ID: 1142619166

View in Genome Browser
Species Human (GRCh38)
Location 17:1154159-1154181
Sequence AGGATCATGAAGGACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142619166_1142619176 7 Left 1142619166 17:1154159-1154181 CCTCCCAGGTCCTTCATGATCCT 0: 1
1: 0
2: 3
3: 21
4: 232
Right 1142619176 17:1154189-1154211 CTGCCGCGGCTGCCACTTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 170
1142619166_1142619175 6 Left 1142619166 17:1154159-1154181 CCTCCCAGGTCCTTCATGATCCT 0: 1
1: 0
2: 3
3: 21
4: 232
Right 1142619175 17:1154188-1154210 CCTGCCGCGGCTGCCACTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 194
1142619166_1142619179 23 Left 1142619166 17:1154159-1154181 CCTCCCAGGTCCTTCATGATCCT 0: 1
1: 0
2: 3
3: 21
4: 232
Right 1142619179 17:1154205-1154227 TTCTGGGAGATTCATCTCTAAGG 0: 1
1: 0
2: 2
3: 17
4: 220
1142619166_1142619180 30 Left 1142619166 17:1154159-1154181 CCTCCCAGGTCCTTCATGATCCT 0: 1
1: 0
2: 3
3: 21
4: 232
Right 1142619180 17:1154212-1154234 AGATTCATCTCTAAGGCCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1142619166_1142619171 -7 Left 1142619166 17:1154159-1154181 CCTCCCAGGTCCTTCATGATCCT 0: 1
1: 0
2: 3
3: 21
4: 232
Right 1142619171 17:1154175-1154197 TGATCCTGGTGTCCCTGCCGCGG 0: 1
1: 0
2: 2
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142619166 Original CRISPR AGGATCATGAAGGACCTGGG AGG (reversed) Intronic
900463129 1:2810827-2810849 AGGAACAGGAAGGGCCTGTGCGG - Intergenic
901715374 1:11149399-11149421 AGGTTGATGAAGGTGCTGGGAGG + Intronic
903576488 1:24342652-24342674 AGGGTCACCAAGGGCCTGGGAGG - Intronic
904341333 1:29836899-29836921 AGGTTCAGGAAGGAGCTGGAGGG - Intergenic
905211640 1:36378428-36378450 AGTATTACAAAGGACCTGGGAGG + Intronic
905314975 1:37076584-37076606 ATGATCAGGAAGGATCTGTGGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906113410 1:43339288-43339310 AGTATCATCAAGGCCATGGGTGG + Exonic
906495911 1:46303687-46303709 AGGATCAAGAAGGACTTGTAAGG - Exonic
907068999 1:51518143-51518165 AGGAGCAGGAAGGAACTGGCAGG + Intronic
909044807 1:70697053-70697075 AAGAACATGAAGGATATGGGAGG + Intergenic
909321251 1:74288466-74288488 AGCAACATGAATGAACTGGGAGG + Intronic
910291636 1:85605680-85605702 GGGATCATTAACTACCTGGGAGG + Intergenic
910318556 1:85917778-85917800 AGGATCAAGCTGAACCTGGGAGG - Intronic
911706607 1:101020972-101020994 AGGACCATGTAAGACCTTGGAGG - Intronic
912409177 1:109467578-109467600 AGGATCATCCAGGCCCTGGTGGG - Intronic
914360613 1:146932828-146932850 AGGATCAAGAAGGTCCGGGAAGG - Intergenic
914491973 1:148157811-148157833 AGGATCAAGAAGGTCCGGGAAGG + Intergenic
915290001 1:154877201-154877223 GGTTTCATGGAGGACCTGGGTGG - Intergenic
917033749 1:170723226-170723248 TGCAGCATGAAGGGCCTGGGTGG - Intronic
918150413 1:181793735-181793757 AGGAGCATGCGGGATCTGGGAGG + Exonic
918245143 1:182652753-182652775 GGGGTCATGAAGGACCCAGGAGG + Intronic
919438349 1:197592547-197592569 AGGATCATGAAGGAACTAGACGG + Intronic
920862900 1:209725381-209725403 AAGTACATGAAGGACCAGGGAGG - Intronic
922715711 1:227870132-227870154 ATGGTCATGAATGACCTGGCAGG + Intergenic
922719640 1:227893656-227893678 AGGAGAATGCAGGAGCTGGGAGG + Intergenic
923360451 1:233205998-233206020 AGCATAATGAAGGACGGGGGAGG + Intronic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
1063724124 10:8618035-8618057 AGAATCCTGCAGGCCCTGGGAGG - Intergenic
1063856992 10:10266110-10266132 AGTATCATGAGAGACCTAGGAGG - Intergenic
1064611657 10:17109649-17109671 AGGAGCATGAGGCATCTGGGTGG + Exonic
1069314620 10:67081806-67081828 AGGATCAGGAAAGACCTCAGAGG - Intronic
1069552282 10:69372956-69372978 AGAATCACGTAGAACCTGGGAGG - Intronic
1069781176 10:70956631-70956653 AGGCACCTGAAAGACCTGGGAGG + Intergenic
1070550072 10:77483988-77484010 AGGATCTAGGAGGACCAGGGTGG + Intronic
1073156413 10:101350715-101350737 AGGATCATGAAGGGGTTAGGGGG - Intergenic
1074168506 10:110908546-110908568 AGGATCCTGAAGGATGGGGGTGG + Intronic
1075490104 10:122859466-122859488 AGGATCAAGAAGGATTTGAGAGG - Intronic
1075995326 10:126872224-126872246 AAGCTCATGCAGGCCCTGGGGGG + Intergenic
1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG + Exonic
1080643670 11:34173293-34173315 AGCAGCATGAAGGGCCTGTGGGG + Exonic
1081784026 11:45733728-45733750 AGGGTCATGCAGGGCCTGGGAGG - Intergenic
1084182133 11:67452123-67452145 AGGATGCTGGAGGTCCTGGGGGG - Exonic
1084440701 11:69171194-69171216 GCAATCATGAAGGACCTGGTGGG - Intergenic
1084603738 11:70161103-70161125 AGGCCCAGGAAGGTCCTGGGTGG + Intronic
1085394366 11:76199699-76199721 AGGCTGAGGCAGGACCTGGGAGG + Intronic
1086329320 11:85737922-85737944 AGGGTCACGGAGGCCCTGGGTGG + Intronic
1088058000 11:105609539-105609561 AGGCTGATGAAGGACCAGAGGGG - Intergenic
1089323459 11:117641855-117641877 AGCACCATGAAGGGCCTGGCTGG - Intronic
1090958474 11:131535037-131535059 AGCAGCATCAAGGACCTGAGAGG - Intronic
1091186494 11:133652299-133652321 AGTATCATGAAAGGCCTGGCTGG - Intergenic
1091250165 11:134137518-134137540 AAGACCATCAAGGACCTGAGAGG - Intronic
1093547405 12:20365379-20365401 AAGATCATGAAGGTCCTTGTAGG + Intergenic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1096494805 12:52033784-52033806 AGGATCAAGAACTACCTGGCCGG - Intronic
1097114644 12:56688400-56688422 AGGATCGCGAAGGAGCTGGGAGG - Intronic
1097973400 12:65659406-65659428 TGGATCATGCAGGACCTCGCAGG - Intergenic
1101839231 12:108316041-108316063 AGGATTATGAACTTCCTGGGGGG - Intronic
1102520404 12:113474585-113474607 ATGATCATGAAGCACGTGGTGGG - Intergenic
1103108297 12:118251016-118251038 GGGACCATGAAGGACCTTGTGGG + Intronic
1104928922 12:132328333-132328355 AGGATCATGCAGGGCTTGGCAGG - Intronic
1107114008 13:36726976-36726998 AAGACCAGGAAGGTCCTGGGTGG - Intergenic
1107196806 13:37662007-37662029 AGGATCAAGAAGGAGCTGGAAGG + Intronic
1107964878 13:45589258-45589280 AGGATCAGAGAGGCCCTGGGGGG - Intronic
1108416165 13:50200177-50200199 AGGATCATGATGGATTTGGGTGG + Intronic
1113182387 13:107644821-107644843 AGGATCATCACTGATCTGGGTGG - Intronic
1114439627 14:22735823-22735845 AGGGTCATGAAAGACTTGTGGGG - Intergenic
1115722555 14:36178611-36178633 GGGACCATGATGGCCCTGGGAGG + Intergenic
1116081554 14:40180279-40180301 AGGAACATGAAGGACATGAGAGG - Intergenic
1117211898 14:53509408-53509430 AGGGTCTTGAAGGAGGTGGGTGG + Intergenic
1117299375 14:54409098-54409120 AGGAACAGTAAAGACCTGGGGGG - Intronic
1117335888 14:54757019-54757041 AGGATCAGTAAAGACTTGGGTGG + Intronic
1119517539 14:75259828-75259850 AGAATCCCAAAGGACCTGGGTGG + Intronic
1121176205 14:91892465-91892487 GGGATCAAGATGGATCTGGGAGG - Intronic
1121313158 14:92945995-92946017 AGGAGCAGGAAGGACCTTGAAGG - Intronic
1122322866 14:100866153-100866175 GGGCTCATGAACGGCCTGGGTGG + Intergenic
1122420918 14:101576803-101576825 AGCATCCTGGATGACCTGGGTGG + Intergenic
1202852703 14_GL000225v1_random:31123-31145 CGGATCCTGGAGCACCTGGGTGG - Intergenic
1127369814 15:58329264-58329286 AGGAACATGGATGAGCTGGGAGG + Intronic
1129656125 15:77526825-77526847 AGGCTCATGCAGGCCCTGGCAGG - Intergenic
1129988164 15:79936891-79936913 ATGAGCATGAAGGACCTGGGGGG - Intergenic
1130417226 15:83705243-83705265 AAGATGATGTAGGGCCTGGGTGG + Intronic
1130635776 15:85618532-85618554 TGGATCATGAATGATTTGGGAGG - Intronic
1133113684 16:3564284-3564306 AGGATCAGGAGGGCCCTGGCTGG + Exonic
1133295876 16:4752048-4752070 TGGCTCCTGAAGGGCCTGGGAGG - Exonic
1134130908 16:11649482-11649504 AGGATCATGAAGCTGGTGGGTGG + Intergenic
1136636624 16:31528450-31528472 AGGATCATTGAAGACCTGGGGGG - Exonic
1138193736 16:55036803-55036825 AGGCTCCTGAAGGACAAGGGTGG + Intergenic
1139531221 16:67543643-67543665 ATGGGCATGAAGGACATGGGAGG - Intronic
1140196033 16:72856352-72856374 AGTGTCATGCAAGACCTGGGGGG + Intronic
1140596136 16:76415678-76415700 AGGAGCATGAAGGAACTGTTGGG - Intronic
1141281725 16:82635263-82635285 AGGCAGATGAAGGATCTGGGCGG + Intronic
1142619166 17:1154159-1154181 AGGATCATGAAGGACCTGGGAGG - Intronic
1143185105 17:5005209-5005231 AGGATCCAGAAGGACCTGTCAGG + Intronic
1143565004 17:7715900-7715922 AGGGTAATGAAGGTTCTGGGAGG + Intergenic
1143627477 17:8118795-8118817 AGGATCCTGCAGGCCCAGGGCGG - Exonic
1147057565 17:37846072-37846094 ATGAGCATAAAGGAACTGGGTGG + Intergenic
1147806297 17:43134247-43134269 TGGATCATGAAGGAGGGGGGCGG - Intergenic
1148394935 17:47300219-47300241 AGTTTAATGAAGGACCTGGGAGG + Intronic
1150398592 17:64839336-64839358 TGGATCATGAAGGAGGGGGGCGG + Intergenic
1150877402 17:68985258-68985280 AGGTTCATAAAGTACCTAGGTGG - Intronic
1151803302 17:76390433-76390455 AGGACTAGGGAGGACCTGGGTGG + Exonic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1153743996 18:8158307-8158329 AAGATCATGAAGCACTTGGGTGG - Intronic
1155009662 18:21764269-21764291 AGGATCAGGAAGGAAGAGGGAGG - Intronic
1158508535 18:58068813-58068835 AGGAGCATGAAGGACCTGGAGGG - Intronic
1158644133 18:59229249-59229271 AGGAAGATCAAGGAACTGGGAGG - Intronic
1159649827 18:70964953-70964975 AGAATCCTGAAGGAGATGGGAGG + Intergenic
1160836462 19:1126963-1126985 AAGCTCCTGAAGGACCTGGGTGG - Intronic
1160915901 19:1496393-1496415 AGAATCATGAACGACCTCAGCGG + Exonic
1162823876 19:13239128-13239150 AGCACCAGGAAGGGCCTGGGAGG - Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1164714515 19:30381584-30381606 TGGAGCATGAGGGACCAGGGAGG + Intronic
1165386306 19:35512503-35512525 AGGATCCAGAGGGACCAGGGAGG + Intronic
1167285727 19:48598000-48598022 AGGACCCTGAAGTATCTGGGTGG - Intronic
926087309 2:10028575-10028597 TGGAGCATGAGGGGCCTGGGGGG - Intergenic
927066161 2:19473055-19473077 ATCATCAAGAAGGACCTTGGAGG - Intergenic
927591853 2:24363448-24363470 AGGATGATGAAGGTCCTGGGCGG - Intergenic
932008102 2:67947830-67947852 AGGAACATGAAGGAACTGTTTGG - Intergenic
932194549 2:69772036-69772058 AGGGTTATGAAGAACATGGGTGG - Intronic
932489906 2:72114065-72114087 AGGGTCATGACAGACCTGAGGGG - Intergenic
934131789 2:88955619-88955641 AGGATCATGAGTGACCTGAGGGG + Intergenic
934133291 2:88970254-88970276 AGGATCATGAGTGACCTGAGGGG + Intergenic
934136048 2:88997436-88997458 AGGATCATGAGTGACCTGAGGGG + Intergenic
934234271 2:90216336-90216358 AGGATCATGAGTGACCTGAGGGG - Intergenic
934853756 2:97716732-97716754 GGCATCATGAAGGGCCTTGGGGG + Intronic
935268200 2:101412245-101412267 AGACTCAGGGAGGACCTGGGAGG - Intronic
935513245 2:104002249-104002271 AGGATCATGAACAACAGGGGTGG - Intergenic
935595016 2:104871730-104871752 GGGATCATAAAGTACCTAGGAGG + Intergenic
938650735 2:133380833-133380855 AGGATCATGCAGGAACTCAGGGG - Intronic
940368571 2:152876178-152876200 AGGATCATGAAGGGTCTTGTTGG - Intergenic
943750180 2:191502583-191502605 AGGCTGAGGCAGGACCTGGGAGG - Intergenic
946208156 2:218125830-218125852 AGGATCCTCAAGGACCAGAGAGG + Intronic
948982331 2:241500759-241500781 ATCATCATGGAGTACCTGGGCGG - Exonic
1169264001 20:4156681-4156703 AGGATCTGGAAGGACCTGTCTGG + Intronic
1169742114 20:8906318-8906340 AGGAAGATGCAGGAACTGGGAGG - Intronic
1172436515 20:34932426-34932448 AGGATCTTGAAGGCCATGGTAGG - Intronic
1173109750 20:40175582-40175604 AGGATTATAAAGGGCCTGGCAGG - Intergenic
1173430403 20:42982715-42982737 CTGCTCATCAAGGACCTGGGAGG - Intronic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1173993235 20:47318885-47318907 AGGAACATCAAGTACCTCGGAGG + Intronic
1174003209 20:47389868-47389890 AAGATCATGGAGGAACTTGGAGG - Intergenic
1174974712 20:55319164-55319186 AGGTTCATGGAGGAGCAGGGAGG + Intergenic
1175379716 20:58554393-58554415 AGCCTCATGAATGACCTGGATGG + Intergenic
1175937671 20:62521924-62521946 AGGAGCCTGAAGAACCCGGGAGG - Intergenic
1177968289 21:27757196-27757218 ATGATTATGAAGGACCTAGCTGG + Intergenic
1179827909 21:43978231-43978253 AGGAGTATTTAGGACCTGGGTGG - Intronic
1180161345 21:45999908-45999930 AGGATCATGGGGGACATGTGAGG + Intronic
1180161367 21:45999992-46000014 AGGATCATGGGGGACCCGTGAGG + Intronic
1180713539 22:17856401-17856423 AGGAGAATGAAGGGCCAGGGAGG - Intronic
1180901345 22:19375593-19375615 AGGACCCTGAAGGACCAGGCAGG - Intronic
1181796717 22:25316943-25316965 AGAATCATCTAGAACCTGGGAGG + Intergenic
1182154512 22:28056765-28056787 AGGATCATGAAGGAACTTTCTGG - Intronic
1183041603 22:35183330-35183352 AGCTTGATGAAGGACCTGAGTGG - Intergenic
1184110915 22:42394336-42394358 AGGATCAATAAGGACATGGAGGG - Intronic
1184201106 22:42970346-42970368 AAAATCATCAAGGACCTGGATGG + Intronic
1184750315 22:46482234-46482256 AGTATCCTGGAGGATCTGGGTGG + Intronic
1184881254 22:47305696-47305718 AGAATCATTAAGGTTCTGGGAGG - Intergenic
1185092804 22:48785383-48785405 AGGAGCATGAAGGGCCTTTGGGG + Intronic
949458899 3:4269072-4269094 AGGATCATCACTGATCTGGGTGG - Intronic
950172891 3:10851757-10851779 AGGGTCAGGGAGGAGCTGGGAGG + Intronic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952816797 3:37453125-37453147 AGGGTCTTGTAGGAGCTGGGGGG - Intronic
953370962 3:42388067-42388089 AGGATGATGAATGAACAGGGGGG - Intergenic
953721027 3:45355307-45355329 AGGTTGGGGAAGGACCTGGGAGG + Intergenic
954092969 3:48300238-48300260 AAGATCATGCAGAGCCTGGGAGG - Intronic
954615054 3:51965246-51965268 TGGATCATGAAGGTCCTTGATGG - Intronic
959186064 3:103049593-103049615 ATGGTCATGAATGACCTTGGAGG + Intergenic
961174145 3:124820299-124820321 AGGATGAAGCAGGACCTGTGGGG - Intronic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
962925289 3:139987713-139987735 AGGAAGATCAAGGACATGGGAGG - Intronic
964561973 3:158007186-158007208 AGGATTGTGAGGGACCTGGTTGG + Intergenic
966372911 3:179266941-179266963 ATGATCAAGAAGGACCTGCGTGG + Intronic
968936797 4:3615380-3615402 AACAGCAGGAAGGACCTGGGTGG - Intergenic
969579261 4:8054533-8054555 AGGGTCTTGAGGAACCTGGGGGG + Intronic
970184704 4:13438513-13438535 AGAATCATGAAATACATGGGTGG + Intronic
974096716 4:57372264-57372286 AGGAGCATGAATGAGCTGTGAGG - Intergenic
974126270 4:57700138-57700160 AGGAAGATGATTGACCTGGGAGG + Intergenic
977092381 4:92694188-92694210 AGGAGCAGGAAGCACCTGGTTGG + Intronic
977567982 4:98600775-98600797 TGGATCATGAAGGACCTTAATGG + Intronic
979530080 4:121760811-121760833 CAGATCCTGAAGGACATGGGTGG - Intronic
981301933 4:143196963-143196985 ATGATAATGTAGGACCAGGGTGG - Intronic
984245900 4:177275116-177275138 GGGATCATGATGGGCCAGGGTGG - Intergenic
984657019 4:182329184-182329206 AGGATCGTGAAGGACCAAGCTGG + Intronic
985155713 4:186985061-186985083 AGGATCATGACTGGCCAGGGCGG + Intergenic
985750813 5:1673233-1673255 AGGAGCATGAAGGGCCGGGGAGG + Intergenic
986665846 5:10103421-10103443 AGGAAGATGAAGTGCCTGGGCGG + Intergenic
987586770 5:19865624-19865646 ATGAGCATTAAGCACCTGGGTGG - Intronic
989618127 5:43357652-43357674 AGGAACATCAGAGACCTGGGTGG - Intergenic
990952779 5:61314212-61314234 ATGAGCAGGAATGACCTGGGTGG - Intergenic
995436698 5:112144372-112144394 AGGATCATCTAAGCCCTGGGAGG - Intronic
997367766 5:133336756-133336778 GGGAGGATGAAGGACCTGGCTGG - Intronic
997636542 5:135411213-135411235 GGGATCATGAAGGATCTTGTTGG + Intergenic
998624108 5:143825970-143825992 AGGATTGTGAAGGAGCTGGGAGG - Intergenic
998670296 5:144345992-144346014 AGGGTAATGAGGGACTTGGGGGG - Intronic
998893213 5:146768759-146768781 AGGAACAGGAAAGAGCTGGGAGG - Intronic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
999522340 5:152363788-152363810 AGGATGATGAAGTACCAAGGAGG - Intergenic
999858031 5:155616554-155616576 AGGAGCATGATGGAACTGGATGG - Intergenic
1000096992 5:157979980-157980002 AGAATCATTTAGAACCTGGGAGG + Intergenic
1002634439 5:180600139-180600161 GGGATCTTGAAGGAGCTTGGCGG - Intergenic
1005915079 6:30344692-30344714 AGGATCATGAGGGTGCTGGAGGG - Intronic
1006339075 6:33436299-33436321 AGAATCAGTAAGGGCCTGGGGGG - Intronic
1007622289 6:43222582-43222604 AGGAAGGTGAAGGATCTGGGCGG - Exonic
1007807740 6:44463140-44463162 AGTATCATGAAGGGCATGGGCGG - Intergenic
1009774936 6:68194500-68194522 AGGAGCAGCAAGGAGCTGGGAGG + Intergenic
1014467466 6:121773772-121773794 AGGATCAGCAAGGACGTGGTGGG + Intergenic
1015862206 6:137692727-137692749 AGGATGATGAAGGATATGGTAGG - Intergenic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1016906115 6:149152347-149152369 AGGCTCTTGAAGTAACTGGGTGG - Intergenic
1017535361 6:155341570-155341592 GGGATGATTAAGGACCTGGGTGG - Intergenic
1018778668 6:167043184-167043206 TGGTTCATGAAGGACATGGGAGG + Exonic
1020175111 7:5876092-5876114 AGGATCACTTAGAACCTGGGAGG - Intergenic
1021636494 7:22699243-22699265 AGGACCTTGCAGGACATGGGAGG + Intergenic
1022091612 7:27111275-27111297 AGGTCCAAGAAGGAGCTGGGTGG - Intronic
1023054367 7:36279651-36279673 AGGCTGAGGGAGGACCTGGGCGG + Intronic
1024543299 7:50496842-50496864 AGAAGCTTGAGGGACCTGGGGGG + Intronic
1027360850 7:77408076-77408098 AGGAGCATGAAGGACTTCTGAGG + Intronic
1029111226 7:98213921-98213943 ATGAGGATGAAGCACCTGGGCGG - Intergenic
1029176152 7:98665979-98666001 GGGAAAATGAAGGAACTGGGGGG - Intergenic
1031102795 7:117503007-117503029 AGTATAAAGAAGGACCTGGGTGG + Intronic
1031478653 7:122252143-122252165 GGGGTCAGGAGGGACCTGGGGGG + Intergenic
1033150931 7:138914397-138914419 AGGGTCAGAAAGGCCCTGGGTGG + Intronic
1033165552 7:139035935-139035957 ATGTTCCTGAAGGACCTGCGCGG - Exonic
1035198010 7:157239415-157239437 AGGATCCTGATGCTCCTGGGAGG + Intronic
1035287219 7:157814239-157814261 TGGAGCTTTAAGGACCTGGGAGG - Intronic
1035485558 7:159221629-159221651 GGGCTCATGGAGAACCTGGGTGG - Intergenic
1035825447 8:2639845-2639867 AGGATAATGAAGGTCAAGGGGGG + Intergenic
1038351412 8:26779544-26779566 AGGATGATGAAGGAACGTGGTGG + Intronic
1038587373 8:28801982-28802004 AGGATCATGAAGTACAGGTGTGG + Intronic
1038745326 8:30249697-30249719 TGGATCCTGATGAACCTGGGTGG - Intergenic
1039864053 8:41485647-41485669 ATCTTTATGAAGGACCTGGGAGG + Intergenic
1042647879 8:71007328-71007350 AGGATCACGAAGGACTGGTGTGG + Intergenic
1043092697 8:75925185-75925207 AGGAACATGAATGACCTGATGGG + Intergenic
1043316996 8:78935353-78935375 ATGATAATAAAGGAGCTGGGAGG - Intergenic
1043970547 8:86523893-86523915 TGGATCTTGAAGAACTTGGGTGG + Intronic
1045579351 8:103461871-103461893 AGGAACATGAAGGAGTTGGTGGG - Intergenic
1046521854 8:115335186-115335208 AGGACCAGGAAAGACCTTGGGGG - Intergenic
1049196729 8:141319976-141319998 AGGCTCAGGAAGGGCCAGGGAGG + Intergenic
1049566582 8:143343379-143343401 AGGGTCATGAAGAGCTTGGGAGG - Intronic
1052273587 9:26653336-26653358 AGGATGGTGAAGGACCCCGGGGG + Intergenic
1056463436 9:86830266-86830288 AGGATCCTGAAGGTGCAGGGTGG - Intergenic
1059607438 9:115849446-115849468 GGGATCATGAAAGGCTTGGGAGG - Intergenic
1059691281 9:116687756-116687778 AGAAATATGAAGGAACTGGGGGG + Intronic
1059883639 9:118720175-118720197 TGAATAATGACGGACCTGGGTGG - Intergenic
1060666565 9:125435533-125435555 AGGTCCATGAAGAAGCTGGGAGG + Intergenic
1061177432 9:129006231-129006253 AACATCAGGAGGGACCTGGGAGG - Exonic
1061676921 9:132222698-132222720 AGAATCCTGCAGGTCCTGGGTGG - Intronic
1062502763 9:136858383-136858405 AGGAACCTGCAGGACATGGGTGG - Exonic
1186146574 X:6630488-6630510 AGACTCAAGAAAGACCTGGGAGG - Intergenic
1186938006 X:14472516-14472538 AGGTTCAGGAAGGAGGTGGGAGG - Intergenic
1189269931 X:39744056-39744078 ATGACCCTGAATGACCTGGGGGG + Intergenic
1190290683 X:48990248-48990270 TGGAACCTGAAGGATCTGGGTGG - Intronic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1195938112 X:110144465-110144487 TGGAATATGAAGGACCTGAGTGG - Intronic
1197187012 X:123598841-123598863 AGGCTCATGAATGAGCTTGGGGG - Intergenic
1197952829 X:131916628-131916650 ATGATCATGAAAGACTTGGAAGG - Intergenic