ID: 1142610970

View in Genome Browser
Species Human (GRCh38)
Location 17:1109109-1109131
Sequence CACGCAGCGGCGGCGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 365}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142610957_1142610970 12 Left 1142610957 17:1109074-1109096 CCGGAGCCCGCGGAGGGCAGACA 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG 0: 1
1: 0
2: 4
3: 33
4: 365
1142610952_1142610970 24 Left 1142610952 17:1109062-1109084 CCTCCATGGCAGCCGGAGCCCGC 0: 1
1: 0
2: 0
3: 8
4: 169
Right 1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG 0: 1
1: 0
2: 4
3: 33
4: 365
1142610954_1142610970 21 Left 1142610954 17:1109065-1109087 CCATGGCAGCCGGAGCCCGCGGA 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG 0: 1
1: 0
2: 4
3: 33
4: 365
1142610951_1142610970 27 Left 1142610951 17:1109059-1109081 CCTCCTCCATGGCAGCCGGAGCC 0: 1
1: 0
2: 2
3: 23
4: 276
Right 1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG 0: 1
1: 0
2: 4
3: 33
4: 365
1142610960_1142610970 5 Left 1142610960 17:1109081-1109103 CCGCGGAGGGCAGACAGGAAGCG 0: 1
1: 0
2: 2
3: 16
4: 149
Right 1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG 0: 1
1: 0
2: 4
3: 33
4: 365
1142610959_1142610970 6 Left 1142610959 17:1109080-1109102 CCCGCGGAGGGCAGACAGGAAGC 0: 1
1: 0
2: 3
3: 13
4: 216
Right 1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG 0: 1
1: 0
2: 4
3: 33
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142610970 Original CRISPR CACGCAGCGGCGGCGGGAGG AGG Intronic
900269210 1:1778553-1778575 CACCCCGCGCGGGCGGGAGGCGG + Intronic
901109615 1:6784856-6784878 CCGGCAGCGGCGGCGGGCTGCGG + Intergenic
901473471 1:9473408-9473430 CACCCAGCAGCGGCAGGAGCTGG + Intergenic
903574777 1:24332458-24332480 CACGCACTGGAGGTGGGAGGGGG - Intronic
903582999 1:24386403-24386425 CAGGCAGCGGCAGCTGGAGCTGG + Intronic
903750181 1:25616692-25616714 GGCGCGGCGGCGGCGGGAGGGGG + Intergenic
903907401 1:26696484-26696506 CGAGCAGCAGCAGCGGGAGGAGG + Exonic
904239412 1:29134343-29134365 CAGGCGGCGGAGGCGGGAGGCGG + Intergenic
904360564 1:29968713-29968735 CAAGCAGAGGCAGCAGGAGGTGG + Intergenic
904724852 1:32539584-32539606 CACGCGGCGCCGGCGGAGGGCGG + Intronic
904769106 1:32871021-32871043 TAGGCAGCGGGGGCGGGAGTGGG - Intronic
905166686 1:36087251-36087273 CAGGAAGCGGCTGCGGGAGATGG + Exonic
905369203 1:37474400-37474422 CGCGCAGCGGCCGCGGGGGCGGG + Intergenic
905553078 1:38859519-38859541 GAGGCGGCGGCGGCGGGCGGAGG - Exonic
905850795 1:41273193-41273215 CACGCAGGGGTGGCCTGAGGAGG - Intergenic
905960061 1:42035815-42035837 CGGGCCGGGGCGGCGGGAGGCGG + Intronic
906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG + Intronic
906481625 1:46203295-46203317 CGCGGCGCGGGGGCGGGAGGAGG - Intronic
908131847 1:61082378-61082400 CCCGCGGCGGCGGCGCGAGCGGG + Intronic
909433403 1:75615344-75615366 GACGAAGGGGCGGAGGGAGGGGG + Intergenic
912124883 1:106523599-106523621 CAGGGAGCGGCGGTGGGGGGTGG - Intergenic
913186283 1:116373266-116373288 CGCAGAGCAGCGGCGGGAGGAGG + Intronic
913939231 1:125086687-125086709 AAAGCCGCGGCGGCGGCAGGGGG + Intergenic
914044057 1:144077057-144077079 AAAGCCGCGGCGGCGGGGGGAGG - Intergenic
914044328 1:144078005-144078027 AAAGCCGCGGCGGCGGGGGGGGG - Intergenic
914133783 1:144882682-144882704 AAAGCCGCGGCGGCGGGGGGGGG + Intergenic
915074510 1:153297430-153297452 CAGGCAGAGGCGGGGAGAGGGGG + Intergenic
915616895 1:157045942-157045964 CACGCCGCGGCGGCCGGGGGCGG + Intergenic
916666924 1:166975339-166975361 CACCCCGCGGCAGCGGGCGGCGG + Intronic
917755467 1:178094011-178094033 GAGGCGGCGGCGGCGGGAGCCGG + Intergenic
918209195 1:182335940-182335962 AAGGCAGCGGTGGCGGGAGAAGG - Intergenic
919657636 1:200213536-200213558 CACGCGGCTCCGGCGGAAGGAGG - Intergenic
920922656 1:210311195-210311217 CACACAGTGGCGGGGGGCGGGGG + Intergenic
921023740 1:211259320-211259342 CGGGCGGCGGCGGAGGGAGGAGG + Intronic
921947180 1:220894269-220894291 CGCGCAGAGGCGGTTGGAGGCGG + Intergenic
923181969 1:231528560-231528582 CGCGCGGCGGTGGCGGGTGGTGG + Intergenic
923591931 1:235327606-235327628 GACACAGCGGCTGCGGGGGGTGG + Intronic
924415173 1:243850306-243850328 GCGGCGGCGGCGGCGGGAGGGGG + Intronic
924582049 1:245331078-245331100 AACGCAGCCGCGGCAGGGGGCGG + Intronic
1062907080 10:1186472-1186494 CATGCAGGTGCCGCGGGAGGTGG - Intronic
1063929844 10:11018056-11018078 CACGCGGCGGCAGCGGCGGGGGG - Exonic
1064244340 10:13657218-13657240 GAGGCAGCGGCAGCGGGCGGCGG - Exonic
1064443210 10:15371382-15371404 GACGCAGCGGCGCCGGGCGGGGG - Intergenic
1065712737 10:28533164-28533186 GCGGCGGCGGCGGCGGGAGGAGG + Intronic
1065712823 10:28533491-28533513 CAGGCGGCGGCGGCGGCGGGCGG - Exonic
1066303825 10:34119662-34119684 GATGCAGCGGCAGCGGCAGGAGG - Exonic
1066464555 10:35640913-35640935 CGGGCGGCGGCGGCGGCAGGCGG + Exonic
1066963971 10:42243675-42243697 ATGGCAGCGGCGGCGGGGGGGGG - Intergenic
1067937605 10:50624604-50624626 CTCGGAGGGGCGGCGGAAGGTGG - Intronic
1068080547 10:52313675-52313697 CTCGCAGTGGCGGGGGGAGGTGG + Intergenic
1069591021 10:69641877-69641899 CACGCAGCTCCTGGGGGAGGAGG - Intergenic
1071291865 10:84194629-84194651 ACTGCAGCCGCGGCGGGAGGGGG - Intergenic
1072404905 10:95141670-95141692 CACACAGCGGGGGCTAGAGGAGG + Intergenic
1072562223 10:96586874-96586896 GAGGAGGCGGCGGCGGGAGGAGG - Exonic
1072719458 10:97771808-97771830 CGGGCGGCGGCGGCGGGGGGGGG - Exonic
1072936560 10:99718815-99718837 CACTCAGTGGCGGGGTGAGGAGG - Intronic
1073036873 10:100570059-100570081 CGGGCGGCTGCGGCGGGAGGCGG + Intergenic
1073112928 10:101073541-101073563 CAGGGAGGGGCGGCGGGAGTCGG - Intergenic
1073295431 10:102435696-102435718 CATGGGGCGGGGGCGGGAGGCGG + Intergenic
1075040550 10:119104124-119104146 CGCGCCGCGGCGGCGGAAGATGG + Exonic
1075697488 10:124447631-124447653 CAGCCAGGGGCGGCGGGGGGCGG - Exonic
1075999728 10:126905333-126905355 CCGGGAGCGCCGGCGGGAGGCGG - Intergenic
1076177300 10:128377907-128377929 CAGGCAGCGGTGGTGGGAGTGGG - Intergenic
1076374055 10:129971893-129971915 AGGGCGGCGGCGGCGGGAGGAGG - Intergenic
1076734718 10:132453403-132453425 GACGCGGCGGCTGCGAGAGGGGG + Intergenic
1076761095 10:132606136-132606158 CACGCAGCTGCAGCTGGATGTGG + Intronic
1078771796 11:14358714-14358736 GCCGGAGCGGCGGCGGGCGGGGG - Intronic
1081459310 11:43256863-43256885 CAGGCAGAGGCGGGTGGAGGGGG + Intergenic
1082023369 11:47553091-47553113 GCGGCAGCGGCGGCGGGACGCGG - Intronic
1082824459 11:57567724-57567746 CACGCAGCGACGGCTGGAGGAGG - Exonic
1083366570 11:62145062-62145084 CAAGCGGCGGCGGCTGGAGGAGG + Exonic
1083747730 11:64744899-64744921 CGCGCAGGGGCGGAGGGGGGAGG - Intronic
1083822694 11:65181893-65181915 GGCGGAGGGGCGGCGGGAGGAGG + Intronic
1083878848 11:65538476-65538498 CGAGGAGCGGCGGCGGGAGATGG + Exonic
1084146224 11:67266661-67266683 GCGGCGGCGGCGGCGGGAGGAGG + Exonic
1084165373 11:67372846-67372868 CAGGTAGGGGCGGCGGGCGGCGG - Intronic
1084385161 11:68839232-68839254 GTGGCAGCGGCGGCGGGAGGCGG - Intronic
1085561095 11:77473662-77473684 AGCGCGGCGGCGGCGGCAGGAGG - Exonic
1087097025 11:94328884-94328906 CAGGCAGCAGAGGCTGGAGGTGG + Intergenic
1088679393 11:112226364-112226386 TGCGCAGCCGCGGTGGGAGGAGG + Exonic
1089020153 11:115205466-115205488 CATGCTGGGGTGGCGGGAGGAGG - Intronic
1091381793 12:66743-66765 GACGCGGCGCCGGCGGGGGGAGG + Exonic
1091558684 12:1594462-1594484 GGAGCAGCGGCGGCGGCAGGAGG - Intronic
1091584723 12:1809680-1809702 CAGCCAGCGGGGGCGGGGGGAGG + Intronic
1092185998 12:6478673-6478695 CAGGCAGCGGCAGGGGGAAGTGG + Intergenic
1092256391 12:6928477-6928499 GAGGCGGCGGCGGCAGGAGGGGG - Intronic
1092764054 12:11836703-11836725 CACGCTGCAACGGAGGGAGGTGG - Intronic
1093921707 12:24866373-24866395 CCCACAGCGGTGGCGGGGGGCGG - Intronic
1094564965 12:31590965-31590987 CAGGCTGCGGCGGCGAGAGGCGG - Exonic
1096459549 12:51814617-51814639 CCGGCGGCGGCGGCGAGAGGCGG - Intergenic
1097046258 12:56189545-56189567 GCGGCCGCGGCGGCGGGAGGCGG - Exonic
1097058733 12:56266991-56267013 AGCGCAGGGGCGACGGGAGGCGG - Exonic
1097218333 12:57431012-57431034 CGCGCAGCCGCAGCGGGGGGCGG - Intergenic
1098029055 12:66235420-66235442 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
1101409507 12:104457111-104457133 CAGGCAGCGGCGGCCGCCGGCGG + Exonic
1103925060 12:124419027-124419049 CACACAGAGGAGGCGGGTGGAGG - Intronic
1103954268 12:124567623-124567645 GCGGCGGCGGCGGCGGGAGGGGG + Intergenic
1103967936 12:124652126-124652148 CAGGCAGCTGCAGCGGGGGGTGG - Intergenic
1103983175 12:124750031-124750053 CAGGCAGCGGGGCGGGGAGGGGG + Intergenic
1104031671 12:125069336-125069358 CACGGAGAGGCGGCCGGAGTGGG - Intronic
1104952071 12:132445621-132445643 CAGGAGGCGGCGGAGGGAGGTGG - Intergenic
1104986508 12:132600552-132600574 CAGGCAGCGGCCGGGAGAGGGGG + Intergenic
1104987098 12:132603448-132603470 CTCGAAGCGGCCGCGGAAGGAGG + Intronic
1110436531 13:75482365-75482387 GCTGCAGCTGCGGCGGGAGGAGG - Intergenic
1112356421 13:98677805-98677827 CTCGCAGCAGCTGCTGGAGGTGG + Intergenic
1113105957 13:106771814-106771836 CACGCAACAGTGACGGGAGGAGG - Intergenic
1113517240 13:110913344-110913366 CACGCAGAAGCGCAGGGAGGAGG + Intronic
1113627592 13:111858081-111858103 CACACAGGGACGGCGGGTGGAGG - Intergenic
1114525877 14:23366492-23366514 CATGCAGCGGAGTCCGGAGGAGG - Intergenic
1115502277 14:34060373-34060395 CACGTACCGGCCCCGGGAGGGGG + Intronic
1118186455 14:63542846-63542868 GCCGCAGCGGGGGCGGGCGGCGG + Exonic
1118849312 14:69572329-69572351 CGAGGAGCGGCGGCGGGAGCTGG - Exonic
1119410339 14:74426242-74426264 GAGGCGGCGGCGGCGGGAGGCGG - Intergenic
1120809859 14:88792536-88792558 CCCGCGGCGGCGACGGGAGGCGG + Exonic
1121050451 14:90816362-90816384 CCCGCGGCGGCGGCGGGAGGCGG - Exonic
1121437338 14:93928368-93928390 CACGGAGCGGCGGCAGGGTGCGG - Exonic
1121616849 14:95319414-95319436 CTCGCAGCGGTGACTGGAGGGGG + Intronic
1122204251 14:100140756-100140778 GAAGCAGCAGCGGCGGCAGGAGG - Intronic
1122523534 14:102363376-102363398 CGCGCAGCGGAGGCCTGAGGAGG - Intronic
1122609801 14:102974063-102974085 CACGCAGCGGCTGCGGGGGCTGG - Exonic
1123024956 14:105420108-105420130 GCGGCAGCGGCGGCGGGTGGGGG - Intronic
1123219840 14:106844948-106844970 GAGGCTGCGGCGGCGAGAGGGGG - Intergenic
1123964045 15:25438368-25438390 CTCGCCTCGGCGGCGGGGGGCGG + Intronic
1124222585 15:27863167-27863189 CACAGAGCAGCGGTGGGAGGAGG + Intronic
1125535760 15:40440735-40440757 CACGAGGCGGCCGGGGGAGGCGG - Intronic
1125834263 15:42736502-42736524 CCCGCCGCGGGGGCAGGAGGCGG - Exonic
1125852816 15:42920718-42920740 GAGGCGGCGGCGGCGGCAGGAGG - Intronic
1126183649 15:45810267-45810289 CATGCTGCGGCCGCTGGAGGTGG - Intergenic
1128067861 15:64775608-64775630 GCGGCAGCGGCGGCGGGGGGCGG + Intergenic
1128078251 15:64841666-64841688 CCCGCATCGGCGGAGGGAGAGGG - Intergenic
1128374792 15:67066741-67066763 CGGGCCGCGGGGGCGGGAGGCGG - Intronic
1128529158 15:68432094-68432116 TGTGCAGCGGCGGCGGGGGGCGG + Exonic
1128547730 15:68579181-68579203 CCCGGGGCGGCGGCGGAAGGGGG - Exonic
1129016566 15:72474237-72474259 CACGCAGGGGCGGTGGGGCGGGG + Intergenic
1129144330 15:73633359-73633381 GGCGCTGCGGCGGCAGGAGGAGG - Exonic
1129263534 15:74382132-74382154 CAGCCTGTGGCGGCGGGAGGGGG + Intergenic
1129697631 15:77749625-77749647 CACGCAGCAGCCGTGGGAGTGGG - Intronic
1131060301 15:89400181-89400203 GGCGCCGCGCCGGCGGGAGGAGG - Intergenic
1131256994 15:90869660-90869682 CAGGCAGAGGCGGTGGGAAGTGG - Intronic
1131367627 15:91853599-91853621 GAGGCAGCGGCGGCGGCGGGCGG + Intergenic
1131694098 15:94856489-94856511 GCAGCAGCGGCGGCGGGAGAAGG + Intergenic
1131827187 15:96331219-96331241 CACCCAGCGACTGCGGGCGGCGG + Exonic
1132018400 15:98339177-98339199 CAGGCAGGGGCAGCAGGAGGTGG + Intergenic
1132055837 15:98649688-98649710 CCCGCAGTGGCCGCGGGCGGCGG - Intronic
1132079580 15:98852715-98852737 ACTGCAGCGACGGCGGGAGGCGG - Intronic
1132365153 15:101251654-101251676 CAGGCCGCGGCGGCGGGGGCGGG - Exonic
1132575128 16:660621-660643 CACCCACCGCTGGCGGGAGGCGG - Exonic
1132575423 16:661661-661683 CATGCACCGGCTCCGGGAGGCGG - Exonic
1133033720 16:3023478-3023500 CACCAAGCGGCGCCTGGAGGAGG - Exonic
1133333696 16:4992166-4992188 CACTCAGTGGAGGCAGGAGGCGG - Intronic
1133784423 16:8963592-8963614 CCGGCCCCGGCGGCGGGAGGCGG - Intronic
1134025151 16:10947512-10947534 CGGGCAGCAGGGGCGGGAGGCGG + Intronic
1134057987 16:11182264-11182286 CAAGCAGCTGCGCCGGGATGAGG - Intergenic
1136414745 16:30096230-30096252 GCCGCCGCTGCGGCGGGAGGGGG + Intronic
1136768590 16:32812003-32812025 AAAGCCGCGGCGGCGGGGGGGGG + Intergenic
1137617357 16:49855820-49855842 CCCGGAGCGGCGGGGGGCGGCGG - Intronic
1140054750 16:71516170-71516192 CCCGCTGCGGCGCCAGGAGGGGG - Intronic
1140223193 16:73058448-73058470 CGGGCGGTGGCGGCGGGAGGAGG + Intronic
1141054639 16:80804080-80804102 CGGGCGGCGGCGGCGGGCGGCGG - Intronic
1141631690 16:85291470-85291492 CACGCGGGGGCCGGGGGAGGAGG - Intergenic
1141669749 16:85485553-85485575 AACGCGGCGGCGGCGGCAGCCGG - Intergenic
1142047036 16:87932192-87932214 GAGGCAGCGGCCGTGGGAGGGGG - Intronic
1142240185 16:88941396-88941418 GGCGCAGCGGCGGCGGCGGGGGG - Intronic
1142263344 16:89052527-89052549 CTGGCAGCCGTGGCGGGAGGCGG - Intergenic
1203015215 16_KI270728v1_random:350877-350899 AAAGCCGCGGCGGCGGGTGGGGG - Intergenic
1203033550 16_KI270728v1_random:624035-624057 AAAGCCGCGGCGGCGGGTGGGGG - Intergenic
1203071016 16_KI270728v1_random:1074138-1074160 AAAGCCGCGGCGGCGGGGGGGGG + Intergenic
1142560216 17:805182-805204 CACGCGGCAGGGGCGGGTGGAGG - Exonic
1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG + Intronic
1142611167 17:1109713-1109735 CCTCCAGCGGCGGCGGGACGCGG - Intronic
1142855138 17:2724905-2724927 CGCGGAGCTGCGGCGGGAGGTGG - Intergenic
1143036880 17:4004398-4004420 CACGGCGGGGCGGAGGGAGGAGG + Intergenic
1143587050 17:7855557-7855579 CAGGCAGAGGCGGCGGTAGCTGG - Exonic
1143672630 17:8406930-8406952 CGCACATCTGCGGCGGGAGGAGG - Intergenic
1143962124 17:10729755-10729777 CAGGCGGCCGCGGTGGGAGGGGG - Intronic
1145912878 17:28552580-28552602 CAGGCAGCGGCGGCAGCAGCAGG - Exonic
1146398656 17:32487294-32487316 ACCGCAGCGGCGGCGGCGGGCGG + Intronic
1147315444 17:39617997-39618019 CCGGCCGCGGCGGCGGGAAGGGG + Intergenic
1147315479 17:39618147-39618169 CACGCGGCGGGGGCGGGGCGGGG + Intergenic
1147386361 17:40084662-40084684 CCGGGAGCGGCGGCGGAAGGAGG + Exonic
1148051153 17:44770491-44770513 CAGGCAGTGGGGGCGGGGGGGGG - Intronic
1148150773 17:45395548-45395570 CACGCTGCTGCGGCCCGAGGTGG - Exonic
1148782709 17:50130481-50130503 CAGGCGGCCGCGGCGGGAGCTGG + Intergenic
1149296229 17:55264867-55264889 CACGCGGCGGCGGGGCGAGCGGG + Intergenic
1150388903 17:64779933-64779955 CACCCAGCCGGGGCGGGAGCGGG - Intergenic
1151472402 17:74326406-74326428 CACGGAGCGGGGTGGGGAGGAGG - Intronic
1151876399 17:76869933-76869955 CCCGCAGCGGGGTGGGGAGGGGG + Intronic
1152419432 17:80184207-80184229 CAGGCTGCGGCAGCGTGAGGCGG - Exonic
1152719775 17:81917829-81917851 CCTGAAGCGGCGGCAGGAGGAGG - Exonic
1152781462 17:82228949-82228971 CGCGCAGGGGCGGCGCCAGGCGG + Intronic
1152781487 17:82229050-82229072 CGGGCAGAGGCGGCGAGAGGCGG + Intronic
1153448262 18:5197261-5197283 GCCACAGCGGCGGCGGGAGGAGG + Intronic
1155654473 18:28177636-28177658 CACGCAGCGGAGGCGCGGAGTGG - Intergenic
1155910357 18:31498216-31498238 AGCGGTGCGGCGGCGGGAGGCGG + Exonic
1155928708 18:31684750-31684772 CGCCAAGCAGCGGCGGGAGGAGG + Intronic
1156014572 18:32533384-32533406 CGGGCAGGGGCGGGGGGAGGGGG + Intergenic
1157610365 18:48951703-48951725 GACCCAGCTGCGGCGGCAGGAGG + Intergenic
1158505603 18:58044187-58044209 CTCGCGGCGCCGGTGGGAGGAGG + Intergenic
1160499846 18:79396201-79396223 CGCGCGGCGGCGGCGGGGAGTGG - Intronic
1160825414 19:1078009-1078031 CAAGCGGCGGCGGCTGGAGGAGG + Exonic
1160882051 19:1325360-1325382 CGCGCCGCGGCGGGGGGCGGCGG + Intergenic
1160909235 19:1467249-1467271 AGGGCACCGGCGGCGGGAGGAGG + Exonic
1161076559 19:2288602-2288624 CACGTGGCAGCGGAGGGAGGCGG + Intronic
1161082050 19:2316180-2316202 CACGCAGTGGCGGTGGGGGGCGG + Intronic
1161327830 19:3671956-3671978 CGCGCTGCGGAGCCGGGAGGTGG + Intronic
1161494601 19:4580518-4580540 CAATCAGCGCCCGCGGGAGGGGG + Intergenic
1161592245 19:5134097-5134119 CAGGCAGGGGCGGTGGGAGAGGG + Intronic
1162524213 19:11197842-11197864 AACGGCTCGGCGGCGGGAGGGGG + Intergenic
1162751776 19:12833905-12833927 GAGGTAGCGGCGGCGGGAGGAGG - Intronic
1162937806 19:13990260-13990282 CACGGAGGGGCTGCGGGCGGTGG + Intronic
1163035142 19:14565522-14565544 AAAGCAGGGGCGGCGGGAGGTGG + Intronic
1163085934 19:14979740-14979762 CACCGAGCGGCCGGGGGAGGGGG + Intronic
1164617224 19:29674475-29674497 CGCCCAGCAGCGGCAGGAGGAGG + Exonic
1165157749 19:33798072-33798094 TCCGCGGCGGAGGCGGGAGGGGG + Intronic
1165242936 19:34481915-34481937 GCCGGAGCGGCGGCGGGAAGCGG + Exonic
1165453815 19:35899753-35899775 CGCGGGGCGGGGGCGGGAGGAGG + Intronic
1166635595 19:44448600-44448622 CACTGCGAGGCGGCGGGAGGCGG + Intergenic
1166765660 19:45251291-45251313 CAAGCGGCGGCGGAGGGAGGCGG - Exonic
1167019069 19:46861012-46861034 CGCGGCGCGGCGGCAGGAGGAGG + Intergenic
1167158794 19:47754855-47754877 GCAGCAGCGGCGGCGGGAGAAGG + Exonic
1202683500 1_KI270712v1_random:30084-30106 ACCGCGGCGGCGGCGGGTGGGGG - Intergenic
925070547 2:964342-964364 CACGAAGGGGCGGAGGCAGGCGG - Intronic
925379879 2:3417327-3417349 CAGGCAGCGGGGGCGGTGGGGGG - Intronic
926053194 2:9757656-9757678 CACGCAGGGCTGGCTGGAGGGGG + Intergenic
926126922 2:10277647-10277669 CAGGCAGAGGCAGAGGGAGGAGG + Intergenic
928093929 2:28392739-28392761 CACGAGGAGGCGGGGGGAGGAGG - Intronic
928313807 2:30231390-30231412 CTCGCAGCTCCGGCGGGCGGCGG - Intergenic
929548719 2:42875385-42875407 CACAAAGCGGCGCCGGGAGGAGG - Intergenic
929961546 2:46500225-46500247 GACCCAGCGGCGGCGGGAGGAGG - Intronic
930089539 2:47521603-47521625 CGCGGAGCCGCGGCGGAAGGTGG + Exonic
931748875 2:65313851-65313873 CAAGTCGCGGCGGCGGAAGGAGG - Exonic
932385853 2:71332012-71332034 CAGACGGCGGGGGCGGGAGGAGG + Intronic
932728418 2:74199256-74199278 CTCCCACCGGCGGAGGGAGGAGG - Intronic
934304215 2:91809036-91809058 GCCGCAGCGGCGGGGGGGGGGGG - Intergenic
934329040 2:92043714-92043736 GCCGCAGCGGCGGGGGGGGGGGG + Intergenic
937296864 2:120814785-120814807 AATGCAGCGGGGGCGGGGGGTGG - Intronic
940848011 2:158661900-158661922 CAGGCAGCAGCAGCAGGAGGGGG - Intronic
941020971 2:160407661-160407683 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
941819181 2:169827724-169827746 GACGCGGCGGCGGCCGGAGGCGG + Exonic
943333845 2:186590277-186590299 CTCGCTGGGGCGGGGGGAGGTGG + Exonic
943460465 2:188166161-188166183 CAGGCAGGGGTGGGGGGAGGGGG + Intergenic
946327903 2:218994048-218994070 CACGCGGCGGCGCCGGGCGCTGG + Intergenic
946340028 2:219060750-219060772 AACGCGGCGGCGGCGGGGGGCGG + Intergenic
946966392 2:225042104-225042126 CCCGCAGAGGCGGCGGGGGAGGG + Intronic
947815205 2:233032135-233032157 CACGCAGCAGCGGGGGCAGACGG + Intergenic
948115809 2:235493942-235493964 GACGCAGCGCCGGCGGCCGGAGG + Intergenic
948876515 2:240832524-240832546 AACCCGGCGGCGGAGGGAGGAGG - Intergenic
1168804454 20:664222-664244 CTCGCGGCGGCGGCGGGGCGGGG - Exonic
1169244610 20:4015622-4015644 CATGCAGCGGGGGCGGGGTGAGG + Intergenic
1170630018 20:18057760-18057782 CGCGCCGCGGCGGGGGGTGGAGG - Exonic
1172277244 20:33686354-33686376 CAGGCAGCGGCGGCCGGGGGCGG - Exonic
1172358884 20:34298592-34298614 GAAGTGGCGGCGGCGGGAGGGGG + Intronic
1173251664 20:41366844-41366866 CGCGGAGGGGAGGCGGGAGGCGG + Intergenic
1173939066 20:46894759-46894781 CACGCAGCGGCGCGGGGACCCGG + Exonic
1174386538 20:50191069-50191091 CAGGCGGCGGCGGCGGCAGGGGG - Exonic
1175519181 20:59588707-59588729 CAGGGAGCGGGGGTGGGAGGTGG - Intronic
1175878784 20:62244362-62244384 TACACAGCGGCGGCGGGTCGGGG + Intronic
1176063504 20:63182481-63182503 CAAGGAGGGGCGGGGGGAGGGGG - Intergenic
1176283411 20:64328090-64328112 GACGCGGCGCCGGCGGGGGGAGG - Intergenic
1176548779 21:8212877-8212899 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1176550166 21:8217361-8217383 CGCGCGGCGGCGGCGGCGGGCGG + Intergenic
1176556674 21:8257086-8257108 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1176567710 21:8395912-8395934 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1176575613 21:8440128-8440150 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1176577008 21:8444631-8444653 CGCGCGGCGGCGGCGGCGGGCGG + Intergenic
1179825559 21:43963819-43963841 CAGGCAGCAGTGGCGGGAGAAGG + Intronic
1180653790 22:17401829-17401851 AAGGCAGCGGGGGCGGGGGGGGG - Intronic
1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG + Exonic
1180742813 22:18065491-18065513 CAGGCAGAGGCGGGGGCAGGAGG + Intergenic
1181085123 22:20436387-20436409 AATGCAGCGGCGGCGGCGGGCGG - Intronic
1182000076 22:26913109-26913131 AGGGCAGAGGCGGCGGGAGGCGG + Intergenic
1182620588 22:31616477-31616499 CAGGCAGTGGAGGCGTGAGGCGG + Intronic
1183192087 22:36328042-36328064 CACGCTGCGGAGGAGGGAGCTGG - Intronic
1184489571 22:44801022-44801044 CACACAGCTGCGGGGAGAGGCGG - Intronic
1184681342 22:46073819-46073841 CAGCCAGCCGCGGCCGGAGGTGG + Intronic
1185078252 22:48694807-48694829 GTCGGAGCGGCGGCGGGTGGGGG - Intronic
1185259340 22:49853272-49853294 CAAGCCGGGTCGGCGGGAGGAGG - Intergenic
1185383442 22:50520988-50521010 CATGCTGCGGGAGCGGGAGGGGG + Exonic
1203253664 22_KI270733v1_random:129182-129204 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1203261720 22_KI270733v1_random:174261-174283 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
950729763 3:14947537-14947559 CTCGCCGCCGCGGCGGGGGGCGG - Intergenic
953844231 3:46414660-46414682 CACACACCGGGGGCGGGGGGAGG - Intergenic
953912189 3:46898831-46898853 CCGGCAGCGGCGGTGGCAGGCGG - Exonic
955916485 3:63912641-63912663 CGCGCGGCGGCGGCGGCGGGCGG + Exonic
956459296 3:69454839-69454861 CACGCAGGGGCCACGGGCGGAGG - Intronic
956468633 3:69542621-69542643 CCCGGAGAGGCGGCGGGCGGGGG - Intergenic
961482602 3:127193570-127193592 CTCGCAGCTGCAGCGGGTGGAGG - Intronic
961949024 3:130727341-130727363 TACTCGGAGGCGGCGGGAGGGGG - Intronic
964491795 3:157243931-157243953 CACTCAGGGGCTGAGGGAGGAGG + Intergenic
964771115 3:160225430-160225452 CGCGCGGAGGCTGCGGGAGGCGG - Intergenic
965404105 3:168249462-168249484 CACCCAGCCGCGGCGGGGGCTGG - Intergenic
966852351 3:184171800-184171822 CAGCCTGCGGCGGGGGGAGGGGG + Exonic
968434118 4:576226-576248 GCGGCGGCGGCGGCGGGAGGCGG - Intergenic
968583700 4:1406339-1406361 TGGGCAGCGGCGGCGGGAGCGGG + Intergenic
968636646 4:1684372-1684394 CTCGCGGCGGCGGCGGGGCGCGG - Intergenic
968654714 4:1773512-1773534 CGGGCAGCGGGGGTGGGAGGTGG - Intergenic
968671754 4:1855884-1855906 ACCGAGGCGGCGGCGGGAGGCGG + Exonic
968795301 4:2699742-2699764 GGAGCAGAGGCGGCGGGAGGAGG + Exonic
968965276 4:3766332-3766354 GACGCGGCTGCGGGGGGAGGGGG - Intronic
969495661 4:7524783-7524805 CAAGCAGTGGCGGCGGGGTGGGG - Intronic
975683378 4:76897468-76897490 CAGGCGGCGGCGGCGCGAGAAGG - Exonic
977607199 4:98995497-98995519 CAGGCACCGCCGGCGGGGGGCGG + Intergenic
981835947 4:149053538-149053560 CACGCAGTGGCTGAGGAAGGTGG - Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
983792235 4:171813043-171813065 GGCGCGGCGGCTGCGGGAGGTGG - Intronic
985472249 5:53534-53556 GCGGCATCGGCGGCGGGAGGAGG + Intergenic
988564700 5:32312248-32312270 CCCGCAGCGCTGACGGGAGGCGG + Intronic
991291242 5:65035551-65035573 AACCTAGTGGCGGCGGGAGGCGG + Intergenic
992550151 5:77852022-77852044 CCCGCGGCGGCGGCGCGAGGAGG - Intronic
992950367 5:81852011-81852033 GCGGCAGCCGCGGCGGGAGGCGG - Intergenic
995438223 5:112160948-112160970 CACGCAGGGGCGCCGGGCGGGGG + Intronic
996184965 5:120464223-120464245 CGCCGGGCGGCGGCGGGAGGAGG + Intergenic
996442923 5:123512317-123512339 CGGCCAGCGGCGGCGGTAGGAGG + Intronic
996442946 5:123512452-123512474 CACCCGCCGGCGGCCGGAGGAGG - Intronic
997201335 5:132011699-132011721 TCCGCAGCGGCGCGGGGAGGCGG - Intronic
997582666 5:135027446-135027468 CCCGCAGCCGCGGAGGGAGGGGG + Intergenic
1001305471 5:170569289-170569311 CACACAGCAGCGGGGGGTGGGGG - Intronic
1002193911 5:177492157-177492179 CACGCAGCGCCGGCGGCGGGAGG + Intronic
1002450355 5:179315074-179315096 CATGCAGGGGCAGGGGGAGGAGG - Intronic
1004924424 6:20403565-20403587 GAGGAGGCGGCGGCGGGAGGGGG + Intronic
1006180712 6:32151941-32151963 AAGGCAGCGGCGGGGGGGGGGGG + Exonic
1006333984 6:33411019-33411041 AAAGCAGCGGCAGCGGCAGGAGG - Exonic
1006396181 6:33788957-33788979 CGAGGAGCGGCTGCGGGAGGAGG - Exonic
1007038842 6:38702878-38702900 CCTGCAGCGGCGGCGGGATGGGG + Intronic
1007435338 6:41806455-41806477 GGAGCAGCGGCGGCAGGAGGAGG - Exonic
1007644528 6:43369775-43369797 CACGTGGCGGCCGCGGGAGGGGG - Intergenic
1009321800 6:62300148-62300170 TATCCAGCGGCGGAGGGAGGTGG + Intergenic
1010083147 6:71886903-71886925 CTAGCGGCGGCGGCAGGAGGAGG - Intronic
1010249851 6:73696238-73696260 CACGCAGAGGAGGTGGGCGGCGG - Exonic
1012237673 6:96837445-96837467 CAGGCGGCGGTGGCGGGAGCTGG + Exonic
1015149343 6:130020220-130020242 CGCGCCGCGGCGGCGGGGCGGGG + Intronic
1015905005 6:138107596-138107618 CACCGGGCGGCGGCGGAAGGCGG + Intergenic
1016599608 6:145843031-145843053 CAGGCAGGGGCAGCGGGAGGAGG - Intergenic
1017778739 6:157699948-157699970 CAGGCAGCGGCAGCGGGCTGAGG + Intergenic
1017877668 6:158537280-158537302 CGCGCTGCGGCGTCGGGAGGAGG + Intronic
1018613070 6:165662236-165662258 GTGGCAGCGGCGGCGGGCGGCGG - Intronic
1018613096 6:165662342-165662364 GCGGCGGCGGCGGCGGGAGGAGG - Intronic
1019360541 7:602273-602295 CAGACGGCGGCGGGGGGAGGGGG + Intronic
1019536405 7:1531610-1531632 CACGCAGTGGGAGCGGGAAGAGG - Intronic
1019967048 7:4507916-4507938 CACACAGCGGCGCCTGTAGGGGG - Intergenic
1022207638 7:28179859-28179881 GCGGCGGCGGCGGCGGGAGGAGG + Intronic
1022230800 7:28410264-28410286 AAAGCAGCGGAGGCAGGAGGCGG - Intronic
1022310791 7:29194478-29194500 CGGGCAGAGGCGGCGGGAGACGG - Exonic
1022721205 7:32943080-32943102 CGCGGGGCGGCGGCGGGAAGGGG - Intergenic
1022739736 7:33109491-33109513 TGCGGGGCGGCGGCGGGAGGGGG - Intergenic
1023435266 7:40135073-40135095 CCGGCCGGGGCGGCGGGAGGGGG + Exonic
1024317471 7:48035292-48035314 GACGCAGCGGGGGTGGGAGCAGG - Intergenic
1024580020 7:50793568-50793590 CGGGCGGCGGCGGCGGGAGGAGG - Intergenic
1025069798 7:55887889-55887911 GCGGCGGCGGCGGCGGGAGGCGG + Intronic
1025561789 7:62379954-62379976 AAAGCCGCGGCGGCGGGTGGGGG - Intergenic
1025561870 7:62380259-62380281 AAAGCAGCGGCGGCGGCCGGGGG - Intergenic
1026822294 7:73557654-73557676 GACGCTGCGGCGGCGGCGGGCGG - Exonic
1027042490 7:74970031-74970053 CACGCAGCGGAGACGGGACCTGG - Intronic
1027345519 7:77255602-77255624 CACCCAGCAGTGGTGGGAGGAGG + Intronic
1029272232 7:99384159-99384181 CACTCAGCGGCAGGTGGAGGAGG + Intronic
1032344453 7:131106220-131106242 CACGCAGCAGCCGGGGGCGGCGG - Intergenic
1032525801 7:132577441-132577463 GAGGGAGCGGCGGCGGGCGGCGG - Intronic
1034128998 7:148698824-148698846 CAGGCGGCGGCGGCGGGAGGAGG + Intronic
1034342736 7:150368724-150368746 CAGGCCGCGGCCGCGGGAGCCGG + Intronic
1034455499 7:151167812-151167834 GGCGCGGCGGCGGCGGGCGGAGG - Intronic
1034781776 7:153887891-153887913 CACCCAGCGGCAGGGGGATGCGG + Intronic
1036163068 8:6406830-6406852 CAGGCAGCGGGGGAGGAAGGAGG - Intronic
1037811366 8:22089110-22089132 CACGCAGCCGGGCCGGGAAGGGG + Intergenic
1037947740 8:22999755-22999777 CGCGCAGGGGCGCCGGGAGAGGG - Intronic
1038408073 8:27336977-27336999 CTGGCAGTGGCGGGGGGAGGGGG - Intronic
1038883653 8:31640248-31640270 CCCGCAGCGGCGGCAGCAGGGGG + Intronic
1039448105 8:37648617-37648639 CACGGAGCTGCTGTGGGAGGTGG + Intergenic
1040466193 8:47697574-47697596 CACGCAGCTGCTCCTGGAGGCGG - Intronic
1041280930 8:56211006-56211028 GGAGCAGCGGCGGCGGCAGGAGG - Intronic
1045674082 8:104589021-104589043 CTCTCCGCGGCTGCGGGAGGGGG + Intronic
1049473821 8:142787848-142787870 CACGTGGCAGCGGCGGCAGGAGG - Intergenic
1049654154 8:143790401-143790423 CGTGCAGCGGCAGCTGGAGGCGG + Intergenic
1049682148 8:143924156-143924178 GAGGCAGCGGCGGCAGGTGGAGG - Exonic
1049746830 8:144266545-144266567 CCCGCGGCGGCCGCAGGAGGCGG + Exonic
1049762173 8:144336606-144336628 TCCGCCGCGGCGGCGGGGGGGGG - Intergenic
1052862880 9:33447558-33447580 CGGGCAGGGGTGGCGGGAGGCGG + Exonic
1053124600 9:35569851-35569873 CAGGCAGCTGGGGAGGGAGGAGG + Intergenic
1053943633 9:43280328-43280350 AAAGCCACGGCGGCGGGAGGGGG + Intergenic
1054407191 9:64773277-64773299 AAAGCCGCGGCGGCGGGGGGTGG + Intergenic
1054407535 9:64774432-64774454 AAAGCCGCGGCGGCGGGGGGGGG + Intergenic
1054440858 9:65258895-65258917 GCCGCGGCGGCGGCGGGGGGGGG + Intergenic
1054489419 9:65762592-65762614 GCCGCGGCGGCGGCGGGGGGGGG - Intergenic
1056154047 9:83817552-83817574 GAGGCGGCGGCGGGGGGAGGAGG - Exonic
1056356450 9:85805541-85805563 GAGGCGGCGGCGGGGGGAGGAGG + Intergenic
1058439203 9:104991735-104991757 CTCCCAGCCGCGGCGGGCGGCGG + Intergenic
1061234505 9:129334635-129334657 CACTCAGCTGCAGAGGGAGGTGG + Intergenic
1061365890 9:130172350-130172372 AGCGCAGGGGCGGCGGCAGGCGG + Intergenic
1061727452 9:132589543-132589565 CACGCCGAGCCCGCGGGAGGAGG - Exonic
1061943180 9:133893841-133893863 CACACAGCAGCGGCGAGAGTCGG + Intronic
1062338633 9:136083665-136083687 CACGCTGCGGAGGCAGGCGGGGG + Intronic
1062472533 9:136712749-136712771 CAGGCAGAGGCGGCCGGGGGCGG - Intronic
1062665720 9:137670438-137670460 CACCCAGCACCGGGGGGAGGGGG - Intronic
1202779998 9_KI270717v1_random:24911-24933 GCCGCGGCGGCGGCGGGTGGCGG + Intergenic
1203470064 Un_GL000220v1:112330-112352 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1203477885 Un_GL000220v1:156302-156324 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1203586751 Un_KI270747v1:10231-10253 AAAGCCACGGCGGCGGGAGGGGG + Intergenic
1190285222 X:48957197-48957219 GGCGCAGCGGCGGCGGGTGTGGG - Exonic
1190726396 X:53193260-53193282 GAGGCGGCGGCGGCGGAAGGTGG - Exonic
1196808030 X:119605918-119605940 GCAGCGGCGGCGGCGGGAGGGGG + Intergenic
1197815644 X:130495140-130495162 CGCGCCGCGGCGGCGGAAGATGG + Intergenic
1200061731 X:153486780-153486802 GCCCCAGCGGCGGGGGGAGGAGG + Exonic
1200155425 X:153972394-153972416 CACCCAGCAGCCGCAGGAGGCGG + Exonic
1200173701 X:154097449-154097471 CCACCGGCGGCGGCGGGAGGGGG + Intronic