ID: 1142611679

View in Genome Browser
Species Human (GRCh38)
Location 17:1111875-1111897
Sequence CTCACTTGGAAGCCCAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 74, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142611673_1142611679 -5 Left 1142611673 17:1111857-1111879 CCCCGGCCACTGGGTCTCCTCAC 0: 1
1: 0
2: 0
3: 13
4: 181
Right 1142611679 17:1111875-1111897 CTCACTTGGAAGCCCAGCCACGG 0: 1
1: 0
2: 1
3: 74
4: 208
1142611674_1142611679 -6 Left 1142611674 17:1111858-1111880 CCCGGCCACTGGGTCTCCTCACT 0: 1
1: 0
2: 2
3: 19
4: 253
Right 1142611679 17:1111875-1111897 CTCACTTGGAAGCCCAGCCACGG 0: 1
1: 0
2: 1
3: 74
4: 208
1142611667_1142611679 30 Left 1142611667 17:1111822-1111844 CCTGGTGTCTTGCTGGGCTCTAG 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1142611679 17:1111875-1111897 CTCACTTGGAAGCCCAGCCACGG 0: 1
1: 0
2: 1
3: 74
4: 208
1142611675_1142611679 -7 Left 1142611675 17:1111859-1111881 CCGGCCACTGGGTCTCCTCACTT 0: 1
1: 0
2: 3
3: 622
4: 4482
Right 1142611679 17:1111875-1111897 CTCACTTGGAAGCCCAGCCACGG 0: 1
1: 0
2: 1
3: 74
4: 208
1142611672_1142611679 -1 Left 1142611672 17:1111853-1111875 CCTGCCCCGGCCACTGGGTCTCC 0: 1
1: 0
2: 5
3: 43
4: 426
Right 1142611679 17:1111875-1111897 CTCACTTGGAAGCCCAGCCACGG 0: 1
1: 0
2: 1
3: 74
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142611679 Original CRISPR CTCACTTGGAAGCCCAGCCA CGG Intronic
900112553 1:1014647-1014669 TTCACTTGGCAGCCCAGGCCTGG - Intergenic
902459966 1:16567008-16567030 TCCACTTGGAAGCCCAGGCAAGG - Intronic
904358452 1:29956846-29956868 CTCACTTGGACCTCCAGTCATGG + Intergenic
904988457 1:34572454-34572476 CTTACTAGGAAGCCAAGGCAGGG + Intergenic
905787842 1:40772069-40772091 CTCACTTTTAAGACCAGCCGAGG - Intergenic
905893874 1:41533041-41533063 CTCTCTGGGATGTCCAGCCATGG - Intronic
906052513 1:42887048-42887070 CTCACGTGGGAGGCCAGCCAAGG + Intergenic
910271334 1:85398164-85398186 ATCACTAGGAAGCCAAACCAAGG - Intronic
911403784 1:97409948-97409970 CTCACCTGTAATCCCAGCTAAGG + Intronic
913329739 1:117657291-117657313 CTCACTTGGATTCCCAGTCAGGG - Intergenic
913605443 1:120461575-120461597 TCCACTTGGAAGCCCAGACAAGG + Intergenic
913642309 1:120824295-120824317 TCCACTTGGAAGCCCAGACAAGG + Intronic
913642488 1:120825835-120825857 TCCACTTGGAAGCCCAGACAAGG + Intronic
913642668 1:120827375-120827397 TCCACTTGGAAGCCCAGACAAGG + Intronic
913642784 1:120828422-120828444 TCCACTTGGAAGCCCAGACAAGG + Intronic
913643399 1:120833924-120833946 TCCACTTGGAAGCCCAGACAAGG + Intronic
913989559 1:143598182-143598204 TCTACTTGGAAGCCCAGACACGG - Intergenic
914083097 1:144427647-144427669 TCCACTTGGAAGCCCAGACAAGG - Intronic
914178021 1:145296167-145296189 TCCACTTGGAAGCCCAGACAAGG - Intronic
914178566 1:145300929-145300951 TCCACTTGGAAGCCCAGACAAGG - Intronic
914179863 1:145312037-145312059 TCCACTTGGAAGCCCAGACAAGG - Intronic
914180409 1:145316807-145316829 TCCACTTGGAAGCCCAGACAAGG - Intronic
914180952 1:145321569-145321591 TCCACTTGGAAGCCCAGACAAGG - Intronic
914181495 1:145326319-145326341 TCCACTTGGAAGCCCAGACAAGG - Intronic
914182040 1:145331086-145331108 TCCACTTGGAAGCCCAGACAAGG - Intronic
914182585 1:145335842-145335864 TCCACTTGGAAGCCCAGACAAGG - Intronic
914183130 1:145340596-145340618 TCCACTTGGAAGCCCAGACAAGG - Intronic
914183675 1:145345350-145345372 TCCACTTGGAAGCCCAGACAAGG - Intronic
914184218 1:145350120-145350142 TCCACTTGGAAGCCCAGACAAGG - Intronic
914184762 1:145354884-145354906 TCCACTTGGAAGCCCAGACAAGG - Intronic
914185307 1:145359631-145359653 TCCACTTGGAAGCCCAGACAAGG - Intronic
914185852 1:145364385-145364407 TCCACTTGGAAGCCCAGACAAGG - Intronic
914186399 1:145369145-145369167 TCCACTTGGAAGCCCAGACAAGG - Intronic
914186943 1:145373893-145373915 TCCACTTGGAAGCCCAGACAAGG - Intronic
914187486 1:145378643-145378665 TCCACTTGGAAGCCCAGACAAGG - Intronic
914188031 1:145383399-145383421 TCCACTTGGAAGCCCAGACAAGG - Intronic
914188574 1:145388147-145388169 TCCACTTGGAAGCCCAGACAAGG - Intronic
914189116 1:145392903-145392925 TCCACTTGGAAGCCCAGACAAGG - Intronic
914210970 1:145578612-145578634 TCCACTTGGAAGCCCAGACAAGG - Intergenic
914269730 1:146069372-146069394 TCCACTTGGAAGCCCAGACAAGG - Intronic
914270271 1:146074100-146074122 TCCACTTGGAAGCCCAGACAAGG - Intronic
914270808 1:146078836-146078858 TCCACTTGGAAGCCCAGACAAGG - Intronic
914271345 1:146083566-146083588 TCCACTTGGAAGCCCAGACAAGG - Intronic
914271880 1:146088293-146088315 TCCACTTGGAAGCCCAGACAAGG - Intronic
914272417 1:146093011-146093033 TCCACTTGGAAGCCCAGACAAGG - Intronic
914272955 1:146097733-146097755 TCCACTTGGAAGCCCAGACAAGG - Intronic
914273493 1:146102455-146102477 TCCACTTGGAAGCCCAGACAAGG - Intronic
914274032 1:146107173-146107195 TCCACTTGGAAGCCCAGACAAGG - Intronic
914274569 1:146111883-146111905 TCCACTTGGAAGCCCAGACAAGG - Intronic
914275102 1:146116601-146116623 TCCACTTGGAAGCCCAGACAAGG - Intronic
914275456 1:146119783-146119805 CTCAGTTGGAAGCCTAGACATGG - Intronic
914275639 1:146121327-146121349 TCCACTTGGAAGCCCAGACAAGG - Intronic
914276170 1:146126065-146126087 TCCACTTGGAAGCCCAGACAAGG - Intronic
914366651 1:146985134-146985156 TCCACTTGGAAGCCCAGACAAGG + Intronic
914367187 1:146989895-146989917 TCCACTTGGAAGCCCAGACAAGG + Intronic
914485795 1:148108311-148108333 TCCACTTGGAAGCCCAGACAAGG - Intronic
914532567 1:148536053-148536075 TCCACTTGGAAGCCCAGACAAGG - Intronic
914533103 1:148540779-148540801 TCCACTTGGAAGCCCAGACAAGG - Intronic
914533638 1:148545493-148545515 TCCACTTGGAAGCCCAGACAAGG - Intronic
914534174 1:148550201-148550223 TCCACTTGGAAGCCCAGACAAGG - Intronic
914534710 1:148554909-148554931 TCCACTTGGAAGCCCAGACAAGG - Intronic
914535246 1:148559622-148559644 TCCACTTGGAAGCCCAGACAAGG - Intronic
914535782 1:148564368-148564390 TCCACTTGGAAGCCCAGACAAGG - Intronic
914536317 1:148569084-148569106 TCCACTTGGAAGCCCAGACAAGG - Intronic
914537214 1:148577012-148577034 TCCACTTGGAAGCCCAGACAAGG - Intronic
914586129 1:149063462-149063484 TCCACTTGGAAGCCCAGACAAGG - Intronic
914628711 1:149488334-149488356 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914629244 1:149493089-149493111 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914629777 1:149497846-149497868 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914630312 1:149502607-149502629 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914630846 1:149507368-149507390 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914631377 1:149512129-149512151 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914631909 1:149516885-149516907 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914632445 1:149521640-149521662 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914632980 1:149526391-149526413 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914633515 1:149531120-149531142 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914634051 1:149535875-149535897 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914634584 1:149540622-149540644 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914635119 1:149545359-149545381 TCCACTTGGCAGCCCAGACAAGG + Intergenic
914635654 1:149550096-149550118 TCCACTTGGCAGCCCAGACAAGG + Intergenic
916808265 1:168281109-168281131 GGCACTCGGAAGCCCAGCGATGG + Exonic
919774234 1:201183828-201183850 GTCCTTGGGAAGCCCAGCCATGG - Intergenic
920190280 1:204189495-204189517 CTCAGATGGAAACCCTGCCATGG + Intergenic
920726393 1:208439239-208439261 CTCAGTTGGGAGCACAGTCACGG + Intergenic
921173156 1:212566753-212566775 CGCGCTGGGAAGCCCATCCAGGG + Intronic
921628303 1:217402785-217402807 TTCACTTGGCAGCCCAGGCAGGG - Intergenic
922729192 1:227941172-227941194 TTCACCTGGCAGCCCAGCCCCGG - Intronic
922917333 1:229269938-229269960 GTCACTTGGGAGCTTAGCCAAGG + Intergenic
923083538 1:230683449-230683471 CTCACTGGTAAGTCCAGCCTCGG - Intronic
924201323 1:241662316-241662338 CTCATTTGGAAGCTCTGCTAGGG + Intronic
924820242 1:247482457-247482479 CTCACTTGGTATGCCTGCCAGGG - Intergenic
1065587434 10:27233465-27233487 CACACCTGTAATCCCAGCCAAGG + Intronic
1065622794 10:27600296-27600318 CACACCTGTAATCCCAGCCAAGG - Intergenic
1070376800 10:75840207-75840229 TTCACTTGGAAGCACAGTCCAGG + Intronic
1070617496 10:77980063-77980085 TTCCCTTGGAAGCCTAGCCATGG + Intronic
1070640119 10:78162428-78162450 CTCACCTGGGAGCACAGACAAGG + Intergenic
1071280048 10:84093310-84093332 CTCACTGGGAGCCCCAGCTATGG + Intergenic
1071976574 10:90961964-90961986 CTCAATTCCAATCCCAGCCATGG + Intergenic
1072828965 10:98637846-98637868 CTTACTTGGAAGGCCAGGCACGG + Intronic
1073451444 10:103611826-103611848 ATCCCCTGGAAGCACAGCCAAGG - Intronic
1074822817 10:117194252-117194274 CTCACCTGGAAACCCAGCAAGGG + Intergenic
1076161970 10:128251363-128251385 CCCAGATGGAAGCCCAGGCAGGG - Intergenic
1076365491 10:129919010-129919032 CGCCCATGGAAGCCCAGCCTGGG + Intronic
1078762341 11:14261318-14261340 AGCTCTTGGAAGACCAGCCAAGG - Intronic
1079284572 11:19117259-19117281 CTCACCTGCGAGCCCAGCCCCGG - Exonic
1081388926 11:42505624-42505646 CTGACTTGGAAGGATAGCCATGG + Intergenic
1082815044 11:57502216-57502238 GTCACTTGGCAGCACTGCCAAGG + Intronic
1084403550 11:68958469-68958491 CCCACTTGGCAGGCCAGCCCTGG - Intergenic
1085798652 11:79566754-79566776 CTAGCTGGGAAGCACAGCCATGG - Intergenic
1088141138 11:106617906-106617928 CTCACTTAGAAGCACTCCCATGG + Intergenic
1088714535 11:112537312-112537334 CTCACTTAGAATCCCAGACTTGG - Intergenic
1090421773 11:126580322-126580344 CTCCCTGGCCAGCCCAGCCATGG - Intronic
1092180388 12:6442855-6442877 CTCCCCTGTAATCCCAGCCAAGG + Intergenic
1094332881 12:29315403-29315425 CTCATTTGGAGGCAAAGCCATGG - Intronic
1095407509 12:41883312-41883334 CTCCCTTGGAAGAACATCCAGGG - Intergenic
1095978281 12:47954703-47954725 CTCTCTTGGACACCCTGCCAAGG - Intergenic
1102480815 12:113221847-113221869 CTCACGTGGGCTCCCAGCCAGGG + Intronic
1104356165 12:128089066-128089088 CTAAAGTGGAAACCCAGCCAGGG + Intergenic
1104485118 12:129144577-129144599 GTCATTTGGAAGCCCAGCTAGGG - Intronic
1105686554 13:22788898-22788920 ATCGCTTTGAAGCCCAGGCAGGG - Intergenic
1110365028 13:74673354-74673376 CTCTCTTGAGATCCCAGCCAAGG + Intergenic
1110409195 13:75185192-75185214 GACACCTGGAAGCCCAGCCTGGG + Intergenic
1111660574 13:91205108-91205130 CTCACTTCGAAGAGAAGCCATGG + Intergenic
1113837660 13:113338784-113338806 CTCACCAGGGAGCTCAGCCATGG + Intronic
1113921396 13:113914978-113915000 CACACTTGGAAGCACAGCTCGGG + Intergenic
1114980442 14:28157743-28157765 CCCATTGGGAAGCCCAGCCTAGG - Intergenic
1115315375 14:32019799-32019821 CTCTCAAGGAAGCCCTGCCAGGG + Intergenic
1115749828 14:36477931-36477953 CTCATTTGGAGGTCCATCCATGG + Intronic
1116353433 14:43896328-43896350 CTCACTCAGTATCCCAGCCATGG - Intergenic
1118343309 14:64914589-64914611 CTCTCTGGGAAGGCCAGCCTTGG - Intronic
1118534842 14:66750335-66750357 CAAAATTGGAATCCCAGCCAAGG - Intronic
1121556563 14:94842199-94842221 AACTCTTGGAAGCCCAGTCAAGG - Intergenic
1122618717 14:103040487-103040509 CTCACTCTGAAGCCCAGGCTGGG + Intronic
1123127023 14:105954037-105954059 CAGCCTTGGAAGCCCAACCAGGG + Intergenic
1123407482 15:20029857-20029879 CAGCCTTGGAAGCCCAACCAGGG + Intergenic
1123516810 15:21036513-21036535 CAGCCTTGGAAGCCCAACCAGGG + Intergenic
1124140606 15:27073796-27073818 TTCAGATGGAAACCCAGCCAGGG - Intronic
1124177125 15:27436743-27436765 CATGCTGGGAAGCCCAGCCATGG - Intronic
1126730128 15:51674056-51674078 CTCACTTGAGAGCCCAGCTTTGG + Intergenic
1128216074 15:65935018-65935040 ATCAATTAGAAGCACAGCCAAGG + Intronic
1128737237 15:70060120-70060142 CTCACTTGGCCACCCAGTCATGG - Intronic
1128788422 15:70415187-70415209 TTCACTTGCAAGGCCAGGCAAGG - Intergenic
1130389916 15:83446594-83446616 CTCACAGCTAAGCCCAGCCAGGG - Intergenic
1131827998 15:96334980-96335002 ATCTCCTGGAGGCCCAGCCAGGG - Intronic
1132860337 16:2067944-2067966 CTTACTTGGAACTCCAGCCCTGG + Intronic
1133232637 16:4373712-4373734 CCCACTTATAAGCCCAGGCAAGG - Intronic
1133399715 16:5476529-5476551 CTCAATTTGAAGCTCAGCCCTGG + Intergenic
1133817929 16:9212428-9212450 CTGTCATGGAATCCCAGCCATGG + Intergenic
1133996135 16:10749990-10750012 CTCACTTTGAAGCCCAGGCTGGG - Intronic
1134183506 16:12065704-12065726 CTGACTGGGAAGCACAACCAGGG - Intronic
1134291586 16:12906005-12906027 ATCACTTGGAGTCCCAGCTATGG + Intronic
1134536760 16:15032621-15032643 CTCACTTGGTGGCCCAGGCTGGG - Intronic
1136424729 16:30162111-30162133 CTCATTTTGAAGGCCAGACATGG + Intergenic
1136922388 16:34343851-34343873 CTCAGGTGGAAGCCATGCCATGG - Intergenic
1136982185 16:35067955-35067977 CTCAGGTGGAAGCCATGCCATGG + Intergenic
1137982766 16:53083943-53083965 CTCACTTTGTTGCCCAGCCTGGG + Intronic
1138048229 16:53748704-53748726 CACACCTGTAATCCCAGCCAAGG - Intronic
1140643930 16:77009581-77009603 CTCAGTAGCAAGACCAGCCATGG + Intergenic
1142611679 17:1111875-1111897 CTCACTTGGAAGCCCAGCCACGG + Intronic
1143104081 17:4519751-4519773 CTAGCTTGGAGGCCCAGCCCAGG + Intronic
1143689928 17:8552833-8552855 CCCCCTGGGAAGCCCAGGCAGGG - Intronic
1144790384 17:17855166-17855188 CTCACTTGGAACTGCAGGCAGGG + Intronic
1146465411 17:33082406-33082428 ATGACTTGGAAGTCCAGGCATGG + Intronic
1151423929 17:74017373-74017395 CTGCCTTGGAGGCCCGGCCAAGG - Intergenic
1151855133 17:76715658-76715680 CGCACTTGGAAGCACTGCCTGGG - Exonic
1152374852 17:79913761-79913783 CTGACTGGGAAGCCCACCCTGGG + Intergenic
1152398185 17:80048006-80048028 CACGCCTGGAATCCCAGCCAAGG + Intronic
1153321517 18:3778587-3778609 CTCACTAGAAGGCCCAGGCAGGG + Intronic
1154089471 18:11344080-11344102 CTCCCTCTGATGCCCAGCCAAGG + Intergenic
1154497204 18:14970709-14970731 CTCACCTGAAACCCCAGGCATGG + Intergenic
1159423829 18:68258182-68258204 CACATGTGTAAGCCCAGCCAAGG - Intergenic
1161553936 19:4929829-4929851 CTCACTTTGTTGCCCAGCCTGGG + Intronic
1162492019 19:10998359-10998381 CTGACTTTGAACCCCTGCCAAGG + Intronic
1162806739 19:13141021-13141043 CTCACTTGGGGGCCCAGGGAGGG - Exonic
1163360637 19:16843996-16844018 CTCACTCCGACGCCCAGCTAAGG + Intronic
1165777738 19:38414806-38414828 TACCCTTGGAAGCCCAGCCTGGG + Intronic
1167143281 19:47666836-47666858 CACACCTGTAATCCCAGCCAAGG - Intronic
1167214674 19:48156621-48156643 CCCACTTGGATTCCCATCCAAGG - Intronic
1167649742 19:50722857-50722879 CTCACTTGGATCTCCAGACAAGG + Intergenic
1167781522 19:51601788-51601810 CTCACATGGAAGGCCAGGTAAGG - Intergenic
1202676397 1_KI270711v1_random:10740-10762 TCCACTTGGAAGCCCAGGCAAGG - Intergenic
926112649 2:10192837-10192859 ATCAGTTGGAAGCTGAGCCATGG - Intronic
927545793 2:23951704-23951726 CTCTCTGGGAGGCCCAGGCAGGG - Intronic
929052831 2:37852664-37852686 GCCTCTTGGGAGCCCAGCCATGG - Intergenic
929091945 2:38226404-38226426 TTCACTTGGAAGGCAAGGCAAGG - Intergenic
930599233 2:53424557-53424579 CTGTGTTGGAAGCCCAGGCAGGG + Intergenic
930709365 2:54535759-54535781 CACACCTGTAATCCCAGCCAAGG + Intronic
931551366 2:63450262-63450284 CTCACATGTAAGCCTAGGCATGG - Intronic
931956780 2:67436087-67436109 CACACTTAGAAGCCCAGACTGGG - Intergenic
932579193 2:72982670-72982692 CTCGCTGGGAGTCCCAGCCAGGG - Intronic
934056042 2:88252608-88252630 CTCTTTTGGAGGCCCTGCCAGGG - Intergenic
936949242 2:117961074-117961096 TTCACTTGGTAACCCACCCATGG + Intronic
939625989 2:144478038-144478060 CACCCATGGATGCCCAGCCAGGG + Intronic
942565689 2:177263876-177263898 CTCTCTTGAAAGCCCAGCCCCGG - Intronic
943677428 2:190729724-190729746 CCCTCTTGGAAGCACAGACAAGG - Intergenic
945065483 2:205944519-205944541 CTCAGGCAGAAGCCCAGCCATGG + Intergenic
945133255 2:206597426-206597448 CACACCTGTAATCCCAGCCAAGG - Intronic
1170824203 20:19779396-19779418 CTCTCTGGGATGCCCAGCCCAGG - Intergenic
1172153199 20:32805100-32805122 CTGACTTTGAAGTCCAGGCAGGG + Intronic
1172884249 20:38220850-38220872 CTGAGTTGGAACCCCACCCAGGG + Intronic
1173364441 20:42372157-42372179 TTCACTTGGAAACATAGCCAAGG - Intronic
1174445892 20:50590843-50590865 CTCACTTCGTTGCCCAGCCTGGG + Intronic
1175200092 20:57270818-57270840 CTCCCTGGGGAGCACAGCCAAGG + Intergenic
1175287773 20:57849326-57849348 CTTACTTGGAAGCCCAGGAATGG + Intergenic
1175621138 20:60448557-60448579 CTCAACAGGAACCCCAGCCAAGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176844602 21:13867063-13867085 CTCACTGGGAAGAGGAGCCAAGG - Intergenic
1178270210 21:31182534-31182556 CTCACCAGGAGGCCCAGCGAGGG + Exonic
1179592576 21:42419112-42419134 CTCAGTGGGGAGCCCAGCCCTGG - Intronic
1180866899 22:19124837-19124859 CTGCCCTGGGAGCCCAGCCAGGG + Intergenic
1182418572 22:30237184-30237206 CCAACTTTGAAGCTCAGCCATGG + Intergenic
1182524762 22:30908196-30908218 CTCACCTGGAAGTGCAGCCCAGG - Intergenic
1182901268 22:33900280-33900302 CCCCCTTGCAAGCCCAGCCCCGG + Intronic
1184257268 22:43294421-43294443 CTCACTTGGAGGCCCTGGCCAGG + Intronic
1184981564 22:48099402-48099424 GTCATTTGGGGGCCCAGCCAGGG - Intergenic
949987229 3:9550957-9550979 GTCACTTGGAATGACAGCCAAGG - Intronic
950145618 3:10647645-10647667 CTCACTTGGAAACTCAGACTGGG + Intronic
950242718 3:11386115-11386137 GTCACTTGGCAGTCCAGCAAGGG - Intronic
953440286 3:42910313-42910335 CTCCCTCTAAAGCCCAGCCAAGG - Intronic
953901600 3:46846810-46846832 CACACCTGGAAGCACACCCAAGG + Intergenic
954026487 3:47787136-47787158 CTCACTTGGCAGCCCAGGCTGGG - Intergenic
956844237 3:73167786-73167808 CTGACTAAGAAGACCAGCCAGGG - Intergenic
957391081 3:79570330-79570352 CTCTCTTGGAAGCCTAAGCAGGG - Intronic
958838181 3:99171367-99171389 CTCACTGGGAACTCCATCCAGGG - Intergenic
960169094 3:114437518-114437540 CTCACTTGGAAGCTGAGGAAAGG - Intronic
960843569 3:121986039-121986061 GACACTTGGCAACCCAGCCAGGG - Intergenic
963249252 3:143087549-143087571 CTCCCTCTGATGCCCAGCCAAGG - Intergenic
964296548 3:155240079-155240101 CAGCCTTGGATGCCCAGCCAGGG - Intergenic
965401977 3:168223246-168223268 CTGGCTTGGGAGCCCAACCATGG - Intergenic
967222549 3:187259822-187259844 CTCACTTGGAAGCTGAGTGAGGG - Intronic
968578601 4:1379328-1379350 CCCACCTGGATGCCCAGGCAGGG - Intronic
968586134 4:1416968-1416990 CCCACTAGGAAGCCCAGCAAGGG - Intergenic
969365903 4:6694202-6694224 ATGCCCTGGAAGCCCAGCCAAGG + Intronic
972003271 4:34066230-34066252 CTCACTAGGAAGCTCAGCTAGGG + Intergenic
982360205 4:154511441-154511463 CACACCTGGAATGCCAGCCAAGG + Intergenic
985865425 5:2510539-2510561 CTCACGTTGAAGCACAGACAGGG - Intergenic
986778605 5:11043971-11043993 CTCACTAGGGAGCCCAGGCAGGG + Intronic
992980417 5:82165149-82165171 CTCACTCTGCAGCACAGCCATGG + Intronic
996368739 5:122730726-122730748 CTTACTCAGGAGCCCAGCCAAGG + Intergenic
997172371 5:131736035-131736057 CACACCTGTAATCCCAGCCAGGG - Intronic
997282861 5:132659546-132659568 CTTGCTTGGAACCCCAGCCATGG - Intronic
997641966 5:135455269-135455291 CTGACCTGGAAGCTCAGCGAAGG + Intergenic
999528148 5:152430941-152430963 GTCACTTGAAAGGCCAGCAAGGG + Intronic
1000288374 5:159847180-159847202 AGCCCTTGGAAGCCAAGCCAAGG + Intergenic
1000521530 5:162300246-162300268 CAGCCTTGGAAGCCCAACCATGG - Intergenic
1002425148 5:179170576-179170598 CTCACAGAGAAGCACAGCCAGGG - Intronic
1006981845 6:38153756-38153778 TTCCCTTGAAAGCCCAGGCAGGG + Exonic
1007788792 6:44297381-44297403 CTCACTCGGATCCCCAGCCCCGG + Intronic
1009995640 6:70892563-70892585 CTCACTTAGAAGCCCAAGCTTGG + Intronic
1013484708 6:110585703-110585725 CAGACTAGGAAGCCAAGCCACGG - Intergenic
1021773327 7:24026779-24026801 CACACTTGGTATCTCAGCCAGGG - Intergenic
1024943971 7:54790712-54790734 CTCACCTGAAACCACAGCCATGG + Intergenic
1026824611 7:73573693-73573715 CTCATCTGGAAGCCAGGCCAAGG + Intronic
1027164065 7:75822304-75822326 CTCACTTGGTGGCCCAGGCAAGG + Intronic
1027465272 7:78507351-78507373 CTTACATGGAAGCCCTGCCCTGG - Intronic
1032239181 7:130148050-130148072 CGCTCTTGGAAGCGCAGCGAGGG - Intergenic
1033559408 7:142517025-142517047 CTCCCTGTGAAGCCCAGCTATGG - Intergenic
1034052177 7:147995297-147995319 CTAACTTGGTGGGCCAGCCATGG + Intronic
1039584882 8:38698386-38698408 ATCAGTTGGGAGCTCAGCCAAGG - Intergenic
1041403395 8:57468815-57468837 CTCACTTGGAAGCCAACTCCAGG - Intergenic
1041741241 8:61159196-61159218 GTCACTTGTAAGCACAACCAAGG - Intronic
1043373384 8:79619456-79619478 CTCACTAGGAAGCCCAAACTGGG - Intronic
1047450967 8:124964702-124964724 CTCACTCTGAAGCCCAGCCAAGG - Intergenic
1049117555 8:140702668-140702690 TTCACATGGAATCACAGCCATGG - Exonic
1049300350 8:141866474-141866496 CTCACCGTGAAGCCCAGACAGGG + Intergenic
1049391883 8:142375856-142375878 ATCAGTTGGAACCCCAGCCTGGG - Intronic
1052840868 9:33289886-33289908 CTCACTTGGGGGCCCAGGGAGGG - Intergenic
1054798616 9:69325347-69325369 CCCACCCGAAAGCCCAGCCACGG - Intronic
1055426339 9:76200745-76200767 ATCACTTGGAGGCCCAGGCAGGG + Intronic
1055769608 9:79703276-79703298 CACACTTGGGAGCCCTGCCCTGG + Intronic
1057863727 9:98662874-98662896 CAGACATGGAAGCCCAGACAAGG + Intronic
1059777542 9:117490716-117490738 TTGACTAGGAAGCCCAGTCAAGG - Intergenic
1061489545 9:130937706-130937728 GTCCCTTGGCAGCCCAGCCTGGG + Intronic
1061649874 9:132038871-132038893 CTCCGTTCGAAGCCCTGCCACGG - Intronic
1061847077 9:133393860-133393882 CTCAACTGGAACCCCAGACAGGG - Intronic
1062047724 9:134432168-134432190 CTCACCTTGAGGGCCAGCCAAGG + Intronic
1062048360 9:134434771-134434793 CTGACTTTGAATCCCAGGCAGGG - Intronic
1062568976 9:137175803-137175825 CTCAGTTGGAAGCACACCCTGGG - Exonic
1185767701 X:2739053-2739075 CTCACTAGGTTGCCCAGACAGGG + Intronic
1186349962 X:8731282-8731304 CACCCTTGGAGCCCCAGCCAGGG - Intronic
1191717073 X:64200994-64201016 TCCACTTGGAAGCCCAGCGGGGG + Intronic
1193656954 X:84210277-84210299 CTCTCTTGGAAACCCAATCAGGG + Intergenic
1196425797 X:115567559-115567581 CTCACTCGGTAGCCCAGGCTTGG - Intronic
1196463851 X:115953328-115953350 CTCACGTGGTAGCCCCGGCAGGG + Intergenic