ID: 1142618066

View in Genome Browser
Species Human (GRCh38)
Location 17:1148115-1148137
Sequence AGTAAGCCCAAAGGTTGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142618056_1142618066 26 Left 1142618056 17:1148066-1148088 CCACCCCACGGTAAGCTTCAAGG 0: 1
1: 0
2: 2
3: 6
4: 92
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618061_1142618066 21 Left 1142618061 17:1148071-1148093 CCACGGTAAGCTTCAAGGATGGC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618055_1142618066 27 Left 1142618055 17:1148065-1148087 CCCACCCCACGGTAAGCTTCAAG 0: 1
1: 1
2: 1
3: 6
4: 109
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618062_1142618066 -1 Left 1142618062 17:1148093-1148115 CCTGCTTGCTGCTGATGAGTGAA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618058_1142618066 23 Left 1142618058 17:1148069-1148091 CCCCACGGTAAGCTTCAAGGATG 0: 1
1: 0
2: 0
3: 8
4: 49
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618059_1142618066 22 Left 1142618059 17:1148070-1148092 CCCACGGTAAGCTTCAAGGATGG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142618066 Original CRISPR AGTAAGCCCAAAGGTTGTCG GGG Intronic