ID: 1142603268

View in Genome Browser
Species Human (GRCh38)
Location 17:1067661-1067683
Sequence TGACCACTCTTGATAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142603268_1142603272 -7 Left 1142603268 17:1067661-1067683 CCACCTCTTATCAAGAGTGGTCA 0: 1
1: 0
2: 0
3: 9
4: 72
Right 1142603272 17:1067677-1067699 GTGGTCACATGGGTCAACACTGG 0: 1
1: 0
2: 0
3: 9
4: 96
1142603268_1142603273 -6 Left 1142603268 17:1067661-1067683 CCACCTCTTATCAAGAGTGGTCA 0: 1
1: 0
2: 0
3: 9
4: 72
Right 1142603273 17:1067678-1067700 TGGTCACATGGGTCAACACTGGG 0: 1
1: 0
2: 0
3: 5
4: 82
1142603268_1142603274 -3 Left 1142603268 17:1067661-1067683 CCACCTCTTATCAAGAGTGGTCA 0: 1
1: 0
2: 0
3: 9
4: 72
Right 1142603274 17:1067681-1067703 TCACATGGGTCAACACTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 84
1142603268_1142603275 0 Left 1142603268 17:1067661-1067683 CCACCTCTTATCAAGAGTGGTCA 0: 1
1: 0
2: 0
3: 9
4: 72
Right 1142603275 17:1067684-1067706 CATGGGTCAACACTGGGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142603268 Original CRISPR TGACCACTCTTGATAAGAGG TGG (reversed) Intronic
900751973 1:4403856-4403878 TGACTATTCTTGATAAAAGGAGG - Intergenic
903916263 1:26766704-26766726 GGACCTTTCATGATAAGAGGAGG - Intronic
906434425 1:45782911-45782933 TGACCACTGTTGATTAGACTGGG + Intergenic
910359703 1:86403442-86403464 TGACCAGTCCTGATAAGAGCAGG + Intergenic
910438265 1:87227443-87227465 TGAACACTTGAGATAAGAGGAGG + Intergenic
912300369 1:108509920-108509942 TGACCAATCCTGATAAGAGCAGG - Intergenic
914443395 1:147726807-147726829 TGAACACTCATTATCAGAGGTGG + Intergenic
918440117 1:184558602-184558624 TGGCCACTCCTGATGAGAGAGGG + Intronic
919944960 1:202312230-202312252 TAACCACTCTTCAAACGAGGAGG - Intronic
920957668 1:210633900-210633922 TGACCACTCTTGCCCAGAGAAGG + Intronic
923630711 1:235648331-235648353 TGACCGGTCATGATAAGAGATGG - Intronic
924553435 1:245099073-245099095 TGGCCAGTCATAATAAGAGGAGG + Intronic
1071588786 10:86851424-86851446 TGACTAAGCTTTATAAGAGGAGG + Intronic
1073547593 10:104364781-104364803 TTACCACTTCTGATAAGAGCTGG - Exonic
1076989343 11:262475-262497 AGAGCACTCTTTATAAGAGGAGG + Intergenic
1078717309 11:13852421-13852443 TGACCACTTTAGATTGGAGGAGG - Intergenic
1079583720 11:22098530-22098552 TGTCCACTCTTGATAACAAAGGG + Intergenic
1083384597 11:62298252-62298274 TAACCACCAGTGATAAGAGGAGG + Intronic
1085236700 11:75020882-75020904 TGAGCAGTCTTGACAAGATGTGG - Intergenic
1086430137 11:86729091-86729113 AGACCAGTGTTCATAAGAGGTGG - Intergenic
1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG + Intronic
1090657528 11:128857309-128857331 CAGCCACTCTTGATAAGAGATGG - Intronic
1097228050 12:57490522-57490544 TCTCCACTCTTTATAGGAGGAGG + Exonic
1106101539 13:26697823-26697845 TGACCACTCTGGAGGAGATGCGG + Intergenic
1108199551 13:48029231-48029253 TGACCACTTTTGATATTAAGTGG + Intergenic
1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG + Intronic
1117404521 14:55388897-55388919 TAACCAGTCATGATGAGAGGAGG + Intronic
1118364215 14:65080478-65080500 TGATTAGTATTGATAAGAGGTGG + Intronic
1126699290 15:51353443-51353465 TGACCACTGATGATAAGATTTGG + Intronic
1126811269 15:52407460-52407482 TGTCCACTCTGAATCAGAGGTGG + Intronic
1134887956 16:17811109-17811131 TGACCATTTTTGGTCAGAGGTGG - Intergenic
1135586853 16:23678412-23678434 TGAGCAGTCTTGTTGAGAGGCGG + Intronic
1136550184 16:30978963-30978985 TGAACTCCCTTGATGAGAGGGGG - Intronic
1138902920 16:61296418-61296440 TGGCCACTCCTTGTAAGAGGAGG + Intergenic
1139117285 16:63971837-63971859 TGACCATTCTTGAGAAGTTGTGG - Intergenic
1139648081 16:68346577-68346599 TGACAACACATGAAAAGAGGGGG - Intronic
1139972035 16:70782257-70782279 ATTCCACTCTTGATGAGAGGAGG - Intronic
1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG + Intronic
1142603268 17:1067661-1067683 TGACCACTCTTGATAAGAGGTGG - Intronic
1167054360 19:47099905-47099927 TGAGAGCCCTTGATAAGAGGCGG + Intronic
929331088 2:40681871-40681893 TGACCACTGATGATAAGCAGGGG + Intergenic
943089387 2:183356187-183356209 TGACCACTCTCTAGAGGAGGTGG - Intergenic
943668196 2:190632562-190632584 TGATCAATCTTGAAAAGAGCAGG + Intergenic
948428718 2:237904822-237904844 GGATCACTCTGGGTAAGAGGTGG + Intronic
1171008306 20:21490346-21490368 TCACAACTCTTGATAAAAAGAGG - Intergenic
1175369667 20:58479747-58479769 TAACCTCTCTTGATTAGAGGAGG + Intronic
1182797574 22:33002235-33002257 TGACCAATCTGGTTAAGAAGAGG + Intronic
952687168 3:36163225-36163247 TGATCACTTTTAACAAGAGGAGG - Intergenic
956470551 3:69562236-69562258 AGACCACAGTAGATAAGAGGAGG + Intergenic
962823846 3:139080935-139080957 TGACCAATCCTGATAAGAGCAGG + Intronic
969728857 4:8941355-8941377 TGACCATTCGCCATAAGAGGTGG - Intergenic
971453571 4:26822622-26822644 CGACCCCTCTTGATAACAGCAGG + Intergenic
975707023 4:77121644-77121666 TGGCCACTCCTCATGAGAGGGGG + Intergenic
975964780 4:79958777-79958799 TTACTACTCTTCAGAAGAGGTGG - Intronic
977050367 4:92121562-92121584 TGACAACTTTTGAGAAGAGGTGG + Intergenic
978403171 4:108351953-108351975 CGACCACTCTTGATAGTGGGAGG + Intergenic
985657140 5:1138021-1138043 TGACCACTTCTGAGAAGAGGAGG - Intergenic
991394046 5:66184853-66184875 TAACCACAATTGATGAGAGGTGG + Intergenic
993311162 5:86333875-86333897 TGAAAACTCTTGATAAGTGTTGG - Intergenic
995189971 5:109309783-109309805 TCACTACTCTTGGTCAGAGGGGG + Intergenic
1000684997 5:164237778-164237800 TGACCACTACTGATAAGAAATGG - Intergenic
1002357869 5:178645405-178645427 TCACCACCCTTGATACGAAGTGG + Intergenic
1002921035 6:1573594-1573616 TGACCACCCTGAATAAGAGAAGG - Intergenic
1004479473 6:16005043-16005065 AGACCACTCAGGAAAAGAGGAGG - Intergenic
1007737660 6:43991641-43991663 TGAGCTCTCTGGGTAAGAGGTGG - Intergenic
1020360288 7:7320395-7320417 TGAGCACTCTGGATAAAAGTAGG - Intergenic
1027761539 7:82285166-82285188 TGACCACCATCGAGAAGAGGAGG - Intronic
1032585326 7:133141193-133141215 TGCCCACTGTTGATAAGATCAGG + Intergenic
1033533222 7:142287129-142287151 GGACCATTCTTGAAAAGACGTGG + Intergenic
1039615550 8:38952268-38952290 TAACCACTCTTAATGAGGGGAGG - Exonic
1042768540 8:72353659-72353681 TGACCCCTCTTGACCAGAGAGGG + Intergenic
1050304861 9:4297784-4297806 AGACCACTCCTGCCAAGAGGAGG + Intronic
1050459088 9:5861897-5861919 TGACCACTTTTGGTAACAGGAGG - Intergenic
1051501135 9:17779091-17779113 TGGCCAGACCTGATAAGAGGTGG + Intronic
1052361799 9:27569905-27569927 TGAACTCTCTTGACAAGATGTGG - Intronic
1058860117 9:109108067-109108089 TGTTTACTCTGGATAAGAGGAGG - Intronic
1062318832 9:135980712-135980734 TCACCACTCCTGCTAAGAGATGG + Intergenic
1196665006 X:118306347-118306369 TTACAACTCATGATAAGATGTGG + Intergenic
1199115377 X:143985923-143985945 TTATCATGCTTGATAAGAGGGGG - Intergenic
1199404678 X:147443280-147443302 TAATCACTCTTGAGAAAAGGAGG + Intergenic
1200829966 Y:7680021-7680043 TGCCCACCCTTGGTAAGAGCAGG + Intergenic
1202089581 Y:21175844-21175866 TGACCACTCTAGATAGGATAGGG + Intergenic