ID: 1142618062

View in Genome Browser
Species Human (GRCh38)
Location 17:1148093-1148115
Sequence TTCACTCATCAGCAGCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142618062_1142618063 -10 Left 1142618062 17:1148093-1148115 CCTGCTTGCTGCTGATGAGTGAA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1142618063 17:1148106-1148128 GATGAGTGAAGTAAGCCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 148
1142618062_1142618065 -2 Left 1142618062 17:1148093-1148115 CCTGCTTGCTGCTGATGAGTGAA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1142618065 17:1148114-1148136 AAGTAAGCCCAAAGGTTGTCGGG 0: 1
1: 0
2: 2
3: 10
4: 91
1142618062_1142618066 -1 Left 1142618062 17:1148093-1148115 CCTGCTTGCTGCTGATGAGTGAA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618062_1142618064 -3 Left 1142618062 17:1148093-1148115 CCTGCTTGCTGCTGATGAGTGAA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1142618064 17:1148113-1148135 GAAGTAAGCCCAAAGGTTGTCGG 0: 1
1: 0
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142618062 Original CRISPR TTCACTCATCAGCAGCAAGC AGG (reversed) Intronic