ID: 1142605453

View in Genome Browser
Species Human (GRCh38)
Location 17:1078733-1078755
Sequence GAGTGGGCTTAGATGTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142605453_1142605472 30 Left 1142605453 17:1078733-1078755 CCCGGCCACATCTAAGCCCACTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142605472 17:1078786-1078808 CACCTCCCACAGCGAGCACCTGG 0: 1
1: 0
2: 2
3: 29
4: 250
1142605453_1142605459 -6 Left 1142605453 17:1078733-1078755 CCCGGCCACATCTAAGCCCACTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142605459 17:1078750-1078772 CCACTCCAGCCGGCCCCCAGAGG 0: 1
1: 0
2: 0
3: 27
4: 315
1142605453_1142605461 -2 Left 1142605453 17:1078733-1078755 CCCGGCCACATCTAAGCCCACTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142605461 17:1078754-1078776 TCCAGCCGGCCCCCAGAGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 156
1142605453_1142605460 -3 Left 1142605453 17:1078733-1078755 CCCGGCCACATCTAAGCCCACTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142605460 17:1078753-1078775 CTCCAGCCGGCCCCCAGAGGTGG 0: 1
1: 0
2: 2
3: 31
4: 353
1142605453_1142605463 1 Left 1142605453 17:1078733-1078755 CCCGGCCACATCTAAGCCCACTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142605463 17:1078757-1078779 AGCCGGCCCCCAGAGGTGGGAGG 0: 1
1: 0
2: 2
3: 16
4: 194
1142605453_1142605464 2 Left 1142605453 17:1078733-1078755 CCCGGCCACATCTAAGCCCACTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142605464 17:1078758-1078780 GCCGGCCCCCAGAGGTGGGAGGG 0: 1
1: 0
2: 1
3: 23
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142605453 Original CRISPR GAGTGGGCTTAGATGTGGCC GGG (reversed) Intronic
900400969 1:2472739-2472761 GAGGGGGCTTAGAGGCAGCCAGG + Intronic
900768535 1:4521573-4521595 GAGTGAGCTTAGCTATGACCTGG + Intergenic
901321513 1:8343115-8343137 GAGTGGGCATTGCTGTGACCTGG - Intronic
902051469 1:13566972-13566994 GAGTGGGATTAGGGGTGGCGTGG - Intergenic
902823565 1:18957343-18957365 CAGCGGGCTTAGCTGTGCCCGGG - Intergenic
903383924 1:22914738-22914760 CAGTGGGCTTTGGTGAGGCCTGG - Intronic
904044272 1:27600831-27600853 GCATGGGCTTAGATCTGGGCTGG - Intronic
907497197 1:54853102-54853124 GTGTGGGCTTAGCTGGGTCCAGG - Intronic
908378643 1:63573223-63573245 GAGTGGGATTAGGGGTGGCGTGG + Intronic
910637515 1:89425484-89425506 GAGTGGCCTGAGCTGTGTCCTGG - Intergenic
911510185 1:98801618-98801640 GAGTGGGATTAGGGGTGGCGTGG + Intergenic
912749079 1:112270479-112270501 GAGTGGGCTGAAATGGGGCAGGG + Intergenic
916426795 1:164688591-164688613 GAGTGGGGTTAGGTATGGCATGG - Intronic
917247482 1:173020325-173020347 GAATGGGCTTAGATGTAGACAGG - Intergenic
919762766 1:201108614-201108636 GAGTGGGATTAAATGTTGGCAGG - Intronic
921045170 1:211471372-211471394 AACTGGCCTGAGATGTGGCCTGG + Intergenic
921106570 1:211986777-211986799 TAGTGTGCTTACATGTGGCTTGG - Intronic
922325101 1:224521069-224521091 GAATAGGCTTGGAGGTGGCCAGG + Intronic
1063624492 10:7676396-7676418 GATTAGGCTTAGATGAGGTCAGG + Intergenic
1073470792 10:103720927-103720949 AAGTGAGCTCAGCTGTGGCCAGG - Intronic
1073684032 10:105733277-105733299 GAGTGGGATTAGGGGTGGCGTGG - Intergenic
1075140234 10:119827159-119827181 GAGTGGGCTTGGAAAAGGCCAGG + Exonic
1075398723 10:122146181-122146203 GAGTGGGTTTATGTGTGGGCTGG + Intronic
1076215851 10:128692981-128693003 GAGTGGGCTTTGAAGGAGCCAGG - Intergenic
1078625645 11:12955031-12955053 GATTAGACTTAAATGTGGCCAGG + Intergenic
1079369124 11:19835243-19835265 TAGTGGCCTCAGGTGTGGCCTGG - Intronic
1079569129 11:21921204-21921226 GAGAGGGCTCAGCTTTGGCCAGG + Intergenic
1080233607 11:30045061-30045083 GAGTGAGCTGAGCTGTGTCCTGG - Intergenic
1081894784 11:46576005-46576027 GACTGGGCTTAGATTGGGACCGG - Intronic
1082633077 11:55563313-55563335 GAGTGGGATTAGTGGTGGCATGG - Intergenic
1083844660 11:65324117-65324139 GAGTGGCCTAAGGTGGGGCCCGG + Intergenic
1084149295 11:67280786-67280808 GAGTGGGCTTGGGTGGGGCATGG + Intronic
1088555390 11:111055556-111055578 GAGTGGGATTAGGGGTGGCGTGG - Intergenic
1089619070 11:119712259-119712281 GAGTGGGCTGGGACGTGACCAGG - Intronic
1090351275 11:126110082-126110104 GACAGGGCTTGGATGTGGGCAGG + Intergenic
1090387353 11:126364766-126364788 GAGTGGGCTGAGAGGGGGCCCGG - Intronic
1090389917 11:126381964-126381986 GAGTGGGCTGGGAGGGGGCCCGG - Intronic
1091267736 11:134283659-134283681 GAGTGGGCTCAGAGCTGCCCCGG - Intronic
1091710689 12:2738070-2738092 GAGTGGGCTTTGGTGAGGCACGG - Intergenic
1092580317 12:9834468-9834490 GAGCGGGATTAGGTGTGGCGTGG + Intronic
1094109824 12:26849825-26849847 CAGTGGGCTTTGATGGGACCAGG + Intergenic
1096259128 12:50080111-50080133 GAGTGGGGTTTGATGGGGGCGGG + Intronic
1097360207 12:58651707-58651729 GAGTGTGCTTATATGTGTCAGGG - Intronic
1098920399 12:76297230-76297252 GAGTGGGATTAGGTGCGGCGTGG - Intergenic
1100861892 12:98815294-98815316 GAGTGGGCTCAGATGAGGACAGG - Intronic
1100863022 12:98827453-98827475 GAATGGGCTTTTATCTGGCCAGG - Intronic
1104604919 12:130180781-130180803 GACTGGGGTGAGATGAGGCCAGG - Intergenic
1104972436 12:132538074-132538096 GAGTGAGCTTGGGTGTGGCTGGG + Intronic
1106248508 13:27967536-27967558 GAGTGTGCCTAGAGGTGGCAAGG - Intronic
1107772890 13:43807352-43807374 TAGGGGGCTTAGATGTGAGCTGG - Intergenic
1108255859 13:48610860-48610882 GAGTGAACATAGATGTAGCCAGG - Intergenic
1112559965 13:100504032-100504054 GAGTGGGATTAGATGTGAGAGGG + Intronic
1121243900 14:92449235-92449257 GAGTGGGCAGAAATGTGTCCTGG + Intronic
1121244107 14:92450224-92450246 GAGTGGTCTCAGATGTGTCTGGG + Intronic
1122508142 14:102245259-102245281 GAGTGGGATTAGGGGTGGCGTGG - Intronic
1125549756 15:40536592-40536614 GAGGGGGCTGTGATCTGGCCAGG + Intronic
1127325145 15:57887675-57887697 GACCAGGCTTAGGTGTGGCCAGG + Intergenic
1127913908 15:63439939-63439961 CAGTGTCCTCAGATGTGGCCAGG - Intergenic
1128127036 15:65200759-65200781 AATTGGTCTGAGATGTGGCCTGG - Intronic
1129757389 15:78106604-78106626 GAGTTCACTTTGATGTGGCCAGG - Intronic
1132708873 16:1257853-1257875 GATGGGGCTTAAATGAGGCCAGG + Intronic
1132929360 16:2451058-2451080 GAAGGGGCTTAGATGTGGCGAGG - Intronic
1133651790 16:7819849-7819871 GAGTGGGATTAGGGGTGGCGTGG - Intergenic
1134341520 16:13351187-13351209 GACTGGGCTTTGATGTGACAGGG - Intergenic
1136609020 16:31355157-31355179 AAGTGGGCAGAGAGGTGGCCAGG - Intronic
1136712402 16:32250319-32250341 GAGTGTGCTTTAATGTGGTCAGG - Intergenic
1136755513 16:32679110-32679132 GAGTGTGCTTTAATGTGGTCAGG + Intergenic
1136812600 16:33191260-33191282 GAGTGTGCTTTAATGTGGTCAGG - Intergenic
1136819076 16:33301340-33301362 GAGTGTGCTTTAATGTGGTCAGG - Intronic
1136825639 16:33357875-33357897 GAGTGTGCTTTAATGTGGTCAGG - Intergenic
1136830705 16:33456646-33456668 GAGTGTGCTTTAATGTGGTCAGG - Intergenic
1137320911 16:47380634-47380656 GAGTGGGGTGAGTTGTGGCTTGG + Intronic
1137365184 16:47853850-47853872 GCGTGGGCTTAGATGGGGCCAGG - Intergenic
1140895559 16:79321523-79321545 GAGACGGCTTAGCTGAGGCCAGG + Intergenic
1141862804 16:86729497-86729519 GGGTGGGCTCAGCAGTGGCCGGG - Intergenic
1202991177 16_KI270728v1_random:14230-14252 GAGTGTGCTTTAATGTGGTCAGG - Intergenic
1203057655 16_KI270728v1_random:939449-939471 GAGTGTGCTTTAATGTGGTCAGG + Intergenic
1142605453 17:1078733-1078755 GAGTGGGCTTAGATGTGGCCGGG - Intronic
1142683029 17:1561708-1561730 GAGGGGGCTGAGATGCGGGCCGG - Intronic
1143518097 17:7430000-7430022 GTGTGAGCTTGGATGTGGGCTGG - Intergenic
1143518134 17:7430138-7430160 GAGTGGGCTGAGGTGTGTTCAGG - Intergenic
1143771030 17:9168939-9168961 GAGTGGGCTTCATTATGGCCAGG + Intronic
1143823866 17:9588347-9588369 GAGCGGGCTGAGCTGTGTCCTGG - Intronic
1146184773 17:30717591-30717613 GAATGTGCTGAGATGTGGCTGGG - Intergenic
1147381285 17:40057721-40057743 GAGTGGGGTAAGAGGTGGCAAGG + Intronic
1149972818 17:61236171-61236193 GAGTGGGGACAGATGTTGCCAGG - Intronic
1151206922 17:72514706-72514728 GGGTAGGCTTAAATGTGGCAAGG + Intergenic
1151849749 17:76683349-76683371 GTGGGGGATCAGATGTGGCCCGG + Intronic
1155222701 18:23699641-23699663 GGGCAGGCCTAGATGTGGCCTGG + Intronic
1157307357 18:46526787-46526809 GAGTGAGCTGAGATGAGGCAGGG + Intronic
1159036589 18:63284182-63284204 AATTGGTCTGAGATGTGGCCTGG + Intronic
1161827285 19:6576744-6576766 GAGTGGGATTAGGGGTGGCGTGG - Intergenic
1161846232 19:6713346-6713368 GAGCGGGCTCAGAGGTGGCGGGG + Intronic
1162974006 19:14198104-14198126 GAATGTGCTGAGATGTGGCTGGG + Intronic
1164570672 19:29372246-29372268 GATGGGGCTTCCATGTGGCCTGG + Intergenic
1164616513 19:29669793-29669815 GAGAGGACATAGATGTGACCAGG - Intronic
1166531675 19:43546700-43546722 GAGTGGGCTTGGTTTTGGTCTGG + Exonic
1166693984 19:44841923-44841945 GAGTGGGCTTAGCTCTCTCCTGG - Intergenic
927032557 2:19137597-19137619 GGGAGGGCTGAGCTGTGGCCTGG - Intergenic
927191338 2:20519197-20519219 GAATGGTCTCAGATGTGGGCAGG + Intergenic
929004417 2:37381540-37381562 GAATGGGATTAGGGGTGGCCTGG + Intergenic
929125046 2:38515728-38515750 GAGTGAGCTGAGCTGTGTCCTGG - Intergenic
932801874 2:74748164-74748186 TAGGGGCATTAGATGTGGCCAGG - Intergenic
932817632 2:74874471-74874493 GAGTGGGCTTGGCGGGGGCCTGG + Intronic
933317046 2:80727626-80727648 GAGTGGGCTTGCCTCTGGCCTGG - Intergenic
933552002 2:83789477-83789499 GAGTGGGATTAGGGGTGGCGTGG + Intergenic
934142077 2:89056386-89056408 GAGTGGGATTAGGGGTGGCATGG - Intergenic
934227161 2:90144160-90144182 GAGTGGGATTAGGGGTGGCATGG + Intergenic
935432163 2:102987972-102987994 GAGTGGGCTTTGATAGGGCAAGG - Intergenic
936478993 2:112867906-112867928 GACTGGTCTAAGATGTGGTCTGG + Intergenic
938732633 2:134158418-134158440 AAGTGTGCTTATACGTGGCCAGG + Intronic
940174558 2:150864030-150864052 GAGTGGGCCCAGGTGTGGCTTGG - Intergenic
943421180 2:187671046-187671068 GAGTGGGGTTAGGGGTGGCATGG + Intergenic
948767692 2:240231979-240232001 GAGTCGGCTTTGTTGGGGCCAGG + Intergenic
948892207 2:240913024-240913046 GACAGGGCCTGGATGTGGCCTGG - Intergenic
1171465995 20:25328404-25328426 GAGTGGGTCTAGATGTGGGATGG - Intronic
1174875627 20:54223476-54223498 GTGTGGGCTCAGATGTGGGAGGG - Intronic
1175636415 20:60587977-60587999 GTGTGGGCATAGAGCTGGCCAGG - Intergenic
1182588944 22:31364148-31364170 GAGTGCTCTGAGATGGGGCCTGG + Intergenic
1183208071 22:36433027-36433049 GAGTGGGATGAGAAGGGGCCTGG - Intergenic
1183212958 22:36462250-36462272 GAGTGCGCTCAGAAGTGGCTGGG + Intergenic
1183905403 22:41036513-41036535 GATGGGGTTTAGATGGGGCCAGG + Intergenic
1184414970 22:44346940-44346962 GAATGGGCTGAGATGGGGGCTGG - Intergenic
1184537910 22:45100001-45100023 GAGTGGGCAGAGAGATGGCCAGG + Intergenic
1184866642 22:47205232-47205254 GTGTGAGCTTGGAGGTGGCCAGG - Intergenic
1185079458 22:48701695-48701717 GAAAGGGCTGAGATGTGGGCGGG - Intronic
950764139 3:15260759-15260781 GGGTGGGCATGGAGGTGGCCTGG + Intronic
951315883 3:21189542-21189564 GAGTGGGATTAGGGGTGGCATGG + Intergenic
953132175 3:40150656-40150678 GAGTGAACTTAGATGCGACCAGG - Intronic
953811186 3:46114209-46114231 GATTGTGCGTAGATTTGGCCTGG - Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957734445 3:84188306-84188328 GAGCGGGATTAGGGGTGGCCTGG + Intergenic
958036553 3:88176199-88176221 TAGTGAGCTTTGATGTGGCCTGG + Intergenic
961696983 3:128712130-128712152 GACTGAGGTTAGATGGGGCCAGG + Intergenic
964312061 3:155404359-155404381 GAGTGGGCATAGCTGAAGCCAGG - Intronic
964593206 3:158390327-158390349 TAGTGGTCTTAGACCTGGCCAGG + Intronic
968691280 4:1991750-1991772 GAGTGGGCTTGGAAGTGGGCAGG - Intronic
970853585 4:20630299-20630321 GAGTGGGATTAGGGGTGGCGTGG + Intergenic
974004952 4:56546449-56546471 AATTGGTCTGAGATGTGGCCTGG + Intronic
975266716 4:72377717-72377739 AAGTGGCCTTTGATGTTGCCAGG + Intronic
976970561 4:91096726-91096748 GAGTGGGCTTACATTTTGCCTGG + Intronic
977372408 4:96155893-96155915 GAGTGGGCAGAGATGTGGCTGGG + Intergenic
984322662 4:178212790-178212812 GAGTGGGATTAGGGGTGGCGTGG - Intergenic
984412215 4:179408786-179408808 GAGTGGGATTAGGGGTGGCGTGG - Intergenic
985706863 5:1406432-1406454 CAGTGGGCTGGGGTGTGGCCTGG - Intronic
985937278 5:3106647-3106669 GAGTGGGCAGAGATGAGGCTGGG - Intergenic
986609646 5:9553576-9553598 AAGTGGACTCAGATGTGGCCTGG - Intergenic
991968894 5:72119362-72119384 GATCCAGCTTAGATGTGGCCAGG - Intronic
997956475 5:138282519-138282541 CAGTGGGCTTATATTAGGCCAGG + Intergenic
999682349 5:154072127-154072149 GATTGGTCTGAGATATGGCCTGG - Intronic
999744803 5:154584011-154584033 CAGCGGGCTTAGATGTCGCAAGG + Intergenic
1000607484 5:163340081-163340103 GAGCGGGATTAGAGGTGGCCTGG - Intergenic
1001069538 5:168572867-168572889 GAGTGGGATTAGGGGTGGCGTGG + Intronic
1001857789 5:175027752-175027774 GAGGAGGCTGAGATGTGGGCAGG + Intergenic
1002459052 5:179363773-179363795 TAGTGGGCCTAGATGGGGCCAGG + Intergenic
1002519410 5:179782994-179783016 GAGTGGGCTTAGAGGTTTCAGGG - Intronic
1004377603 6:15104291-15104313 ATGAGGACTTAGATGTGGCCGGG - Intergenic
1004405331 6:15327769-15327791 GAATGGGCTTGGTTGTGACCTGG + Intronic
1015586267 6:134779496-134779518 GAGTGGGCCTAGGTGAGACCAGG + Intergenic
1015936216 6:138407853-138407875 CAGTGGGCTGAGGTGTGGCCTGG - Intronic
1016969600 6:149749888-149749910 GAGTGTGCTTAGCGATGGCCTGG + Exonic
1017922000 6:158880926-158880948 GAGTGGGATTAGGGGTGGCGTGG + Intronic
1019306484 7:337774-337796 GTGTGTGCTTAGCAGTGGCCAGG - Intergenic
1019430295 7:996037-996059 GGCTGGGCTAAGATGTGGTCTGG - Intergenic
1021062517 7:16131475-16131497 CAGTGGGCTGAAATGTGACCTGG + Intronic
1021963143 7:25892189-25892211 GACTGGGCTTAGGCCTGGCCTGG - Intergenic
1022011296 7:26310158-26310180 GAGTGGGCTCACAGGTGGGCTGG + Intronic
1022268851 7:28786186-28786208 AAGTTGGCTTTGATGTGCCCTGG + Intronic
1022389308 7:29929406-29929428 GAGTGGGCTTTGGAGTGGCATGG - Intronic
1022665655 7:32407830-32407852 GAGTTGGCTTGGTGGTGGCCTGG - Intergenic
1023512828 7:40971239-40971261 GAGTGGGCTCACATGAGACCTGG - Intergenic
1025099579 7:56123626-56123648 CAGTGGGCTCAGGAGTGGCCAGG - Intergenic
1026568738 7:71511268-71511290 GAATGGGCTTGGATTTGGCAAGG + Intronic
1028158578 7:87460231-87460253 CAGTGGGTCCAGATGTGGCCTGG + Intronic
1029280117 7:99430040-99430062 GAGTGGGCTGACAAGTGCCCAGG - Intronic
1030105971 7:105987665-105987687 GATTGGACTTGGATATGGCCTGG + Intronic
1031979768 7:128116960-128116982 GAGTGGGCTTGGATGGTCCCAGG - Intergenic
1032433137 7:131879303-131879325 GAGTAGTCTTGGATGTGACCTGG - Intergenic
1032737977 7:134710607-134710629 CAGTGGGTTTTGCTGTGGCCTGG + Intergenic
1037571532 8:20162078-20162100 AAGTGGGCCCAGATGTGGCCTGG - Intronic
1037766487 8:21775471-21775493 GAGAGGGCTCTGAGGTGGCCCGG + Intronic
1039399063 8:37253181-37253203 GAGTGAGCTTAGCTGGGTCCAGG + Intergenic
1041119163 8:54569228-54569250 GAGTGGGCAGACAGGTGGCCTGG - Intergenic
1042706573 8:71669945-71669967 GAGTGGGATTAGGGGTGGCATGG - Intergenic
1043599410 8:81919382-81919404 GAGTGGGATTAGGGGTGGCGTGG - Intergenic
1044727391 8:95204520-95204542 GAGTAGGCTGAGCTGTGTCCTGG - Intergenic
1049363705 8:142226415-142226437 GCGTGGGCTGAGAGGTGGGCGGG - Intronic
1051863908 9:21657081-21657103 AATTGGTCTGAGATGTGGCCAGG - Intergenic
1052942855 9:34144163-34144185 GGGTGGGCAGAGATGTGACCTGG + Intergenic
1055627189 9:78186267-78186289 GAGTGGGATTAGGGGTGGCGTGG - Intergenic
1056860164 9:90173905-90173927 GAGTGGGCAGAGAGGTGGGCTGG + Intergenic
1057906435 9:98987127-98987149 GAGTGGGCCAAGAGGTGGCCTGG + Intronic
1058286295 9:103183818-103183840 GAGTGAGCTGAGCTGTGTCCTGG + Intergenic
1058720797 9:107761661-107761683 GATTGGGCAAAGATGAGGCCAGG + Intergenic
1059345956 9:113628120-113628142 CAGTGGGCTGAGAAGTGGCCTGG - Intergenic
1059794813 9:117682410-117682432 GAGTGGGCTTAGGAGTGGTGGGG + Intergenic
1059809602 9:117840939-117840961 GATGGGGCTGAGAGGTGGCCAGG + Intergenic
1060866645 9:127005032-127005054 GACTGAGCTGAGTTGTGGCCCGG + Intronic
1061921455 9:133784685-133784707 GACTGGGCTTGGATGTGGGCAGG + Intronic
1186637516 X:11422356-11422378 GAAAGGGCACAGATGTGGCCAGG + Intronic
1186935722 X:14448809-14448831 GAGTGAGCTGAGCTGTGTCCTGG - Intergenic
1188358967 X:29228909-29228931 GAGTGGGCTGAGAAGTGCCTTGG - Intronic
1189251159 X:39601527-39601549 GAGGGGGCTGAGAGGTGGACAGG + Intergenic
1192730932 X:73801943-73801965 GAGTGGGATTAGGGGTGGCGTGG + Intergenic
1200007214 X:153095114-153095136 GAGTGGGATTAGGGGTGGCGCGG + Intergenic