ID: 1142618066

View in Genome Browser
Species Human (GRCh38)
Location 17:1148115-1148137
Sequence AGTAAGCCCAAAGGTTGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142618055_1142618066 27 Left 1142618055 17:1148065-1148087 CCCACCCCACGGTAAGCTTCAAG 0: 1
1: 1
2: 1
3: 6
4: 109
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618062_1142618066 -1 Left 1142618062 17:1148093-1148115 CCTGCTTGCTGCTGATGAGTGAA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618061_1142618066 21 Left 1142618061 17:1148071-1148093 CCACGGTAAGCTTCAAGGATGGC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618056_1142618066 26 Left 1142618056 17:1148066-1148088 CCACCCCACGGTAAGCTTCAAGG 0: 1
1: 0
2: 2
3: 6
4: 92
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618059_1142618066 22 Left 1142618059 17:1148070-1148092 CCCACGGTAAGCTTCAAGGATGG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1142618058_1142618066 23 Left 1142618058 17:1148069-1148091 CCCCACGGTAAGCTTCAAGGATG 0: 1
1: 0
2: 0
3: 8
4: 49
Right 1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142618066 Original CRISPR AGTAAGCCCAAAGGTTGTCG GGG Intronic
904345688 1:29867275-29867297 AGCAAGCCCCAAGGATGTCTGGG - Intergenic
913591679 1:120334738-120334760 AGAAAGCCCAAATTATGTCGTGG + Intergenic
919626719 1:199918146-199918168 AGTAAGCCCAGTGTTTGTCAGGG + Intergenic
922536761 1:226386669-226386691 AGGAAGCCCTAAGGGTGTGGGGG + Intronic
924732335 1:246723945-246723967 AGCAAGCTCAAGGGTTCTCGGGG + Intergenic
1068084380 10:52356628-52356650 AGTAAGACCAAAGTTTATCTTGG + Intergenic
1070295134 10:75154101-75154123 AGTAAGCCCACAGGATGGAGTGG + Intronic
1087062478 11:93993789-93993811 AGTAAGCCCAAATATTTTCCAGG + Intergenic
1088511667 11:110581957-110581979 AGAAAGCCCAGAGGTAGTAGAGG - Intronic
1089131723 11:116217679-116217701 AGTGTGCCCAAAGGTTTTCATGG + Intergenic
1091514757 12:1168007-1168029 AAGAAGCCCAAAGGCTGACGGGG - Intronic
1107417313 13:40212581-40212603 AGTAAGCACAGAGTCTGTCGGGG - Intergenic
1108287751 13:48925567-48925589 AGTAAGCCATAAGGCTATCGGGG + Intergenic
1119324299 14:73750510-73750532 AGAGAGCCCAAAGGGTGTTGAGG + Intronic
1120272491 14:82331249-82331271 AGTGAGCCCAAAGGTTGGTAGGG - Intergenic
1126456879 15:48872488-48872510 TGTAAGCCCAAAGCTTCTAGGGG + Intronic
1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG + Intronic
1143449170 17:7025478-7025500 GGTCAGCCCAAAGCTTGTCAGGG + Intronic
1146272395 17:31492900-31492922 AGTAACCACCAAGGTTGTCTGGG - Intronic
1165393199 19:35549952-35549974 AGAAAGCCCAGAGGTGGTAGGGG + Intergenic
931653083 2:64486191-64486213 AGTAAACACAAAGGTTGCCTGGG + Intergenic
1182490099 22:30665974-30665996 AGAAAGACCAAAGGTTGTATAGG + Intronic
952756849 3:36876525-36876547 AGTAAGCCTGAAGGTTCTGGTGG + Intronic
955226784 3:57066836-57066858 AGTGAGCCCAAAGGCTCTCTGGG - Intronic
957840575 3:85663526-85663548 AGTGAGCACAGAGGTTGTTGGGG - Intronic
962348591 3:134640579-134640601 ACAGAGCCCAAAGGTTGTCAAGG + Intronic
970056959 4:11984782-11984804 AGTATGCCCAAATCTTGTCATGG - Intergenic
980643740 4:135614856-135614878 ATTTAGCCCAAAGGTTTTCATGG - Intergenic
990650206 5:57889704-57889726 AGAATGCCCAAAGGTTGGTGTGG + Intergenic
990737651 5:58881347-58881369 AGTAAGCTAAAAGGTTCTTGAGG + Intergenic
992507742 5:77404923-77404945 AATAAGCTCAAAGGTTTTAGGGG + Intronic
1006983168 6:38161864-38161886 GGTCAGCCCAAAGGTTGGGGTGG - Intergenic
1016826240 6:148390882-148390904 TCTAAGCCCAAAGGGTGTCTAGG + Intronic
1021107357 7:16653172-16653194 AGGAAGCTCAAAGGTGGTGGTGG - Intronic
1028438521 7:90831922-90831944 AGTAAGTCCAAAGGTTCTGAGGG - Intronic
1031572495 7:123376561-123376583 AGTAAGCCTCATGGTTGTCCTGG + Intergenic
1034829233 7:154294831-154294853 AACAAGCCCACAGATTGTCGGGG - Intronic
1040287788 8:46109323-46109345 AACAAGGCCACAGGTTGTCGTGG - Intergenic
1040743624 8:50612177-50612199 AGAAAGCACAAAGGTTGACAAGG - Intronic
1043666250 8:82818802-82818824 AATAAGTCAAAAGGTTGTAGGGG - Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047202418 8:122778586-122778608 ATTAAGTCCAAAGGTGGTTGAGG + Intergenic
1048780101 8:137990714-137990736 AGTAAGCTCAAAGGGGGTTGTGG - Intergenic
1050983574 9:12052803-12052825 ATTAAGCCCAAAGTTAGTTGAGG - Intergenic
1185893349 X:3838637-3838659 ACTCGGCCCAGAGGTTGTCGAGG - Intronic
1185898463 X:3877061-3877083 ACTCGGCCCAGAGGTTGTCGAGG - Intergenic
1185903578 X:3915490-3915512 ACTCGGCCCAGAGGTTGTCGAGG - Intergenic
1186234789 X:7496056-7496078 CGTAAGCACAAAGGTTTTCCTGG + Intergenic
1193575099 X:83186328-83186350 AGAAATCCCAAAGCCTGTCGGGG + Intergenic
1193855819 X:86600322-86600344 AGTAAACCCAAAAGTTTTCATGG - Intronic
1195302597 X:103545473-103545495 ACTAAGCCCAAAGTTAGTAGAGG + Intergenic
1195412005 X:104577658-104577680 AGAAAGCACAAGGGTGGTCGGGG + Intronic
1198915313 X:141664319-141664341 AGTAGGCTCAAAGGTTGGAGTGG - Intronic