - Intergenic
1081664687 11:44909921-44909943 CCCCTCAGAGCACCCATGGATGG - Intronic
1084245268 11:67852667-67852689 GCCCTCTTAGCCACTGTGGGGGG + Intergenic
1084510549 11:69600978-69601000 TCACTCAAAGCAACCGTGGATGG + Intergenic
1084827420 11:71741911-71741933 GCCCTCTTAGCCACAGTGGGGGG - Intergenic
1085520640 11:77137282-77137304 GGGCTCAGAGCCACCCAGGATGG - Intronic
1087700763 11:101433969-101433991 GCCCTCAGATCTTCAGTGGAAGG - Intergenic
1087926566 11:103925475-103925497 ACCCTCAGAGCAACTCTGGAAGG + Intronic
1089293027 11:117449919-117449941 CCCCTCAGAGCATCAGTGGAAGG + Intronic
1090084926 11:123642445-123642467 CCCCTAAGAGTCACCGAGGAGGG - Exonic
1091333959 11:134752887-134752909 GCTCTCAGAGCCCCCCAGGATGG - Intergenic
1091798425 12:3310167-3310189 ACAGTCAGGGCCACCGTGGATGG - Intergenic
1091799136 12:3313748-3313770 GCCCACAGGGCCACCATGGATGG - Intergenic
1091804731 12:3347737-3347759 GTCCTCACAGCCACCATGCAAGG - Intergenic
1092415838 12:8289799-8289821 GCCCTCTTAGCCACTGTGGGGGG + Intergenic
1092648094 12:10601594-10601616 ACCCTCATAGCAACCTTGGATGG - Intergenic
1092903901 12:13085003-13085025 TCCCTCAGAGACAGAGTGGATGG + Exonic
1094488325 12:30942273-30942295 GTCCTCACAGCCACCATGCAAGG + Intronic
1096179601 12:49543359-49543381 GCACTGAGAGCCACCTGGGATGG + Exonic
1096404038 12:51329819-51329841 GCCCCCAGAGTCACCCTGCAGGG + Exonic
1098416272 12:70238821-70238843 GCTCTCTGAGCCACCGTGCCTGG + Intergenic
1099566013 12:84247044-84247066 GGCCTCACAACCACGGTGGAAGG - Intergenic
1099570014 12:84305085-84305107 GCTCACAGAGCCAACGGGGATGG - Intergenic
1100105230 12:91162899-91162921 GGTCTCATAGGCACCGTGGATGG - Intronic
1101650274 12:106671378-106671400 ACCCCCAGAGCCACCCAGGAAGG - Intronic
1102207572 12:111100970-111100992 GCCCTCAGAGGGACAGGGGAGGG - Intronic
1103719481 12:122965785-122965807 GGCCTCACTGCCAGCGTGGATGG + Intronic
1103951647 12:124554693-124554715 GCCCTCAGTGGGAACGTGGAAGG - Intronic
1103968089 12:124652826-124652848 ACCCTCAGAGCTACCTAGGAGGG + Intergenic
1104413544 12:128579186-128579208 GGCCTCAGTGCCACAGTTGATGG + Intronic
1108283339 13:48881301-48881323 GCCCTCACAGCCACCTTAAATGG - Intergenic
1108460824 13:50665763-50665785 GGCCTCACAGTCATCGTGGAAGG - Intronic
1109756089 13:66762125-66762147 TCCCTCAGAACCACCATGGTTGG + Intronic
1110423044 13:75335109-75335131 GGTGTCAGAGCCACAGTGGAGGG - Intronic
1113430114 13:110242720-110242742 GCCAGCACAGCCACCCTGGAAGG + Exonic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1119399010 14:74349280-74349302 GCCTCCAGGGCCACCGGGGAGGG + Intronic
1119782130 14:77283399-77283421 GCCCTCAGAGCCAGGCTGGTAGG - Intronic
1120391189 14:83910444-83910466 GCCCTCACAGTCACGGTGGAAGG - Intergenic
1122121372 14:99555256-99555278 GCCCTCAGAGCCTCATGGGATGG + Intronic
1123017852 14:105384111-105384133 GCCCTGAGTGCCACTGAGGAAGG - Intronic
1125263009 15:37848914-37848936 CCCCTTGGAGCCACTGTGGAAGG - Intergenic
1126474372 15:49050838-49050860 GGCCTCACAACCACAGTGGAAGG + Intergenic
1127854192 15:62941371-62941393 GCCTGCAGAGCCACAGTGAAGGG - Intergenic
1128263475 15:66249438-66249460 CCCCACAGAGCCACCGGGCATGG + Intronic
1128619595 15:69137581-69137603 GCCCCCAGAGCAACCTGGGAGGG + Intergenic
1128868655 15:71135858-71135880 GCCCTCAGAGCCAACAGGGGAGG - Intronic
1129822649 15:78615420-78615442 GGCCCCAAAGCCACAGTGGATGG + Intronic
1129904825 15:79179103-79179125 TCTCTGAGAGCCACCGTTGACGG - Intergenic
1130579356 15:85121583-85121605 GCCCTCAGTGCCACAGTGCTTGG + Intronic
1132457831 16:33873-33895 GACCTCAGAGCTTCCGAGGAAGG + Intergenic
1132508112 16:322666-322688 TCCCACAGAGCCACTGAGGATGG + Intronic
1132549507 16:548525-548547 GCCCTCCTGGCCACGGTGGAGGG - Intronic
1132793994 16:1709513-1709535 GTTCTCAGGGCCGCCGTGGACGG + Intronic
1132886638 16:2185117-2185139 GCCTTCAGAGCCCGCGTGTAGGG + Exonic
1133378910 16:5313598-5313620 GGCCTCACAGTCACGGTGGAAGG + Intergenic
1134246836 16:12546364-12546386 GGCCTCACAATCACCGTGGAAGG + Intronic
1136699216 16:32116534-32116556 GCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1136768437 16:32811400-32811422 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1136799707 16:33059705-33059727 GCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1136902137 16:34050969-34050991 GCCCTCAGAGCCGCGGCGGCTGG - Intergenic
1136957624 16:34803727-34803749 GCGCTCAGAGCCACGGCGGCGGG - Intergenic
1137489425 16:48919172-48919194 GCCCTCAGAGCCAAGGTTAATGG - Intergenic
1139491970 16:67291069-67291091 GCCCACAGAGCCACAGGGGTAGG + Intronic
1141350511 16:83290517-83290539 GGCCTCACAATCACCGTGGAAGG - Intronic
1203070829 16_KI270728v1_random:1073416-1073438 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1142599654 17:1047402-1047424 GCCCTCAGAGCCACCGTGGATGG - Intronic
1142611565 17:1111394-1111416 GCCCTCGGTGCCCCCCTGGAGGG + Intronic
1142904313 17:3032336-3032358 GTGCACAGAGCCGCCGTGGAAGG + Intronic
1144083738 17:11787883-11787905 GGCCTCAGAACCACGGTGGGAGG - Intronic
1145870597 17:28270153-28270175 GCCATCAGAGCCACCTAAGAAGG - Intergenic
1146057683 17:29589401-29589423 GCCCTCTGGGCCAGCGTGGGGGG + Exonic
1146223726 17:31048561-31048583 GCCATCAGAGCCACCTGAGAAGG - Intergenic
1146811883 17:35910397-35910419 GCCATCAGAGCCACCTGAGAAGG - Intergenic
1147232651 17:39030444-39030466 GCCATCAGAGCCACCTGAGAAGG + Intergenic
1147326825 17:39673659-39673681 GCCCTCTGAGCAACCCTGGACGG - Intronic
1147922108 17:43924037-43924059 GCCATCAGAGCCACCTGAGAAGG - Intergenic
1148333399 17:46825387-46825409 GCCCTCAGAGCCCAGGCGGAAGG - Intronic
1150784362 17:68150846-68150868 GCCATCAGAGCCACCTGAGAAGG - Intergenic
1152092829 17:78256582-78256604 GCCCTGAGGGCCAGCGTGGCTGG + Intergenic
1152567349 17:81106269-81106291 GCTCTCAGGGCCACTGGGGATGG - Intronic
1152599184 17:81252982-81253004 GCCCTGAGAGCCACCCCGCAGGG + Intronic
1152755683 17:82086077-82086099 GTCCACACAGCCACCGTGGAGGG - Intronic
1153675462 18:7452625-7452647 GCCCACTGAGCCAACGCGGATGG - Intergenic
1153752608 18:8248686-8248708 GCCCTGAGTGGCACCGAGGATGG - Intronic
1154139506 18:11810782-11810804 GCACTTATAGCCAGCGTGGATGG - Intronic
1154408427 18:14118858-14118880 GCCCTCACAGCCACAGTCCATGG + Intronic
1154518342 18:15197903-15197925 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1155932972 18:31725701-31725723 GCCATCAGAGCCACCTGAGAAGG + Intergenic
1156447657 18:37249210-37249232 GCCCTTAGACCCACCCAGGATGG + Intronic
1159059077 18:63495538-63495560 GACCCCAGAGCCAGCCTGGAAGG + Intronic
1159750285 18:72292677-72292699 GGCCTCACAGTCACGGTGGAAGG - Intergenic
1160122191 18:76140580-76140602 GACCTCAGAGTCATGGTGGAAGG - Intergenic
1160451725 18:78971039-78971061 GACGTCAGAGCCACTGGGGATGG - Intergenic
1160824351 19:1072679-1072701 GCCTTCAGAGCTAGCGTAGATGG + Intronic
1161043517 19:2122396-2122418 GGCCTGAAAGCCACCGTGGATGG - Intronic
1161145941 19:2678131-2678153 CCACTCAGGGCCACAGTGGAAGG - Intronic
1162552678 19:11366239-11366261 GCCCTCAGAGCCACAATTGAGGG - Intergenic
1163005759 19:14395869-14395891 GCTCTCAGAGCTAGTGTGGATGG + Intronic
1163062072 19:14768163-14768185 GCTCTCAGAGCTAGTGTGGATGG - Intronic
1163258319 19:16171403-16171425 GACCTCAGACCCACCAAGGATGG - Intronic
1163966896 19:20754299-20754321 GCCCTCTTAGCCACTGTGGGGGG + Intronic
1164151788 19:22560203-22560225 GCCCTCAGACTCACTGGGGAGGG - Intergenic
1165385986 19:35510928-35510950 GCCCTCACACCCATCGTGCAGGG + Intronic
1166473415 19:43099808-43099830 AACCTCAGAGCCACTGGGGAAGG + Intronic
1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG + Exonic
1168115905 19:54221291-54221313 GACATCAGAGCCACACTGGAGGG + Exonic
1168118888 19:54241039-54241061 GACATCAGAGCCACACTGGAGGG + Exonic
1168133834 19:54337608-54337630 GACATCAGAGCCACACTGGAGGG + Exonic
1168185580 19:54697715-54697737 GACATCAGAGCCACACTGGAGGG - Intronic
1168187554 19:54709621-54709643 GACATCAGAGCCACACTGGAGGG - Intergenic
1168262459 19:55203871-55203893 GACACCAGAGTCACCGTGGATGG - Exonic
928719541 2:34103249-34103271 GTCCACAGAGCCACTGAGGAGGG - Intergenic
935597368 2:104889662-104889684 ACCCTGAGACCCACAGTGGAAGG + Intergenic
935671160 2:105558335-105558357 GCCCTCACAATCACGGTGGAAGG + Intergenic
935691556 2:105736503-105736525 GCACTCAGAGCCACACTGGATGG - Intergenic
940873867 2:158881897-158881919 GCCCTCTTAGCCACTGTGGGGGG - Intergenic
945754925 2:213834144-213834166 GGCCTCAGAGTCATGGTGGAAGG - Intronic
947594439 2:231402020-231402042 GCCCTCTTAGCCACTGTGGGGGG - Intergenic
948064758 2:235069283-235069305 GGCCTCACAGCCATGGTGGAAGG + Intergenic
948461663 2:238132660-238132682 GCACCCAGAGCCCCCGAGGACGG - Exonic
948628477 2:239285206-239285228 GAGCACAGAGCCACGGTGGAGGG + Intronic
948643817 2:239391519-239391541 GTCCTCAGAGCCAGCGGGGGAGG + Intronic
948655770 2:239475921-239475943 GCCTTCAGGTCCTCCGTGGAAGG - Intergenic
948657041 2:239483011-239483033 GCCTTCAGGTACACCGTGGAAGG + Intergenic
1171332947 20:24357409-24357431 GCCTTAAGAGCCACCGTCTATGG - Intergenic
1173402930 20:42740759-42740781 GCTCTAAGAGCCTCCGAGGAAGG + Intronic
1174049982 20:47760719-47760741 ACTCTCAGAGCCACCTGGGAAGG - Intronic
1179930952 21:44570421-44570443 GCCCTCACAGCCACCTTGTGGGG + Intronic
1180168255 21:46041252-46041274 GCCCTTAGAGCCAGCGTGTGTGG + Intergenic
1180193827 21:46182101-46182123 GGCCTCAGAGCCACCGGCCAGGG - Intronic
1180984798 22:19897995-19898017 GGCCTCAGAGCCACAGGGGCGGG + Intronic
1182691113 22:32164008-32164030 TGTCTCAGAGTCACCGTGGACGG - Intergenic
1183399586 22:37594427-37594449 CCCCACAGCGCCACCGTGAACGG - Intergenic
1183737700 22:39653038-39653060 GCCCTCTTAGCCACCGTGTGGGG - Intronic
1183737712 22:39653087-39653109 GCCCTCTTAGCCACCGTGTGGGG - Intronic
1184140354 22:42574710-42574732 GCCGTGAGAGCCGCAGTGGATGG - Intergenic
1184715236 22:46278225-46278247 GCCCTCAGAGCCTCAGGGGTGGG + Intronic
1184724869 22:46338053-46338075 GTCTTCAGCACCACCGTGGAGGG - Intronic
1184867213 22:47208361-47208383 GCACTCAGAGCCACCCTGCAAGG - Intergenic
1185050322 22:48550952-48550974 GCCCTCAGAGCAGCCCTGGTGGG - Intronic
1185279270 22:49962977-49962999 GCCCTCAGAGCGGCCGTCGCTGG + Exonic
950614000 3:14145012-14145034 GCCCTCACAACCACCGTGTGTGG - Intronic
953404944 3:42655361-42655383 TGCCTCAGAGCCTCCCTGGAAGG - Intronic
953546877 3:43870038-43870060 TCCCTCACAGCCACACTGGAAGG - Intergenic
956418215 3:69056025-69056047 GCCATCACAGCCACCCTAGAGGG - Exonic
956857974 3:73294549-73294571 GCTGTCAGAGTCACCATGGAGGG - Intergenic
961271715 3:125694571-125694593 GCCCTCTTAGCCACTGTGGGGGG - Intergenic
961547347 3:127644529-127644551 GGCCTCAGGACCACAGTGGAGGG + Intronic
961812122 3:129527946-129527968 AACCTCACAGCCACCCTGGACGG + Intergenic
962894848 3:139704888-139704910 GCCCTTAGAGCCACTTTGGGTGG + Intergenic
963847788 3:150177607-150177629 GCCCTCACAGCAACCCTGCAAGG + Intergenic
964296543 3:155240066-155240088 TCCCTCAGAGGCACCCTGGCTGG + Intergenic
967111807 3:186300178-186300200 GCAATCAGAGCCAGCGAGGATGG - Intronic
967182383 3:186917670-186917692 GGACTCAGAGCCACAGTGGGTGG - Intergenic
968385801 4:136282-136304 GCCCTCACAGCCACAGTCCATGG - Intronic
969488921 4:7487690-7487712 GACCTCAGAGCCGCCTTGGTGGG + Intronic
969610510 4:8225384-8225406 GCCTCCAGTGCCACAGTGGACGG - Intronic
969749381 4:9098731-9098753 GCCCTCTTAGCCACTGTGGGGGG - Intergenic
971629619 4:28974021-28974043 GCCTTCACAGTCACGGTGGAAGG + Intergenic
977977885 4:103287718-103287740 GGCCTCACAGTCACAGTGGAAGG - Intergenic
979065504 4:116127075-116127097 GGCCTCAGAGTCATGGTGGAAGG - Intergenic
981422055 4:144562452-144562474 GCCCTCAGTGCCTACGAGGAAGG + Intergenic
981604448 4:146527170-146527192 GCCCTCTTAGCCACTGTGGGGGG - Intergenic
982966238 4:161912542-161912564 GGCCTCAGAATCACGGTGGAAGG - Intronic
985607477 5:865851-865873 GCACGCACAGACACCGTGGAGGG + Intronic
985907234 5:2849329-2849351 AGTCTCAGAGCCACAGTGGAAGG + Intergenic
987662584 5:20895526-20895548 GGCCTCACAGTCACGGTGGAAGG - Intergenic
990362389 5:55033757-55033779 GCCCCCTGAGTCACCCTGGAAGG - Exonic
990947905 5:61268645-61268667 CCCCTCAGTGCCAACCTGGAAGG + Intergenic
1001181508 5:169525238-169525260 GGCCTCAGAATCACCGTGGGAGG + Intergenic
1002075880 5:176708158-176708180 GCAATCACAGCCACTGTGGATGG + Intergenic
1002641758 5:180633745-180633767 GTCCTCAGAGCTACAGAGGAGGG + Intronic
1006730059 6:36230091-36230113 GCCAGCTGAGCCACCCTGGAGGG - Intronic
1006960612 6:37926339-37926361 TCCCTCAGAGCCACCTTGGAGGG - Intronic
1007082071 6:39114828-39114850 GGCCTCGGAGCCACAGTCGAGGG - Intronic
1007616257 6:43181296-43181318 TACCCCAGAGCCACCGAGGAAGG - Exonic
1007958748 6:45940052-45940074 GCCCACAGTGCCAGCTTGGAGGG - Intronic
1010833268 6:80556398-80556420 GCCCTCATGGTCACTGTGGATGG + Intergenic
1012062860 6:94511042-94511064 GACCTCGGACCCACGGTGGAGGG - Intergenic
1013475715 6:110505652-110505674 GCCCTAACACCCACCCTGGAAGG + Intergenic
1015969788 6:138732107-138732129 GGCCTCAGAGTCACGGCGGAAGG + Intergenic
1016084973 6:139902326-139902348 GGCCTCACAGTCACGGTGGAAGG - Intergenic
1016922857 6:149313435-149313457 GCCCACAAAGCAACCCTGGACGG - Intronic
1018224308 6:161613193-161613215 GCCCTCAGAGTCATCCAGGAGGG - Intronic
1019341129 7:509544-509566 GCAGTCCCAGCCACCGTGGAAGG - Intronic
1019886863 7:3912940-3912962 GGGCTCAAAGCAACCGTGGAGGG + Intronic
1020007150 7:4789068-4789090 ACCCTCACAGGGACCGTGGATGG - Intronic
1022654464 7:32306135-32306157 GGCCTCACAACCACGGTGGAAGG - Intergenic
1025306719 7:57868139-57868161 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1025478641 7:60956873-60956895 GCCCTCAGACCCACGGCGGTGGG - Intergenic
1025481841 7:60992520-60992542 GCCCTCAGAGCCTCTGCGGCGGG - Intergenic
1025561962 7:62380612-62380634 GCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1025878381 7:65509137-65509159 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1025882728 7:65554951-65554973 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1025890715 7:65647652-65647674 GCCCTCAGAGCCGCGGCGGCGGG - Exonic
1026278564 7:68901943-68901965 GGCCTCAGAATCACCGTGGGAGG - Intergenic
1029260184 7:99296909-99296931 GCCCTCAGACTCACCCTGCAGGG - Intergenic
1029349136 7:100000635-100000657 GATCTCAGACCCACCATGGATGG - Intergenic
1032510607 7:132469304-132469326 GCCCTCACAGCAACCCTGCAAGG - Intronic
1035333984 7:158113972-158113994 CCCCTCAGAGCCACCTGGGGAGG + Intronic
1035769806 8:2138159-2138181 GCCCTCAGACACACCACGGATGG + Intronic
1036372452 8:8173074-8173096 GCCCTCTTAGCCACTGTGGGGGG - Intergenic
1036493663 8:9250489-9250511 GCCCTCTTAGCCACTGTGGGGGG - Intergenic
1036660035 8:10701974-10701996 ACCCTCACAGCCAGCGTGGATGG + Intronic
1036817174 8:11910791-11910813 GCCCTCTCAGCCACTGTGGGGGG + Intergenic
1036820473 8:11935682-11935704 GCCCTCTTAGCCACTGTGGGGGG + Intergenic
1036878451 8:12492567-12492589 GCCCTCTTAGCCACTGTGGGGGG + Intergenic
1036906537 8:12712375-12712397 GCCCTCTTAGCCACTGTGGGAGG + Intergenic
1037005640 8:13776171-13776193 GCCCTAACAGCCACGCTGGAAGG - Intergenic
1038612514 8:29069294-29069316 GCCCCCAGGCCCACCGTGCATGG - Exonic
1038890948 8:31722437-31722459 GGACTCTGTGCCACCGTGGAAGG - Intronic
1039925294 8:41925661-41925683 GCCCTCCAAGCCACAGTGGAGGG + Intergenic
1046622753 8:116545498-116545520 GCCCAAAGATCCACCTTGGATGG + Intergenic
1046866093 8:119152038-119152060 GGCCTCACAGTCACGGTGGAAGG - Intergenic
1048967747 8:139626521-139626543 GCCCTCGGAGGGACTGTGGATGG + Intronic
1048969189 8:139634835-139634857 GCCCTGAGAGCCTCCGTGAGGGG + Intronic
1049360712 8:142211428-142211450 GCCCTCTGTGCCACGGTGGGCGG + Intergenic
1049478555 8:142808126-142808148 GCTGCCAGTGCCACCGTGGATGG + Intergenic
1049599312 8:143499728-143499750 GTCCCCAGGGCCTCCGTGGAGGG - Intronic
1049734895 8:144199658-144199680 GCCCTCATAGCCATCCTGGAGGG + Intronic
1050490881 9:6186651-6186673 GGCCTCACAACCACGGTGGAAGG + Intergenic
1053434127 9:38064267-38064289 GTACTCAGAGCCATGGTGGAGGG - Intronic
1054747633 9:68870859-68870881 GTCCTCAGAGCCACTATTGATGG + Intronic
1055462358 9:76530730-76530752 GCCCACAGAGGCAACGTGGTTGG - Intergenic
1062224730 9:135443301-135443323 GCCCTCTTAGCCACTGTGGGGGG + Intergenic
1062617115 9:137402833-137402855 GGCCTCAGAATCACGGTGGAAGG + Intronic
1203744715 Un_GL000218v1:35419-35441 GCCCACACGGCCACCCTGGAGGG - Intergenic
1189403362 X:40693485-40693507 GGCCTCAGAATCACAGTGGAAGG - Intronic
1194731694 X:97463108-97463130 GACCACAGAGCCACCTTGAAAGG - Intronic
1200947811 Y:8864049-8864071 GCCCTCTTAGCCACTGTGGGGGG - Intergenic