ID: 1142609739

View in Genome Browser
Species Human (GRCh38)
Location 17:1102266-1102288
Sequence TCTGTGGCCACGATGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 110}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142609739_1142609749 -2 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609749 17:1102287-1102309 GAAGGGGAGTGAGAGGGCCGGGG 0: 1
1: 0
2: 7
3: 82
4: 713
1142609739_1142609750 5 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609750 17:1102294-1102316 AGTGAGAGGGCCGGGGAGACAGG 0: 1
1: 0
2: 3
3: 42
4: 491
1142609739_1142609745 -8 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609745 17:1102281-1102303 GCCACAGAAGGGGAGTGAGAGGG 0: 1
1: 0
2: 4
3: 45
4: 491
1142609739_1142609748 -3 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609748 17:1102286-1102308 AGAAGGGGAGTGAGAGGGCCGGG 0: 1
1: 0
2: 11
3: 114
4: 1000
1142609739_1142609747 -4 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609747 17:1102285-1102307 CAGAAGGGGAGTGAGAGGGCCGG 0: 1
1: 0
2: 5
3: 196
4: 924
1142609739_1142609755 18 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609755 17:1102307-1102329 GGGAGACAGGGTAGTGGTGAGGG 0: 1
1: 1
2: 3
3: 48
4: 643
1142609739_1142609754 17 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609754 17:1102306-1102328 GGGGAGACAGGGTAGTGGTGAGG 0: 1
1: 1
2: 2
3: 62
4: 623
1142609739_1142609751 6 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609751 17:1102295-1102317 GTGAGAGGGCCGGGGAGACAGGG 0: 1
1: 0
2: 2
3: 33
4: 463
1142609739_1142609744 -9 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609744 17:1102280-1102302 GGCCACAGAAGGGGAGTGAGAGG 0: 1
1: 0
2: 3
3: 41
4: 467
1142609739_1142609752 12 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609752 17:1102301-1102323 GGGCCGGGGAGACAGGGTAGTGG 0: 1
1: 0
2: 3
3: 67
4: 606
1142609739_1142609756 27 Left 1142609739 17:1102266-1102288 CCCTGAGGCATCGTGGCCACAGA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1142609756 17:1102316-1102338 GGTAGTGGTGAGGGACTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142609739 Original CRISPR TCTGTGGCCACGATGCCTCA GGG (reversed) Intronic
900494879 1:2971857-2971879 GCTGTGGCCTCGCTGCCTCCCGG - Intergenic
902635730 1:17733901-17733923 TCTGGGAGCACGATTCCTCAAGG + Intergenic
902890397 1:19439116-19439138 CCTGTGGCCAAGAAGCCTCCCGG + Intronic
907957318 1:59242149-59242171 TCTGTGCCCAAGAGGTCTCATGG - Intergenic
908104156 1:60824293-60824315 TGTCAGGGCACGATGCCTCATGG + Intergenic
915849464 1:159305752-159305774 TCTGGGGCCACAAAGCCTCTCGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
917504502 1:175615539-175615561 TCTGTGACCTCGAAGCCTCAGGG - Intronic
923520142 1:234728933-234728955 TCAGTGGCCCCGACACCTCAGGG - Intergenic
924711666 1:246534605-246534627 TCAGTGGCAAGGAAGCCTCAGGG + Intergenic
1069921106 10:71816182-71816204 TCTCTGGCCAAGATGGGTCATGG + Intergenic
1070763006 10:79036684-79036706 TCTGTGGCCATGGTGCCAGAAGG - Intergenic
1076327032 10:129632369-129632391 TCAGTGGCCTCACTGCCTCATGG - Intronic
1076705015 10:132296825-132296847 TCTGTGGCCACCATGCCCCGGGG - Intronic
1078050701 11:7962776-7962798 TCTGTGGCCCTGATCTCTCAAGG - Intronic
1078713192 11:13815133-13815155 ACTGTGCCCACCATGCCTAATGG + Intergenic
1080522207 11:33077111-33077133 TCTGTGGCCACTGTGCCTGGCGG + Intronic
1081402236 11:42656657-42656679 TCTGTGGCAAAGAAGCCTCGAGG - Intergenic
1083692180 11:64416210-64416232 CCTGTGGCCACGAACCCTCATGG - Intergenic
1084812855 11:71625756-71625778 TCTGTGGCCTGGGTGGCTCAAGG - Intergenic
1085779665 11:79396727-79396749 CCAGTGGCCACCATGCCTGAAGG - Intronic
1088147649 11:106701975-106701997 TCTGTGGCCAAGCTGTCCCATGG - Intronic
1102698253 12:114816806-114816828 TCTGTCTCCATGATGCCTCTTGG - Intergenic
1105205726 13:18221863-18221885 TCCGTGGGCATGATGCCTTATGG - Intergenic
1105331556 13:19421364-19421386 TCCGTGCCCACCATGGCTCAGGG + Intergenic
1105880228 13:24599186-24599208 TCCGTGCCCACCATGGCTCAGGG - Intergenic
1105919604 13:24949680-24949702 TCCGTGCCCACCATGGCTCAGGG + Intergenic
1106584696 13:31046795-31046817 TCTGTGGCCAAGCTGCCTCACGG + Intergenic
1108263004 13:48677105-48677127 TCTGTAGCCCTGAGGCCTCATGG - Intronic
1113580528 13:111425618-111425640 ACTGCGGACACCATGCCTCAGGG - Intergenic
1113737364 13:112688685-112688707 TCTGTGGCTACGATTCTTCCTGG - Intergenic
1118174210 14:63421998-63422020 AGTGTGGCCACGATGCCTCAAGG + Exonic
1122887151 14:104715140-104715162 TCTCTGGCCACTAAGCCACATGG - Intronic
1123061364 14:105596186-105596208 CCTGTGGCCCCGATGGCTCTGGG + Intergenic
1123085818 14:105717097-105717119 CCTGTGGCCCCGATGGCTCTGGG + Intergenic
1129759992 15:78123796-78123818 TCAGAGGCCTCGATGCCACAGGG + Intronic
1130051918 15:80490815-80490837 ACTGTGGTCACCATGCATCATGG + Intronic
1133080395 16:3314490-3314512 TCTGGGGCTAACATGCCTCAGGG - Intronic
1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG + Intergenic
1139367760 16:66444189-66444211 CCTGTGTCCACCATGCCCCAAGG + Intronic
1139631326 16:68233767-68233789 ACTGTGGCCACCATGGCACAGGG - Exonic
1142206670 16:88786044-88786066 ACTGTGGCCACTGAGCCTCAAGG + Intergenic
1142609739 17:1102266-1102288 TCTGTGGCCACGATGCCTCAGGG - Intronic
1144739056 17:17571028-17571050 TCTGTGGCCTGGACTCCTCAGGG - Intronic
1146567397 17:33925073-33925095 TCTCTGGCCACCATGCTGCAGGG + Intronic
1154964002 18:21338571-21338593 TCTCTGGGCACCAGGCCTCAGGG + Intronic
1160840714 19:1145966-1145988 TCTGAGGCCAAGGTGTCTCAGGG + Intronic
1161562460 19:4981186-4981208 GCTGGGGCCACGCTGCCCCATGG - Intronic
1161737401 19:5999892-5999914 CCCCTGGCCACGCTGCCTCAGGG - Intronic
1162475864 19:10898959-10898981 TCTGTGCCCATCATTCCTCATGG - Intronic
1165673129 19:37696574-37696596 GCTGTGGCCCAGTTGCCTCACGG + Exonic
1166331152 19:42078760-42078782 TCTGTGGCCACAGTGACTCCGGG - Exonic
1166570506 19:43793325-43793347 TCCTTGGCCACCATGCCTCAGGG + Intergenic
925273702 2:2634167-2634189 TCTGAGGCCTGGATGCCTCTCGG + Intergenic
926698743 2:15788608-15788630 TCAGTGGCCCCCATGCCCCAAGG + Intergenic
928455856 2:31420982-31421004 TCTGTGTCCAGAAGGCCTCAGGG - Intergenic
928613129 2:33010138-33010160 TCTGTGGCCAGCATGGCTGATGG + Intronic
933991761 2:87639028-87639050 TCGGTGCCAAGGATGCCTCATGG + Intergenic
936302084 2:111311790-111311812 TCGGTGCCAAGGATGCCTCATGG - Intergenic
936606612 2:113963912-113963934 TCTGTGGGCAGTATTCCTCAGGG + Intergenic
937974860 2:127576528-127576550 TCTGAGGCCCTGAGGCCTCAGGG + Intronic
947794035 2:232883241-232883263 TGTGTGGCCTCGATGCCTATGGG - Intronic
948650831 2:239442620-239442642 TCTGTGCCCACGCTGCCTGCCGG - Intergenic
1171230365 20:23479468-23479490 TGAGTGGACACGATGCTTCAGGG + Intergenic
1171879177 20:30604022-30604044 TCTGTGACCAGGAAGCCTAAGGG + Intergenic
1173248096 20:41349938-41349960 TCTGTGGCCCCCATGGGTCAGGG + Intronic
1174715381 20:52752160-52752182 GCTGTGGCGAAGAGGCCTCAGGG - Intergenic
1175851614 20:62097024-62097046 TCTGTGCCCATGACACCTCAGGG - Intergenic
1176741444 21:10607226-10607248 TCCGTGCCCACCATGGCTCAGGG - Intergenic
1178443524 21:32618080-32618102 TCTGTGGCCTGGGGGCCTCAAGG - Intergenic
1180760242 22:18196853-18196875 TCCGTGGGCATGATGCCTTATGG + Intergenic
1180775426 22:18427843-18427865 TCCGTGGGCATGATGCCTTATGG - Intergenic
1182359830 22:29739949-29739971 TCTCTGTCCAGGAGGCCTCAGGG - Intronic
1182686184 22:32122878-32122900 TCTGGGGCCACGTTGGCTCAGGG + Intergenic
1183782525 22:40007898-40007920 TCTGTGGAGACGATGCATCCAGG - Intronic
1184142743 22:42587778-42587800 TTTGTGGCCACTTTGCCTCTTGG - Intronic
1185103009 22:48851702-48851724 TCTGTGGACACCAGGCCCCATGG + Intergenic
1185278180 22:49958787-49958809 TCTACGGCCAGGATGACTCAGGG + Intergenic
1203278592 22_KI270734v1_random:110098-110120 TCCGTGGGCATGATGCCTTATGG + Intergenic
953915470 3:46917446-46917468 TCTGTTTCCAAGATGACTCATGG - Intergenic
954418225 3:50404587-50404609 TCTATGCCCACCATGGCTCAGGG + Intronic
954943147 3:54393449-54393471 TCAGTGGCAACAAAGCCTCAGGG - Intronic
956788359 3:72661240-72661262 GCTGCTGCCAAGATGCCTCAGGG - Intergenic
961006632 3:123410040-123410062 TATGGGGCCACACTGCCTCAGGG - Intronic
961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG + Intronic
962929895 3:140026622-140026644 TCTGAGGCCAAGATCCCTGAGGG - Intronic
963222558 3:142827540-142827562 CCTGTGGGCACCATGCCTGAGGG - Intronic
966544418 3:181129324-181129346 CCTGTGTCCACACTGCCTCAAGG - Intergenic
968121458 3:196128784-196128806 ACTGTGGCCACAAAGCCTCGGGG - Intergenic
968707035 4:2084014-2084036 TCTCTGGCCACCAGCCCTCAGGG - Intronic
969290098 4:6233360-6233382 TCTGTGCCCATGTGGCCTCAGGG + Intergenic
971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG + Intergenic
971859506 4:32086502-32086524 TCCTTGACCAAGATGCCTCATGG + Intergenic
972296746 4:37746319-37746341 TGTGTGGCCCCTCTGCCTCAGGG - Intergenic
984414137 4:179435261-179435283 TCTCTGGCAACGAAGCTTCAGGG + Intergenic
985952322 5:3231775-3231797 TCTGTGGACACGTTGCCCAATGG - Intergenic
985970788 5:3376903-3376925 GCTGTGGCCTGGAGGCCTCAGGG + Intergenic
992766123 5:80002262-80002284 TCTGAGGCCACACTACCTCAAGG + Intronic
1001124621 5:169008311-169008333 TCTGTGGCCATGAAGCTGCAAGG + Intronic
1018860516 6:167707953-167707975 TATGTTGTCACGATGCCCCATGG + Intergenic
1019153953 6:170026394-170026416 CCTGTGGCAGAGATGCCTCAGGG + Intergenic
1020310209 7:6861464-6861486 TCTGTGGCCTCGGGGGCTCAAGG + Intergenic
1020833315 7:13118198-13118220 TTTGTGGCAACCATTCCTCAAGG + Intergenic
1021793555 7:24230059-24230081 TCTGTGGCCAAGATGCTGCCGGG + Intergenic
1032451697 7:132037064-132037086 ACTGGGGCCAAGATGCCTCCAGG + Intergenic
1035315104 7:157992725-157992747 CCTGTGGCCACGGTGCCTGGGGG - Intronic
1036240817 8:7079703-7079725 TCTGTGGCCTCGGGGGCTCAAGG - Intergenic
1038573550 8:28684453-28684475 TCAGTGGGCACGATGCATGATGG + Intronic
1043418817 8:80078530-80078552 TCTGTGCCCATGACCCCTCAGGG - Intronic
1045603196 8:103742762-103742784 TCTTTAACAACGATGCCTCAAGG + Intronic
1047509364 8:125504633-125504655 TCTGTGGCCATGAGGCGACATGG - Intergenic
1049432790 8:142573105-142573127 TCTGTGGCCAGGCTGGCACAAGG - Intergenic
1049432982 8:142573845-142573867 TGGGTGGCCCCAATGCCTCACGG + Intergenic
1049844025 8:144791447-144791469 CCTGTGGGCACCATGCCTGAGGG - Exonic
1056934398 9:90904799-90904821 TCTGTGCCCACGATGCCGTAAGG + Intergenic
1057316983 9:93975821-93975843 TCTGTGGCAATGATGACACAGGG - Intergenic
1058678950 9:107425091-107425113 TCTTTGGCGACGCTGCCTCCTGG + Intergenic
1062235629 9:135506354-135506376 CCTGTGGCCACAATGCCTGCAGG + Intergenic
1194533240 X:95076264-95076286 TCAGTGGCAAGGAAGCCTCAAGG - Intergenic
1200688335 Y:6277813-6277835 CCTGTGGCCACGACTTCTCAGGG - Intergenic