ID: 1142618058 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:1148069-1148091 |
Sequence | CATCCTTGAAGCTTACCGTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 58 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 49} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142618058_1142618066 | 23 | Left | 1142618058 | 17:1148069-1148091 | CCCCACGGTAAGCTTCAAGGATG | 0: 1 1: 0 2: 0 3: 8 4: 49 |
||
Right | 1142618066 | 17:1148115-1148137 | AGTAAGCCCAAAGGTTGTCGGGG | 0: 1 1: 0 2: 0 3: 0 4: 52 |
||||
1142618058_1142618063 | 14 | Left | 1142618058 | 17:1148069-1148091 | CCCCACGGTAAGCTTCAAGGATG | 0: 1 1: 0 2: 0 3: 8 4: 49 |
||
Right | 1142618063 | 17:1148106-1148128 | GATGAGTGAAGTAAGCCCAAAGG | 0: 1 1: 0 2: 0 3: 9 4: 148 |
||||
1142618058_1142618065 | 22 | Left | 1142618058 | 17:1148069-1148091 | CCCCACGGTAAGCTTCAAGGATG | 0: 1 1: 0 2: 0 3: 8 4: 49 |
||
Right | 1142618065 | 17:1148114-1148136 | AAGTAAGCCCAAAGGTTGTCGGG | 0: 1 1: 0 2: 2 3: 10 4: 91 |
||||
1142618058_1142618064 | 21 | Left | 1142618058 | 17:1148069-1148091 | CCCCACGGTAAGCTTCAAGGATG | 0: 1 1: 0 2: 0 3: 8 4: 49 |
||
Right | 1142618064 | 17:1148113-1148135 | GAAGTAAGCCCAAAGGTTGTCGG | 0: 1 1: 0 2: 1 3: 9 4: 114 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142618058 | Original CRISPR | CATCCTTGAAGCTTACCGTG GGG (reversed) | Intronic | ||