ID: 1142610442

View in Genome Browser
Species Human (GRCh38)
Location 17:1106873-1106895
Sequence CACAAGGCGTTCAGAGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142610442_1142610450 23 Left 1142610442 17:1106873-1106895 CCCCTTGCTCTGAACGCCTTGTG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1142610450 17:1106919-1106941 CTTGTCATCTCTACAGTGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 139
1142610442_1142610452 28 Left 1142610442 17:1106873-1106895 CCCCTTGCTCTGAACGCCTTGTG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1142610452 17:1106924-1106946 CATCTCTACAGTGCCAGGCAGGG 0: 1
1: 0
2: 4
3: 31
4: 264
1142610442_1142610451 27 Left 1142610442 17:1106873-1106895 CCCCTTGCTCTGAACGCCTTGTG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1142610451 17:1106923-1106945 TCATCTCTACAGTGCCAGGCAGG 0: 1
1: 0
2: 0
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142610442 Original CRISPR CACAAGGCGTTCAGAGCAAG GGG (reversed) Intronic
901006232 1:6172897-6172919 CACAAGGTGATCAAAACAAGGGG + Intronic
902613061 1:17608364-17608386 CAGAAGGCGGGGAGAGCAAGTGG - Intronic
903364453 1:22797428-22797450 CACAAAGGGCTCAGAGCGAGAGG - Intronic
903641195 1:24861656-24861678 CACTGGGCGTCCAGAGCACGTGG + Intergenic
904049368 1:27629610-27629632 CACATAGAGATCAGAGCAAGAGG - Intronic
906406765 1:45548506-45548528 CACAAGGCGGGCAGATCACGAGG - Intergenic
907751340 1:57266142-57266164 CACAAGGCTATCAGAAAAAGGGG + Intronic
908809098 1:67960643-67960665 CACAGGTCCTTCAGAGCATGGGG - Intergenic
911812466 1:102300551-102300573 CACAAGGCCTGCATGGCAAGTGG - Intergenic
916846177 1:168652569-168652591 CAAAAGCCATTCAGAGGAAGTGG - Intergenic
920733902 1:208513808-208513830 GACAAGGCCTTCAAAGCCAGAGG + Intergenic
921580222 1:216887692-216887714 AACAAGCCATTCAGAGGAAGTGG - Intronic
1071483323 10:86080678-86080700 CACAAGGAGTCAAGTGCAAGAGG + Intronic
1072544316 10:96422762-96422784 CAGAAGACATTCAGAGCAAGAGG + Intronic
1083887609 11:65580549-65580571 CACAGGGCGGGCACAGCAAGTGG - Intronic
1084960440 11:72713459-72713481 CACAAGGAGGTCCGAGCCAGTGG + Intronic
1088659974 11:112035719-112035741 CACAAGGCAGTCAGATCACGAGG - Intronic
1097226410 12:57479088-57479110 CACCAGGAGTCCAGAGCAATTGG + Exonic
1102768498 12:115452899-115452921 GACAAGGCCTTCAGAGCCAGCGG + Intergenic
1104598315 12:130134702-130134724 CACAGGGCGGTCAGGGCAGGCGG + Intergenic
1105932554 13:25066580-25066602 TAGAAGGTGTTCAGAGTAAGAGG + Intergenic
1106847824 13:33755706-33755728 CACAAGAAATTCAGAGAAAGAGG - Intergenic
1112409631 13:99151804-99151826 CCCAAGGTGGACAGAGCAAGTGG + Intergenic
1112432290 13:99360619-99360641 CCCAAGGTGTTCAAAGAAAGGGG - Intronic
1112547081 13:100381703-100381725 CACAAGGAGTTGAGAGCTATAGG - Intronic
1112859288 13:103810326-103810348 CACAAGGCCTCCAGAACAAATGG - Intergenic
1113256136 13:108508205-108508227 TACAAGGCATACAGAGAAAGAGG - Intergenic
1117843548 14:59886514-59886536 CACAAGCCCTTGAGAGCCAGAGG + Intergenic
1122024834 14:98868087-98868109 AACAAGGGGTTCAGACCAAAGGG - Intergenic
1125120132 15:36146502-36146524 CACAAGGCATACAAAGCAACTGG + Intergenic
1130210954 15:81920850-81920872 CACAAGGCATACAGAGAAACAGG + Intergenic
1132413810 15:101606156-101606178 CAAAAGGCCTTCAGGACAAGGGG - Intergenic
1132730861 16:1361317-1361339 CACAAGACGTTCAAAGAAACAGG - Intronic
1133819181 16:9221513-9221535 AACAAGGATTTCAGTGCAAGTGG - Intergenic
1137766613 16:50982306-50982328 GACAAGGAATTGAGAGCAAGTGG + Intergenic
1138852033 16:60641168-60641190 CATGAGGAGTTGAGAGCAAGGGG - Intergenic
1142610442 17:1106873-1106895 CACAAGGCGTTCAGAGCAAGGGG - Intronic
1143909666 17:10237340-10237362 CACAAGGTGTGAATAGCAAGAGG + Intergenic
1145275514 17:21427028-21427050 CACAGCTGGTTCAGAGCAAGGGG - Intergenic
1145711813 17:26984878-26984900 CACAGCTGGTTCAGAGCAAGGGG - Intergenic
1156100404 18:33586925-33586947 CACATGGTGTCCAGAGAAAGTGG + Intronic
1156713430 18:39976817-39976839 CACAAGGAGTTGAGAGCAGCAGG - Intergenic
1158014310 18:52766027-52766049 CACAAGGAGTTGAGAGCAGTGGG - Intronic
1158541746 18:58362617-58362639 CACAAGCTGTTGAGAGCAACAGG - Intronic
1162966276 19:14157628-14157650 CACAAGCCTTCCAGAGCATGAGG - Intronic
1164026544 19:21358437-21358459 TACAAGGCGGGCAGATCAAGAGG - Intergenic
1164144442 19:22503207-22503229 AAGATGGAGTTCAGAGCAAGAGG - Intronic
1164662573 19:29989653-29989675 CACAAGGCGGACAGATCATGAGG - Intronic
928950202 2:36807266-36807288 CAGAAGGCCTTGAGAGCAATGGG - Intronic
934858275 2:97742398-97742420 CATGAGACGTTCACAGCAAGAGG - Intergenic
935470057 2:103448485-103448507 TAAAAGTCATTCAGAGCAAGTGG - Intergenic
935555759 2:104508206-104508228 CACACTGTGTTCAGAGAAAGGGG - Intergenic
940424543 2:153515385-153515407 CAGAAGGTTTTCAGAGCAAAGGG - Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
946353068 2:219168327-219168349 CAGAAGGCTTTAGGAGCAAGAGG + Intronic
1169035571 20:2448611-2448633 CAAAAGAGGCTCAGAGCAAGAGG + Intergenic
1169045176 20:2529268-2529290 CACAGGGCGTTCAAATCCAGGGG - Intergenic
1170290584 20:14764296-14764318 CACAAGGCCTTCAGTCCCAGCGG + Intronic
1171142672 20:22756468-22756490 AAGAAGGCATTCAGGGCAAGAGG + Intergenic
1174498710 20:50968392-50968414 CACAAGGCCCTCTGAGCATGCGG + Intergenic
1177493174 21:21854774-21854796 CCCAAGGCGGGCAGAGCACGAGG + Intergenic
1179493789 21:41758918-41758940 CAGAATGCGTTCAGAGTAAGAGG + Intronic
1179609845 21:42543202-42543224 CAGAATGCGCTCAGAGCAAGAGG + Intronic
1179935279 21:44600066-44600088 CCCAAGGGCTTTAGAGCAAGTGG - Intronic
1184362363 22:44025988-44026010 AACAGGGCGATCAGAGCCAGGGG + Intronic
1185253341 22:49817181-49817203 CAGAAGGGGTGCAGAGCCAGTGG + Intronic
952925181 3:38315137-38315159 TGCAAGGTGGTCAGAGCAAGGGG - Intronic
953983348 3:47423852-47423874 CACAGAGCGTTAACAGCAAGAGG + Intronic
959348392 3:105228927-105228949 CACAGGGCGTGCATAGCAAGAGG - Intergenic
961231835 3:125319914-125319936 CAGAAGGCCTTAAGAGCAGGTGG - Intronic
963802479 3:149689950-149689972 CACAAGGAGTTAAAAGTAAGAGG + Intronic
964214283 3:154262361-154262383 GACAAAGCCTTCAGAGCAAAGGG + Intergenic
972662877 4:41133781-41133803 AACAAGGAGTGCAGAGTAAGGGG + Intronic
979596691 4:122542197-122542219 CACAAGGGGTTGAGTGCAATGGG + Intergenic
979815157 4:125091903-125091925 TGCAAGGGGTTCAGAGCAGGGGG - Intergenic
980374482 4:131926577-131926599 CAGAAGGGGGTCAGAGCAACTGG - Intergenic
983018179 4:162640560-162640582 CACAAGGAGTTGAGAGCAGTGGG + Intergenic
986752510 5:10801433-10801455 CACAAGGACTTTAGAGTAAGAGG - Intergenic
986786933 5:11123210-11123232 CACAAGGCGTTAGGAGGTAGGGG + Intronic
987451146 5:18085381-18085403 GACAAGGAGTTCTGAGCAGGAGG + Intergenic
988920625 5:35938374-35938396 CACTAGGCTGTCAGTGCAAGAGG - Intronic
989633030 5:43506938-43506960 CATAAGTTTTTCAGAGCAAGAGG + Intronic
991405499 5:66297239-66297261 GACAAGGAGTTCAGGGGAAGAGG - Intergenic
991589085 5:68230457-68230479 CACATGACATTCAGAGCACGTGG - Intronic
996346450 5:122493375-122493397 CAGAAGGCGGCCAGAGCAAAAGG - Intergenic
1000169184 5:158684944-158684966 CACATGGCATTCTGGGCAAGAGG + Intergenic
1001202232 5:169728665-169728687 CCAAAGGCCATCAGAGCAAGGGG + Intronic
1001204753 5:169752053-169752075 CACAAGGACTTCTGAGCATGTGG - Intronic
1003948701 6:11097999-11098021 AACATGGAGTTCAGATCAAGAGG + Intronic
1017679649 6:156850538-156850560 TACTATGCGTTCAGTGCAAGGGG - Intronic
1019014863 6:168872878-168872900 CCCAAGGAGTTCAGAGAAGGCGG - Intergenic
1019084243 6:169459050-169459072 CACAAGGCATTCAAAGAAATAGG + Intronic
1019508944 7:1407619-1407641 CACACGGCGCTCACGGCAAGGGG + Intergenic
1019545866 7:1575858-1575880 AACAAGACGTGCAAAGCAAGTGG + Intergenic
1024324124 7:48095459-48095481 GACCAGGAGTCCAGAGCAAGGGG - Intronic
1026849818 7:73717656-73717678 CACAAGGCATTCAGAGCCCAGGG - Intronic
1032840619 7:135710921-135710943 CACAAGCTGTCCAGAGCAGGGGG - Intronic
1035915692 8:3619399-3619421 CACAAGGCATACAAAGAAAGAGG + Intronic
1037982004 8:23261175-23261197 CTCCAGGTGTTCAGAGAAAGAGG + Exonic
1038230889 8:25698612-25698634 TACAAGGCATTCAGAGTGAGGGG - Intergenic
1053639457 9:40056558-40056580 CAGAAGGGGGTCAGAGCAACTGG - Intergenic
1053766622 9:41408551-41408573 CAGAAGGGGGTCAGAGCAACTGG + Intergenic
1054320259 9:63653217-63653239 CAGAAGGGGGTCAGAGCAACTGG - Intergenic
1054545290 9:66320061-66320083 CAGAAGGGGGTCAGAGCAACTGG + Intergenic
1059815534 9:117908789-117908811 CACAAGGCATACAGAGAAACAGG + Intergenic
1060494503 9:124108177-124108199 AACAAGGGGTTCAAACCAAGTGG + Intergenic
1187231350 X:17426334-17426356 CACAATGAGATCAGAGCAAAGGG - Intronic