ID: 1142607811

View in Genome Browser
Species Human (GRCh38)
Location 17:1091606-1091628
Sequence CAACACTATGGGCTCCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142607806_1142607811 -5 Left 1142607806 17:1091588-1091610 CCTCTCCTGAGGCTCCTGCAACA 0: 1
1: 0
2: 1
3: 39
4: 411
Right 1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG 0: 1
1: 0
2: 1
3: 19
4: 132
1142607804_1142607811 1 Left 1142607804 17:1091582-1091604 CCCGGTCCTCTCCTGAGGCTCCT 0: 1
1: 0
2: 3
3: 41
4: 414
Right 1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG 0: 1
1: 0
2: 1
3: 19
4: 132
1142607805_1142607811 0 Left 1142607805 17:1091583-1091605 CCGGTCCTCTCCTGAGGCTCCTG 0: 1
1: 0
2: 5
3: 50
4: 505
Right 1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG 0: 1
1: 0
2: 1
3: 19
4: 132
1142607807_1142607811 -10 Left 1142607807 17:1091593-1091615 CCTGAGGCTCCTGCAACACTATG 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG 0: 1
1: 0
2: 1
3: 19
4: 132
1142607802_1142607811 13 Left 1142607802 17:1091570-1091592 CCGAGAGGGCTGCCCGGTCCTCT 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG 0: 1
1: 0
2: 1
3: 19
4: 132
1142607800_1142607811 25 Left 1142607800 17:1091558-1091580 CCTTCAAGGAGTCCGAGAGGGCT 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG 0: 1
1: 0
2: 1
3: 19
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142607811 Original CRISPR CAACACTATGGGCTCCACTG AGG Intronic
901525839 1:9823321-9823343 CACCACCATGGGCTGCAGTGGGG + Intronic
901989013 1:13097495-13097517 CCACAATATAGGGTCCACTGTGG - Intergenic
901992800 1:13129272-13129294 CCACAATATAGGGTCCACTGTGG + Intergenic
910525107 1:88168557-88168579 CAATAAAATGTGCTCCACTGAGG - Intergenic
914737224 1:150429322-150429344 TAACACTTTGGGATCAACTGAGG - Intronic
915664250 1:157430400-157430422 AAACACTATGGCTTTCACTGGGG + Intergenic
918346355 1:183610572-183610594 CAACACCAGGGGCTTCACTTGGG + Intergenic
922274019 1:224060025-224060047 CAACACTGTGGGCTTTACAGAGG + Intergenic
923715632 1:236422737-236422759 CAGCACTATGGGCTCTGGTGAGG + Intronic
1063096932 10:2916304-2916326 CACACCTCTGGGCTCCACTGGGG - Intergenic
1066389905 10:34970229-34970251 AAGCACTGTGGGCTCTACTGTGG - Intergenic
1067533802 10:47093383-47093405 CACCACTATGGCCACCACTATGG - Intergenic
1069326975 10:67243141-67243163 AAACACAATGGGCTCAACTTCGG - Intronic
1069551626 10:69368339-69368361 CCACACAATGGGCTTCTCTGGGG - Intronic
1069796774 10:71058469-71058491 CAACACTGTGGGTTTCACTGTGG - Intergenic
1069915704 10:71785409-71785431 CAACACCATGGGGTCCTCCGAGG + Intronic
1070528819 10:77318438-77318460 CACCACCATGGACTCTACTGTGG + Intronic
1070959020 10:80486028-80486050 CTACACTAGGGGCCACACTGCGG - Intronic
1073147502 10:101290536-101290558 CATCTCTGTGGGCTCCATTGTGG - Intergenic
1074585642 10:114765583-114765605 CAAAACTGTGGGCTTCACTATGG - Intergenic
1077274400 11:1697027-1697049 CAAAACTATGTACACCACTGAGG + Intergenic
1077479773 11:2808102-2808124 CACCACTGTGGGCACCACTTGGG + Intronic
1078130976 11:8613923-8613945 CAACACTGAGAGCTCAACTGAGG + Exonic
1087152315 11:94869874-94869896 CATCACAATGTCCTCCACTGAGG - Intronic
1089373529 11:117978564-117978586 CCACTCCATGGGCTCCTCTGAGG - Intergenic
1091302713 11:134517707-134517729 AAACAAAATGTGCTCCACTGCGG + Intergenic
1100128858 12:91465019-91465041 CAACATTAAGGGCTTAACTGAGG + Intergenic
1102597890 12:114006693-114006715 CAACACTCTGGGCTCCATGCTGG + Intergenic
1103343777 12:120235710-120235732 CACCACTAGGGGCTCCTCTGTGG - Intronic
1106118777 13:26839933-26839955 CAACACTATGACATGCACTGGGG - Intergenic
1106775536 13:33004792-33004814 TAAGACTATGGGCTCCAGTTTGG + Intergenic
1107120727 13:36792633-36792655 CATCACTATGGGCACCACTGAGG + Intergenic
1117736472 14:58773545-58773567 CAACACACTGGGCTCTCCTGAGG - Intergenic
1122600194 14:102917560-102917582 CAGCACTCTGGACTCCCCTGAGG + Intergenic
1125600637 15:40913766-40913788 CTACACAGTGGGCTCCACAGTGG - Intergenic
1126220499 15:46207703-46207725 AAGCACAAGGGGCTCCACTGGGG - Intergenic
1127398869 15:58565391-58565413 CAACACTACCTTCTCCACTGGGG + Intronic
1134053293 16:11152692-11152714 CAAAGCTAAGGGCACCACTGTGG + Intronic
1135086904 16:19482306-19482328 CAACACTTTGGGATCCACCAAGG - Intronic
1136165603 16:28450929-28450951 CACCAAGATGGGCTCCTCTGTGG - Intergenic
1136197369 16:28664080-28664102 CACCAAGATGGGCTCCTCTGTGG + Intergenic
1136213708 16:28778227-28778249 CACCAAGATGGGCTCCTCTGTGG + Intergenic
1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG + Intronic
1143879780 17:10021250-10021272 CACCACTATGGGCACAGCTGGGG - Intronic
1144472992 17:15561261-15561283 CAGCACTAAGGGCTCGACTGAGG + Intronic
1144688340 17:17242072-17242094 CAGCACTAGGTGCTCCTCTGGGG - Intergenic
1144719096 17:17455332-17455354 CAGCACCAGGGCCTCCACTGTGG - Intergenic
1144923488 17:18783439-18783461 CAGCACTAAGGGCTCGACTGAGG - Intronic
1145966561 17:28922830-28922852 CAGCACTTTGGGATCCTCTGAGG + Intronic
1147458567 17:40554034-40554056 CCACACTCTGGGCTCCAGAGTGG - Exonic
1148559030 17:48595432-48595454 CAGCACTAAGGGAGCCACTGAGG - Intronic
1148822969 17:50371224-50371246 CAACACTTTGGGATCACCTGAGG - Intronic
1150645573 17:66975725-66975747 TAACACCGTGGCCTCCACTGGGG - Intronic
1151945026 17:77314972-77314994 CAACAATCTGGGCTCCACAGGGG - Intronic
1152566845 17:81104104-81104126 CACCAGTAAGGGCTCCGCTGGGG + Exonic
1152807400 17:82362671-82362693 CAACACCACGGGCTCCCCTGGGG - Exonic
1156510895 18:37635537-37635559 CACCACTATGGACTCAACTGGGG + Intergenic
1156795146 18:41035605-41035627 CTAAACTTTGGGCTCCAGTGAGG + Intergenic
1158060134 18:53330529-53330551 CAACACTATGGGGTCTAGAGAGG - Intronic
1164056304 19:21624825-21624847 CAAAAGTATTGGCTCCATTGGGG - Intergenic
1166855202 19:45779853-45779875 CACCACGATGGGCTCCGCTGGGG + Exonic
1167281920 19:48574331-48574353 CAGCACTGTGGGCTCCACCCTGG + Intronic
925147126 2:1588787-1588809 CAGCACCATGGGCTGCACTGTGG + Intergenic
927961502 2:27243119-27243141 CACAAGTCTGGGCTCCACTGGGG - Intronic
931230513 2:60370825-60370847 GAACATTTTGGGATCCACTGGGG - Intergenic
931367883 2:61635340-61635362 CTACACTCTGGCCTCCAGTGTGG - Intergenic
935881513 2:107570415-107570437 CAACAGAATGGGCTCCCCAGCGG - Intergenic
940245405 2:151610060-151610082 CAATGCTCTGGGCTCCAATGTGG + Exonic
941932311 2:170954409-170954431 CAACACCCTGCCCTCCACTGTGG - Intronic
947588293 2:231370428-231370450 CAACTCTGTGAGCTCCACAGAGG - Intronic
948501970 2:238401897-238401919 GACCACTGTGGGCTCCTCTGAGG + Intergenic
1168902396 20:1376106-1376128 CACCCCCATGGGCTCCTCTGTGG + Intronic
1175192900 20:57223491-57223513 CAGCACTATGGGAATCACTGAGG + Intronic
1176371920 21:6067403-6067425 CAGCACTATGGGCCCATCTGGGG + Intergenic
1177138721 21:17334822-17334844 CAACACTATACACTCCAGTGGGG - Intergenic
1177239953 21:18443614-18443636 CACAACTGTGGCCTCCACTGGGG - Intronic
1179751599 21:43471136-43471158 CAGCACTATGGGCCCATCTGGGG - Intergenic
949739439 3:7213675-7213697 ATCCACTATGGGCTCAACTGAGG - Intronic
954158295 3:48700749-48700771 CTACAAAATGGGATCCACTGGGG + Intronic
956371711 3:68570654-68570676 AAACCCTCTGGGCTCCACTCTGG - Intergenic
961483952 3:127204589-127204611 AAACACTATGCATTCCACTGAGG - Intergenic
962283713 3:134070337-134070359 CCACTCCATGGGCTCCCCTGCGG - Intronic
962459945 3:135601663-135601685 CAACACTAAGGGCTCTCCAGAGG + Intergenic
963763328 3:149307736-149307758 CAACACAGTGGGCTCCCCTCTGG + Intergenic
967814224 3:193785839-193785861 CAACACAGTGGGCTCCATTTGGG - Intergenic
967937337 3:194739476-194739498 CCACCCTAGAGGCTCCACTGGGG + Intergenic
969377331 4:6771569-6771591 CCAAGCTATGGGCTCCTCTGGGG - Intergenic
971319107 4:25591017-25591039 TAACAATATGGGGTCCACTCAGG + Intergenic
973081175 4:45995836-45995858 CTAGACTGTGAGCTCCACTGGGG - Intergenic
974303977 4:60107473-60107495 CACCACCATGGGATCCTCTGAGG - Intergenic
976601269 4:86939896-86939918 CAACACTTTGAGAACCACTGTGG + Intronic
977482161 4:97592897-97592919 AAACACTCTGGGCTCTACAGAGG - Intronic
982369982 4:154624198-154624220 CCACACCATGTGCCCCACTGTGG + Intergenic
985710041 5:1422892-1422914 CAGCACCATGGGCAGCACTGTGG - Intronic
985988787 5:3538505-3538527 CCACACTGGAGGCTCCACTGAGG + Intergenic
986467541 5:8041227-8041249 AAACACTCTGGGCTCCACACTGG + Intergenic
986738263 5:10683223-10683245 CAATACTGTGGGGTTCACTGCGG + Intronic
987861462 5:23492661-23492683 AAACACTCTGGGCTCCACAAAGG + Intergenic
989027804 5:37087252-37087274 TAACACTATGGGCTCTAGTAAGG + Intergenic
991246604 5:64514767-64514789 CAACAGTATTAGCACCACTGAGG - Intronic
994031601 5:95149675-95149697 CATGACTGTGGCCTCCACTGGGG + Intronic
994092457 5:95821270-95821292 CACTACTACGGGCCCCACTGTGG - Intronic
997915937 5:137925258-137925280 CAACACTTTGGGATCACCTGAGG - Intronic
1000565001 5:162835742-162835764 CAAAACTATGGACTCGACTTTGG - Intergenic
1000831398 5:166106016-166106038 CAGCACTTTGGGATCCACTAAGG + Intergenic
1001516999 5:172362835-172362857 CAGGACCATGGGGTCCACTGAGG + Exonic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002634854 5:180602202-180602224 GAACACTGTGGGATCCACTCAGG - Exonic
1006239165 6:32662232-32662254 GGTCACTGTGGGCTCCACTGAGG + Exonic
1006248304 6:32759115-32759137 GGTCACTGTGGGCTCCACTGAGG + Exonic
1008951833 6:57170435-57170457 CACCAATATGTGCTCCACAGAGG - Intergenic
1009347235 6:62629086-62629108 GGACACTATGGGCACCAGTGAGG + Intergenic
1009513994 6:64590721-64590743 CATAACTATGGGACCCACTGAGG - Exonic
1009941148 6:70289309-70289331 CAACACTATGGGCACAGCTGAGG + Intronic
1013134751 6:107271168-107271190 TACCACTATGGCCTCCACAGTGG + Intronic
1013642604 6:112101353-112101375 CAACAATCTGGGCTCCTCTATGG - Exonic
1015104928 6:129524992-129525014 CAACACTATGGGATTCATTGGGG + Intergenic
1017456581 6:154606481-154606503 CAACACTAAGGCATCCACTCAGG - Intergenic
1018729033 6:166635422-166635444 CGAGACTAAGGGCTCCTCTGGGG - Intronic
1019902362 7:4030910-4030932 CTACACTATGAGCTCCATTAAGG + Intronic
1032133930 7:129257016-129257038 CAACTCTAGGGGCTCCTCTGAGG - Intronic
1032717758 7:134525334-134525356 CACCTCTGTGGGCTTCACTGGGG - Intergenic
1033158464 7:138976307-138976329 CAACACTTTGGGATCACCTGAGG - Intronic
1033582161 7:142748146-142748168 CAACACCATGGGCCCCACTTTGG + Intergenic
1036618005 8:10403673-10403695 CACAACTGTGGGCTCTACTGAGG + Intronic
1040318419 8:46276966-46276988 CAACCCTGTGGGCTCCTCTGGGG + Intergenic
1040439623 8:47427721-47427743 CCACTCTGTGGGCTGCACTGTGG - Intronic
1040799216 8:51322593-51322615 GACCAATATGGGCTCCACTGAGG + Intronic
1042954816 8:74238509-74238531 CAAGACTCTGAGCTCCACAGTGG + Intronic
1044488428 8:92782412-92782434 CAACACCATGGTTTTCACTGTGG - Intergenic
1052882505 9:33612181-33612203 CAACTCCATGGGCCCCACTTTGG - Intergenic
1056220021 9:84442674-84442696 GATCACTAAGGGCTCCACTGAGG + Intergenic
1058942198 9:109823562-109823584 CCACTCTGTGGTCTCCACTGTGG - Intronic
1061721709 9:132556122-132556144 CAGCACCCTGGCCTCCACTGGGG + Intronic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1185821185 X:3206408-3206430 CATTTCTGTGGGCTCCACTGTGG + Intergenic
1187644103 X:21328199-21328221 AAACCCTCTGGGCTCCACTCTGG - Intergenic
1188829206 X:34875727-34875749 CAACACTGTAACCTCCACTGAGG - Intergenic
1189926341 X:45959462-45959484 AAACGCTCTGGGCTCCACTCAGG - Intergenic
1191198634 X:57752563-57752585 CAGGACAATGGGCTCCCCTGTGG - Intergenic
1193732239 X:85115530-85115552 CAAAAACATGGGCTCCTCTGTGG - Intergenic
1194650787 X:96512328-96512350 CCACTCCATGGGCTCCAGTGCGG - Intergenic
1195611922 X:106877291-106877313 CAAGACTCTGGGCTCAACTTAGG + Intronic
1197084519 X:122456016-122456038 CAACATGATGGCCTCCCCTGAGG - Intergenic
1197279740 X:124521132-124521154 CAGCACTATGGGCTCCATTAAGG + Intronic
1197790359 X:130248464-130248486 AAACCCTCTGGGCTCCACTCTGG - Intronic
1198532778 X:137562205-137562227 AAACACTTTGTGCTCCACTAGGG + Intergenic
1199154074 X:144525683-144525705 CAGGACTGTGGGCTCCACTGTGG + Intergenic
1201401572 Y:13609408-13609430 CAAAAGTATTGGCTCCACTGGGG - Intergenic
1202275828 Y:23118770-23118792 TAACACTATGTTCTCCTCTGTGG + Intergenic
1202290200 Y:23301921-23301943 TAACACTATGTTCTCCTCTGTGG - Intergenic
1202428822 Y:24752489-24752511 TAACACTATGTTCTCCTCTGTGG + Intergenic
1202441969 Y:24917600-24917622 TAACACTATGTTCTCCTCTGTGG - Intergenic